| Column number: Node in JAR3D model: Insertion positions indicated by I: Position in motif group: | 1 1 I | 2 2 1 | 3 2 I | 4 3 2 | 5 3 I | 6 4 3 | 7 5 I | 8 6 4 | 9 7 I | 10 12 5 | 11 12 I | 12 13 6 | 13 13 I | 14 13 7 | 15 13 I | 16 13 8 | 17 13 I | 18 13 9 | 19 12 I | 20 12 10 | 21 11 I | 22 10 11 | 23 9 I | 24 8 12 | 25 5 I | 26 4 13 | 27 4 I | 28 4 14 | 29 4 I | 30 4 15 | 31 4 I | 32 4 16 | 33 3 I | 34 3 17 | 35 2 I | 36 2 18 | 37 1 I | In acceptance region | Cutoff score | Full edit distance | Interior edit distance | Alignment score deficit |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| HL_51921.1_Instance_1 HL_51921.1,HL_8CRE_075,U69_A89 | U | G | A | A | U | U | G | C | A | G | A | U | A | U | U | C | G | U | G | A | A | |||||||||||||||||||||
| HL_51921.1_Sequence_1 HL_51921.18CRE_U69_A89 | U | G | A | A | U | U | G | C | A | G | A | U | A | U | U | C | G | U | G | A | A | true | 100 | 0 | 0 | 0.00 | ||||||||||||||||
| HL_51921.1_Instance_2 HL_51921.1,HL_8P9A_187,U69_A89 | U | G | A | A | U | U | G | C | A | G | A | A | U | U | C | C | G | U | G | A | A | |||||||||||||||||||||
| HL_51921.1_Sequence_2 HL_51921.18P9A_U69_A89 | U | G | A | A | U | U | G | C | A | G | A | A | U | U | C | C | G | U | G | A | A | true | 100 | 0 | 0 | 0.00 |
1 2 s35 1 18 cWW 2 16 s33 2 17 tSH 3 13 tSS 3 14 s35 3 15 s33 3 16 tHS 3 17 s55 4 5 s35 4 17 perp 5 6 s35 5 10 cWW 7 8 s35 8 9 s35 9 10 s35 10 11 s35 11 12 s55 11 13 perp 12 13 s35 13 14 s35 15 16 s35 17 18 s35 6 5 7BPh 8 6 7BR 15 14 2BR 2 16 6BR 3 16 6BRJAR3D SCFG/MRF model for HL_51921.1:
Character Definition | A,C,G,U,* // Identity and order of characters in matrices InitialNode | Left Length Distribution [0.999900000,0.000100000] | Left Letter Distribution [0.000000000,0.000000000,0.000000000,0.000000000,0.000000000] | Right Length Distribution [0.999900000,0.000100000] | Right Letter Distribution [0.000000000,0.000000000,0.000000000,0.000000000,0.000000000] | Left Index [1] | Right Index [18] // Initial node BasepairNode | Deletion Probability [0.0000229437914523] | Pair Probability [[0.009034335,0.017544761,0.009910087,0.196321162,0.000000000],[0.022043953,0.009831675,0.196981684,0.011044900,0.000000000],[0.009929415,0.194460696,0.002044250,0.023047545,0.000000000],[0.224032836,0.010374563,0.053294552,0.010103588,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [1] | Right Index [18] // Basepair U69 - A89 cWW BasepairNode | Deletion Probability [0.0000229437914523] | Pair Probability [[0.054906639,0.058126077,0.000659118,0.003106423,0.000000000],[0.055314556,0.057991481,0.000659118,0.000659118,0.000000000],[0.349166642,0.003295588,0.016111083,0.279717048,0.000000000],[0.061290472,0.057678403,0.000659118,0.000659118,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [2] | Right Index [17] // Basepair G70 - A88 tSH ClusterNode | Deletion Probability [0.000000000000000076180842891157205953625402643352350634502873] | Num Left Bases [1] | Num Right Bases [4] | Left Index [3] | Right Index [16] | Norm Constant [0.492877882422646] // Cluster node 8CRE|1|4|A|71:8CRE|1|4|A|71 and 8CRE|1|4|U|82:8CRE|1|4|G|87 Interaction | Interacting Bases [1,2] | Pair Probability [[0.230465747,0.235038765,0.231362554,0.270576079,0.000000000],[0.000501936,0.000501936,0.003323246,0.000501936,0.000000000],[0.002498456,0.000501936,0.002577542,0.020142120,0.000000000],[0.000501936,0.000501936,0.000501936,0.000501936,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction 8CRE|1|4|A|71 - 8CRE|1|4|U|82 tSS Interaction | Interacting Bases [1,5] | Pair Probability [[0.112745781,0.113583401,0.154951637,0.125854401,0.000000000],[0.119356604,0.119080223,0.001353438,0.118437346,0.000000000],[0.001353438,0.001353438,0.006616528,0.001353438,0.000000000],[0.006378757,0.001353438,0.114874695,0.001353438,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction 8CRE|1|4|A|71 - 8CRE|1|4|G|87 tHS Interaction | Interacting Bases [3,3] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.375000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.125000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.375000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Right