| Column number: Node in JAR3D model: Insertion positions indicated by I: Position in motif group: | 1 1 I | 2 2 1 | 3 2 I | 4 3 2 | 5 3 I | 6 3 3 | 7 3 I | 8 3 4 | 9 3 I | 10 3 5 | 11 3 I | 12 3 6 | 13 3 I | 14 3 7 | 15 3 I | 16 3 8 | 17 3 I | 18 3 9 | 19 3 I | 20 3 10 | 21 3 I | 22 3 11 | 23 3 I | 24 3 12 | 25 3 I | 26 3 13 | 27 3 I | 28 3 14 | 29 3 I | 30 3 15 | 31 3 I | 32 3 16 | 33 3 I | 34 3 17 | 35 2 I | 36 2 18 | 37 1 I | In acceptance region | Cutoff score | Full edit distance | Interior edit distance | Alignment score deficit |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| HL_60293.1_Instance_1 HL_60293.1,HL_5DEA_002,U8_G29 | U | G | U | G | G | A | A | G | G | A | G | U | G | G | C | U | G | G | G | U | U | G | ||||||||||||||||||||
| HL_60293.1_Sequence_1 HL_60293.15DEA_U8_G29 | U | G | U | G | G | A | A | G | G | A | G | U | G | G | C | U | G | G | G | U | U | G | true | 100 | 0 | 0 | 0.00 | |||||||||||||||
| HL_60293.1_Instance_2 HL_60293.1,HL_5DE8_001,U8_G29 | U | G | U | G | G | A | A | G | G | A | G | U | G | G | C | U | G | G | G | U | U | G | ||||||||||||||||||||
| HL_60293.1_Sequence_2 HL_60293.15DE8_U8_G29 | U | G | U | G | G | A | A | G | G | A | G | U | G | G | C | U | G | G | G | U | U | G | true | 100 | 0 | 0 | 0.00 |
1 2 s35 1 18 cWW 2 4 s33 2 14 s33 2 15 cWH 2 18 s55 3 4 s35 3 5 s53 3 6 cWH 3 13 cHW 4 6 s53 4 7 cWH 4 14 cHW 6 7 s35 6 10 cWH 7 9 s33 7 11 cWH 8 9 s55 8 17 tSW 9 11 s33 9 15 cHW 9 17 s55 10 11 s35 10 13 cWH 11 13 s53 11 14 cWH 11 15 s33 13 14 s35 14 15 s33 15 18 s55 9 7 2BRJAR3D SCFG/MRF model for HL_60293.1:
Character Definition | A,C,G,U,* // Identity and order of characters in matrices InitialNode | Left Length Distribution [0.999900000,0.000100000] | Left Letter Distribution [0.000000000,0.000000000,0.000000000,0.000000000,0.000000000] | Right Length Distribution [0.999900000,0.000100000] | Right Letter Distribution [0.000000000,0.000000000,0.000000000,0.000000000,0.000000000] | Left Index [1] | Right Index [18] // Initial node BasepairNode | Deletion Probability [0.0000229437914523] | Pair Probability [[0.011246147,0.013983971,0.014277598,0.037274594,0.000000000],[0.302538153,0.027950744,0.042354115,0.016034133,0.000000000],[0.014590167,0.037125289,0.003306148,0.014672010,0.000000000],[0.086192816,0.014679149,0.350222612,0.013552354,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [1] | Right Index [18] // Basepair U8 - G29 cWW HairpinNode | Num Bases [16] | Left Index [2] | Right Index [17] | Norm Constant [0.003284219621981] // Hairpin node G9:U28 Interaction | Interacting Bases [2,5] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G11 - G15 cWH Interaction | Interacting Bases [3,6] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G12 - G16 cWH Interaction | Interacting Bases [5,9] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G15 - G20 cWH Interaction | Interacting Bases [6,10] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G16 - G21 cWH Interaction | Interacting Bases [2,12] | Pair Probability [[0.004917740,0.004917740,0.204479002,0.016996810,0.000000000],[0.004917740,0.052126028,0.004917740,0.004917740,0.000000000],[0.050576271,0.004917740,0.511381834,0.015383823,0.000000000],[0.041662297,0.017736492,0.004917740,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G11 - G24 cHW Interaction | Interacting Bases [9,12] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G20 - G24 cWH Interaction | Interacting Bases [3,13] | Pair Probability [[0.004917740,0.004917740,0.204479002,0.016996810,0.000000000],[0.004917740,0.052126028,0.004917740,0.004917740,0.000000000],[0.050576271,0.004917740,0.511381834,0.015383823,0.000000000],[0.041662297,0.017736492,0.004917740,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G12 - G25 cHW Interaction | Interacting Bases [10,13] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G21 - G25 cWH Interaction | Interacting Bases [1,14] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G9 - G26 cWH Interaction | Interacting Bases [8,14] | Pair Probability [[0.001492205,0.001492205,0.062045696,0.005157395,0.000000000],[0.001492205,0.015816762,0.001492205,0.001492205,0.000000000],[0.076732572,0.007461025,0.765710357,0.023339805,0.000000000],[0.012641719,0.005381839,0.001492205,0.016759600,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction G18 - G26 cHW Interaction | Interacting Bases [7,16] | Pair Probability [[0.015475941,0.014451115,0.002934097,0.313017499,0.000000000],[0.014422784,0.014585827,0.002934097,0.125809611,0.000000000],[0.014187592,0.002934097,0.002934097,0.014280575,0.000000000],[0.013675905,0.029185846,0.137876263,0.281294655,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin Interaction A17 - U28 tSW Interaction | Interacting Bases [4,4] | Pair Probability [[0.625000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.125000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.125000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position A14 Interaction | Interacting Bases [11,11] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.375000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.125000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.375000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position U23 Interaction | Interacting Bases [15,15] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.125000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.625000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position U27 Insertion | Location [1] | Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.125000000,0.125000000,0.125000000,0.625000000,0.000000000]// Insertion in Hairpin after nucleotide 2, position 1 Insertion | Location [3] | Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.625000000,0.125000000,0.125000000,0.125000000,0.000000000]// Insertion in Hairpin after nucleotide 4, position 3 Insertion | Location [8] | Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.125000000,0.125000000,0.125000000,0.625000000,0.000000000]// Insertion in Hairpin after nucleotide 9, position 8 Insertion | Location [10] | Length Distribution [0.493381468,0.493381468,0.012635379,0.000601685] | Letter Distribution [0.166666667,0.500000000,0.166666667,0.166666667,0.000000000]// Insertion in Hairpin after nucleotide 11, position 10 Insertion | Location [11] | Length Distribution [0.493381468,0.493381468,0.012635379,0.000601685] | Letter Distribution [0.166666667,0.166666667,0.166666667,0.500000000,0.000000000]// Insertion in Hairpin after nucleotide 12, position 11Sequences of instances from HL_60293.1:
> HL_60293.1 5DEA U 8 G 29 UGUGGAAGGAGUGGCUGGGUUG > HL_60293.1 5DE8 U 8 G 29 UGUGGAAGGAGUGGCUGGGUUG