| Column number: Node in JAR3D model: Insertion positions indicated by I: Position in motif group: | 1 1 I | 2 2 1 | 3 2 I | 4 3 2 | 5 3 I | 6 4 3 | 7 5 I | 8 6 4 | 9 7 I | 10 8 5 | 11 8 I | 12 8 6 | 13 8 I | 14 8 7 | 15 8 I | 16 8 8 | 17 8 I | 18 8 9 | 19 8 I | 20 8 10 | 21 8 I | 22 8 11 | 23 8 I | 24 8 12 | 25 8 I | 26 8 13 | 27 8 I | 28 8 14 | 29 8 I | 30 8 15 | 31 8 I | 32 8 16 | 33 8 I | 34 8 17 | 35 3 I | 36 3 18 | 37 2 I | 38 2 19 | 39 1 I | In acceptance region | Cutoff score | Full edit distance | Interior edit distance | Alignment score deficit |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| HL_12758.3_Instance_1 HL_12758.3,HL_8U5Z_001,C6_G31 | C | G | A | A | G | G | U | GA | G | G | A | G | A | G | G | C | G | A | G | G | AA | G | A | G | ||||||||||||||||||||
| HL_12758.3_Sequence_1 HL_12758.38U5Z_C6_G31 | C | G | A | A | G | G | U | GA | G | G | A | G | A | G | G | C | G | A | G | G | AA | G | A | G | true | 87 | 0 | 0 | 3.24 | |||||||||||||||
| HL_12758.3_Instance_2 HL_12758.3,HL_5V3F_001,C4_G28 | C | G | A | A | G | G | G | AC | G | G | U | G | C | G | G | A | G | A | G | G | A | G | A | G | ||||||||||||||||||||
| HL_12758.3_Sequence_2 HL_12758.35V3F_C4_G28 | C | G | A | A | G | G | G | AC | G | G | U | G | C | G | G | A | G | A | G | G | A | G | A | G | true | 100 | 0 | 0 | 0.00 |
1 2 s35 1 19 cWW 2 4 s33 2 18 tSH 3 4 s35 4 18 s35 5 6 s35 5 8 cWH 5 15 cHW 5 16 s35 6 7 s33 6 8 s53 6 9 cWH 6 16 cHW 7 10 cHW 7 17 cWH 8 9 s35 8 11 cWH 9 10 s33 9 11 s53 9 12 cWH 10 13 cHW 11 12 s35 11 14 tSH 11 15 cWH 12 13 s33 12 14 s55 12 15 s53 12 16 cWH 13 17 cHW 15 16 s35 16 17 s33 18 19 s35 2 5 6BPh 4 2 7BR 14 11 6BRJAR3D SCFG/MRF model for HL_12758.3:
Character Definition | A,C,G,U,* // Identity and order of characters in matrices InitialNode | Left Length Distribution [0.999900000,0.000100000] | Left Letter Distribution [0.000000000,0.000000000,0.000000000,0.000000000,0.000000000] | Right Length Distribution [0.999900000,0.000100000] | Right Letter Distribution [0.000000000,0.000000000,0.000000000,0.000000000,0.000000000] | Left Index [1] | Right Index [19] // Initial node BasepairNode | Deletion Probability [0.0000229437914523] | Pair Probability [[0.009536579,0.017101376,0.010963471,0.198789353,0.000000000],[0.020276398,0.009712729,0.228583296,0.013790641,0.000000000],[0.011086594,0.203072729,0.002089755,0.023466206,0.000000000],[0.201366458,0.013287017,0.026771249,0.010106148,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [1] | Right Index [19] // Basepair C6 - G31 cWW BasepairNode | Deletion Probability [0.0000229437914523] | Pair Probability [[0.043697995,0.046260217,0.000524565,0.002472278,0.000000000],[0.044022640,0.046153098,0.000524565,0.000524565,0.000000000],[0.386803555,0.003671957,0.017951032,0.311661837,0.000000000],[0.048778633,0.045903932,0.000524565,0.000524565,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [2] | Right Index [18] // Basepair G7 - A30 tSH FixedNode | Deletion Probability [0.0050000000000000] | Letter Distribution [0.625000000,0.125000000,0.125000000,0.125000000,0.000000000] | Position [1] | Left Index [3] | Right Index [17] // Fixed node on left for 8U5Z|1|A|A|8 InitialNode | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [1.000000000] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [4] | Right Index [17] // New Initial node after Fixed node FixedNode | Deletion Probability [0.0050000000000000] | Letter Distribution [0.875000000,0.041666667,0.041666667,0.041666667,0.000000000] | Position [1] | Left Index [4] | Right Index [17] // Fixed node on left for 8U5Z|1|A|A|9 InitialNode | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [1.000000000] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [5] | Right Index [17] // New Initial node after Fixed node HairpinNode | Num Bases [13] | Left Index [5] | Right Index [17] | Norm Constant [0.000119948821652] // Hairpin node G10:G29 Interaction | Interacting Bases [1,4] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G10 - G15 cWH Interaction | Interacting Bases [2,5] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G11 - G16 