| Column number: Node in JAR3D model: Insertion positions indicated by I: Position in motif group: | 1 1 I | 2 2 1 | 3 2 I | 4 3 2 | 5 3 I | 6 3 3 | 7 3 I | 8 3 4 | 9 3 I | 10 3 5 | 11 3 I | 12 3 6 | 13 3 I | 14 3 7 | 15 3 I | 16 3 8 | 17 3 I | 18 3 9 | 19 3 I | 20 3 10 | 21 3 I | 22 3 11 | 23 3 I | 24 3 12 | 25 3 I | 26 3 13 | 27 3 I | 28 3 14 | 29 3 I | 30 3 15 | 31 3 I | 32 3 16 | 33 3 I | 34 3 17 | 35 3 I | 36 3 18 | 37 3 I | 38 3 19 | 39 3 I | 40 3 20 | 41 2 I | 42 2 21 | 43 1 I | In acceptance region | Cutoff score | Full edit distance | Interior edit distance | Alignment score deficit |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| HL_35354.1_Instance_1 HL_35354.1,HL_6E8S_001,A8_U31 | A | G | G | A | A | G | G | A | UU | G | G | U | A | U | G | U | G | G | U | A | U | A | U | |||||||||||||||||||||||||
| HL_35354.1_Sequence_1 HL_35354.16E8S_A8_U31 | A | G | G | A | A | G | G | A | UU | G | G | U | A | U | G | U | G | G | U | A | U | A | U | true | 100 | 0 | 0 | 0.00 |
1 14 s33 1 21 cWW 2 3 s35 2 4 s53 2 5 cWH 2 13 s35 2 14 s55 2 15 cHW 3 5 s53 3 6 cWH 3 13 cHW 4 5 s35 5 6 s35 5 8 cWH 6 8 s53 6 9 cWH 7 12 tWW 8 9 s35 8 15 cWH 9 13 cWH 10 11 s35 10 17 tWW 10 18 s35 11 16 s35 11 17 s53 11 18 tHH 13 15 s53 14 15 s55 14 20 tSW 15 16 s33 15 20 s55 16 19 cSH 18 19 s35 20 21 s35 11 18 6BPh 15 14 2BR 20 15 7BRJAR3D SCFG/MRF model for HL_35354.1:
Character Definition | A,C,G,U,* // Identity and order of characters in matrices InitialNode | Left Length Distribution [0.999900000,0.000100000] | Left Letter Distribution [0.000000000,0.000000000,0.000000000,0.000000000,0.000000000] | Right Length Distribution [0.999900000,0.000100000] | Right Letter Distribution [0.000000000,0.000000000,0.000000000,0.000000000,0.000000000] | Left Index [1] | Right Index [21] // Initial node BasepairNode | Deletion Probability [0.0000224390099112] | Pair Probability [[0.009374836,0.022228469,0.010012528,0.216037101,0.000000000],[0.017691617,0.009675113,0.196088410,0.010461402,0.000000000],[0.009993038,0.198630499,0.002061361,0.053740648,0.000000000],[0.197964449,0.011137350,0.023240462,0.011662716,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] | Left Length Distribution [0.989901010,0.009999000,0.000099990] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.989901010,0.009999000,0.000099990] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [1] | Right Index [21] // Basepair A8 - U31 cWW HairpinNode | Num Bases [19] | Left Index [2] | Right Index [20] | Norm Constant [0.011168842434633] // Hairpin node G9:A30 Interaction | Interacting Bases [1,4] | Pair Probability [[0.004966430,0.004966430,0.051077026,0.042074794,0.000000000],[0.004966430,0.052642128,0.004966430,0.017912101,0.000000000],[0.206503547,0.004966430,0.506544030,0.004966430,0.000000000],[0.017165095,0.004966430,0.015536138,0.055780127,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G9 - G13 cWH Interaction | Interacting Bases [2,5] | Pair Probability [[0.004966430,0.004966430,0.051077026,0.042074794,0.000000000],[0.004966430,0.052642128,0.004966430,0.017912101,0.000000000],[0.206503547,0.004966430,0.506544030,0.004966430,0.000000000],[0.017165095,0.004966430,0.015536138,0.055780127,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G10 - G14 cWH Interaction | Interacting Bases [4,7] | Pair Probability [[0.004966430,0.004966430,0.051077026,0.042074794,0.000000000],[0.004966430,0.052642128,0.004966430,0.017912101,0.000000000],[0.206503547,0.004966430,0.506544030,0.004966430,0.000000000],[0.017165095,0.004966430,0.015536138,0.055780127,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G13 - G18 cWH Interaction | Interacting Bases [5,8] | Pair Probability [[0.004966430,0.004966430,0.051077026,0.042074794,0.000000000],[0.004966430,0.052642128,0.004966430,0.017912101,0.000000000],[0.206503547,0.004966430,0.506544030,0.004966430,0.000000000],[0.017165095,0.004966430,0.015536138,0.055780127,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G14 - G19 cWH Interaction | Interacting Bases [6,11] | Pair Probability [[0.017376847,0.042940161,0.003635060,0.373406976,0.000000000],[0.017064104,0.039159201,0.015138258,0.041984236,0.000000000],[0.003635060,0.018018508,0.017398138,0.291185254,0.000000000],[0.041525169,0.034858775,0.017919960,0.024754293,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction A15 - U22 tWW Interaction | Interacting Bases [2,12] | Pair Probability [[0.004966430,0.004966430,0.206503547,0.017165095,0.000000000],[0.004966430,0.052642128,0.004966430,0.004966430,0.000000000],[0.051077026,0.004966430,0.506544030,0.015536138,0.000000000],[0.042074794,0.017912101,0.004966430,0.055780127,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G10 - G23 cHW Interaction | Interacting Bases [8,12] | Pair Probability [[0.004966430,0.004966430,0.051077026,0.042074794,0.000000000],[0.004966430,0.052642128,0.004966430,0.017912101,0.000000000],[0.206503547,0.004966430,0.506544030,0.004966430,0.000000000],[0.017165095,0.004966430,0.015536138,0.055780127,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G19 - G23 cWH Interaction | Interacting Bases [1,14] | Pair Probability [[0.001279730,0.001279730,0.266055152,0.004423035,0.000000000],[0.001279730,0.013564619,0.006398652,0.001279730,0.000000000],[0.013161329,0.001279730,0.649766220,0.004003292,0.000000000],[0.010841669,0.004615521,0.006398652,0.014373206,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G9 - G25 cHW Interaction | Interacting Bases [7,14] | Pair Probability [[0.001506979,0.001506979,0.077492300,0.012766885,0.000000000],[0.001506979,0.015973364,0.007534897,0.005435124,0.000000000],[0.062660010,0.001506979,0.763390658,0.001506979,0.000000000],[0.005208458,0.001506979,0.023570892,0.016925537,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G18 - G25 cWH Interaction | Interacting Bases [9,16] | Pair Probability [[0.025225366,0.030632286,0.005409939,0.036840993,0.000000000],[0.047552989,0.030869927,0.019182033,0.027617952,0.000000000],[0.005409939,0.018294450,0.025916781,0.039370057,0.000000000],[0.047096977,0.029437174,0.060248256,0.550894880,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction U20 - U27 tWW Interaction | Interacting Bases [10,17] | Pair Probability [[0.426248873,0.334479782,0.019961529,0.020365520,0.000000000],[0.052326193,0.000594783,0.050705654,0.005651677,0.000000000],[0.002965422,0.050057641,0.001484577,0.000594783,0.000000000],[0.004039806,0.029334195,0.000594783,0.000594783,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction A21 - A28 tHH Interaction | Interacting Bases [15,18] | Pair Probability [[0.080081996,0.081599880,0.004486614,0.079746437,0.000000000],[0.059786442,0.090099217,0.000993413,0.079913615,0.000000000],[0.069967806,0.000993413,0.085348797,0.109242244,0.000000000],[0.081324543,0.080836340,0.000993413,0.094585831,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G26 - U29 cSH Interaction | Interacting Bases [13,19] | Pair Probability [[0.235660254,0.004986930,0.000530644,0.002473347,0.000000000],[0.236059076,0.002540673,0.000530644,0.002112943,0.000000000],[0.229609277,0.000530644,0.000530644,0.001678859,0.000000000],[0.275223099,0.002427299,0.002631877,0.002473789,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction U24 - A30 tSW Interaction | Interacting Bases [3,3] | Pair Probability [[0.500000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.166666667,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.166666667,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.166666667,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position A12 Insertion | Location [2] | Length Distribution [0.045351474,0.907029478,0.045351474,0.002267574] | Letter Distribution [0.500000000,0.166666667,0.166666667,0.166666667,0.000000000]// Insertion in Hairpin after nucleotide 3, position 2 Insertion | Location [6] | Length Distribution [0.000000000,0.045351474,0.907029478,0.045351474,0.002267574] | Letter Distribution [0.125000000,0.125000000,0.125000000,0.625000000,0.000000000]// Insertion in Hairpin after nucleotide 7, position 6Sequences of instances from HL_35354.1:
> HL_35354.1 6E8S A 8 U 31 AGGAAGGAUUGGUAUGUGGUAUAU