strand conserved insertion 8CRE|1|4|U|83 Interaction | Interacting Bases [4,4] | Pair Probability [[0.041666667,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.041666667,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.875000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.041666667,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Right strand conserved insertion 8CRE|1|4|G|85 Insertion | Location [3] | Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.125000000,0.625000000,0.125000000,0.125000000,0.000000000]// Insertion after nucleotide 14, position 3 in cluster node Insertion | Location [4] | Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.125000000,0.125000000,0.125000000,0.625000000,0.000000000]// Insertion after nucleotide 15, position 4 in cluster node InitialNode | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [4] | Right Index [12] // Initial node 8CRE|1|4|A|72 - 8CRE|1|4|A|81 from node FixedNode | Deletion Probability [0.0050000000000000] | Letter Distribution [0.625000000,0.125000000,0.125000000,0.125000000,0.000000000] | Position [1] | Left Index [4] | Right Index [12] // Fixed node on left for 8CRE|1|4|A|72 InitialNode | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [1.000000000] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [5] | Right Index [12] // New Initial node after Fixed node FixedNode | Deletion Probability [0.0050000000000000] | Letter Distribution [0.375000000,0.125000000,0.125000000,0.375000000,0.000000000] | Position [2] | Left Index [5] | Right Index [12] // Fixed node on right for 8CRE|1|4|U|80 InitialNode | Left Length Distribution [1.000000000] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Right Letter Distribution [0.375000000,0.125000000,0.125000000,0.375000000,0.000000000] | Left Index [5] | Right Index [11] // New Initial node after Fixed node FixedNode | Deletion Probability [0.0050000000000000] | Letter Distribution [0.625000000,0.125000000,0.125000000,0.125000000,0.000000000] | Position [2] | Left Index [5] | Right Index [11] // Fixed node on right for 8CRE|1|4|A|79 InitialNode | Left Length Distribution [1.000000000] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [5] | Right Index [10] // New Initial node after Fixed node BasepairNode | Deletion Probability [0.0000229437914523] | Pair Probability [[0.010223770,0.012712701,0.012979634,0.033885995,0.000000000],[0.275034684,0.025409767,0.038503741,0.014576484,0.000000000],[0.013263788,0.033750263,0.003005589,0.013338191,0.000000000],[0.078357106,0.013344681,0.409293284,0.012320322,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [5] | Right Index [10] // Basepair U73 - G78 cWW HairpinNode | Num Bases [4] | Left Index [6] | Right Index [9] | Norm Constant [1.000000000000000] // Hairpin node U74:A77 Interaction | Interacting Bases [1,1] | Pair Probability [[0.031250000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.031250000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.031250000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.906250000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position U74 Interaction | Interacting Bases [2,2] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.625000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.125000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position G75 Interaction | Interacting Bases [3,3] | Pair Probability [[0.041666667,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.875000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.041666667,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.041666667,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position C76 Interaction | Interacting Bases [4,4] | Pair Probability [[0.625000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.125000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.125000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position A77Sequences of instances from HL_51921.1:
> HL_51921.1 8CRE U 69 A 89 UGAAUUGCAGAUAUUCGUGAA > HL_51921.1 8P9A U 69 A 89 UGAAUUGCAGAAUUCCGUGAA