cWH Interaction | Interacting Bases [3,6] | Pair Probability [[0.004470673,0.004470673,0.185890002,0.015451645,0.000000000],[0.004470673,0.047387299,0.004470673,0.004470673,0.000000000],[0.045978428,0.004470673,0.456871186,0.013985294,0.000000000],[0.037874815,0.016124084,0.103401154,0.050212058,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction U12 - G18 cHW Interaction | Interacting Bases [4,7] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G15 - G20 cWH Interaction | Interacting Bases [5,8] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G16 - G21 cWH Interaction | Interacting Bases [6,9] | Pair Probability [[0.004917740,0.004917740,0.204479002,0.016996810,0.000000000],[0.004917740,0.052126028,0.004917740,0.004917740,0.000000000],[0.050576271,0.004917740,0.511381834,0.015383823,0.000000000],[0.041662297,0.017736492,0.004917740,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G18 - G23 cHW Interaction | Interacting Bases [7,10] | Pair Probability [[0.112745781,0.119356604,0.001353438,0.006378757,0.000000000],[0.113583401,0.119080223,0.001353438,0.001353438,0.000000000],[0.154951637,0.001353438,0.006616528,0.114874695,0.000000000],[0.125854401,0.118437346,0.001353438,0.001353438,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G20 - A24 tSH Interaction | Interacting Bases [1,11] | Pair Probability [[0.004917740,0.004917740,0.204479002,0.016996810,0.000000000],[0.004917740,0.052126028,0.004917740,0.004917740,0.000000000],[0.050576271,0.004917740,0.511381834,0.015383823,0.000000000],[0.041662297,0.017736492,0.004917740,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G10 - G25 cHW Interaction | Interacting Bases [7,11] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G20 - G25 cWH Interaction | Interacting Bases [2,12] | Pair Probability [[0.004917740,0.004917740,0.204479002,0.016996810,0.000000000],[0.004917740,0.052126028,0.004917740,0.004917740,0.000000000],[0.050576271,0.004917740,0.511381834,0.015383823,0.000000000],[0.041662297,0.017736492,0.004917740,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G11 - G26 cHW Interaction | Interacting Bases [8,12] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G21 - G26 cWH Interaction | Interacting Bases [3,13] | Pair Probability [[0.004470673,0.004470673,0.045978428,0.037874815,0.000000000],[0.004470673,0.047387299,0.004470673,0.016124084,0.000000000],[0.185890002,0.004470673,0.456871186,0.004470673,0.000000000],[0.015451645,0.004470673,0.112915775,0.050212058,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction U12 - G29 cWH Interaction | Interacting Bases [9,13] | Pair Probability [[0.004917740,0.004917740,0.204479002,0.016996810,0.000000000],[0.004917740,0.052126028,0.004917740,0.004917740,0.000000000],[0.050576271,0.004917740,0.511381834,0.015383823,0.000000000],[0.041662297,0.017736492,0.004917740,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G23 - G29 cHW Insertion | Location [3] | Length Distribution [0.000000000,0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.416666667,0.250000000,0.250000000,0.083333333,0.000000000]// Insertion in Hairpin after nucleotide 7, position 3 Insertion | Location [5] | Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.375000000,0.125000000,0.125000000,0.375000000,0.000000000]// Insertion in Hairpin after nucleotide 9, position 5 Insertion | Location [6] | Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.375000000,0.375000000,0.125000000,0.125000000,0.000000000]// Insertion in Hairpin after nucleotide 10, position 6 Insertion | Location [8] | Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.375000000,0.375000000,0.125000000,0.125000000,0.000000000]// Insertion in Hairpin after nucleotide 12, position 8 Insertion | Location [12] | Length Distribution [0.011890606,0.487514863,0.487514863,0.012485137,0.000594530] | Letter Distribution [0.700000000,0.100000000,0.100000000,0.100000000,0.000000000]// Insertion in Hairpin after nucleotide 16, position 12Sequences of instances from HL_12758.3:
> HL_12758.3 8U5Z C 6 G 31 CGAAGGUGAGGAGAGGCGAGGAAGAG > HL_12758.3 5V3F C 4 G 28 CGAAGGGACGGUGCGGAGAGGAGAG