| Column number: Node in JAR3D model: Insertion positions indicated by I: Position in motif group: | 1 1 I | 2 2 1 | 3 2 I | 4 3 2 | 5 4 I | 6 7 3 | 7 8 I | 8 9 4 | 9 9 I | 10 10 5 | 11 10 I | 12 10 6 | 13 10 I | 14 10 7 | 15 10 I | 16 10 8 | 17 10 I | 18 10 9 | 19 10 I | 20 10 10 | 21 10 I | 22 10 11 | 23 10 I | 24 10 12 | 25 9 I | 26 9 13 | 27 8 I | 28 7 14 | 29 7 I | 30 7 15 | 31 6 I | 32 5 16 | 33 2 I | 34 2 17 | 35 1 I | In acceptance region | Cutoff score | Full edit distance | Interior edit distance | Alignment score deficit |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| HL_89346.1_Instance_1 HL_89346.1,HL_8P9A_224,A1691_U1710 | A | G | A | A | G | G | G | G | G | CAA | C | U | C | C | A | U | C | U | ||||||||||||||||||||||
| HL_89346.1_Sequence_1 HL_89346.18P9A_A_1691_U_1710 | A | G | A | A | G | G | G | G | G | CAA | C | U | C | C | A | U | C | U | true | 89 | 0 | 0 | 2.83 | |||||||||||||||||
| HL_89346.1_Instance_2 HL_89346.1,HL_6ZDU_005,C1268_G1286 | C | U | U | C | C | C | G | A | A | U | U | G | U | G | G | A | U | A | G | |||||||||||||||||||||
| HL_89346.1_Sequence_2 HL_89346.16ZDU_C_1268_G_1286 | C | U | U | C | C | C | G | A | A | U | U | G | U | G | G | A | U | A | G | true | 100 | 0 | 0 | 0.00 |
1 2 s35 1 17 cWW 2 3 s35 2 17 s55 3 4 s35 3 14 cWW 3 15 cWW 4 5 s35 4 13 cWW 4 14 s33 5 6 s35 6 7 s35 6 11 perp 7 8 s35 7 11 s53 7 12 perp 8 9 perp 9 10 s55 11 12 perp 12 13 s35 13 14 s35 14 15 s35 15 16 s35 16 17 s55JAR3D SCFG/MRF model for HL_89346.1:
Character Definition | A,C,G,U,* // Identity and order of characters in matrices InitialNode | Left Length Distribution [0.999900000,0.000100000] | Left Letter Distribution [0.000000000,0.000000000,0.000000000,0.000000000,0.000000000] | Right Length Distribution [0.999900000,0.000100000] | Right Letter Distribution [0.000000000,0.000000000,0.000000000,0.000000000,0.000000000] | Left Index [1] | Right Index [17] // Initial node BasepairNode | Deletion Probability [0.0000229437914523] | Pair Probability [[0.009409752,0.019555960,0.010438919,0.211256183,0.000000000],[0.018897284,0.009646494,0.211374635,0.012074740,0.000000000],[0.010490831,0.199877935,0.002065453,0.038339992,0.000000000],[0.198695040,0.012157589,0.024891932,0.010827262,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [1] | Right Index [17] // Basepair A1691 - U1710 cWW FixedNode | Deletion Probability [0.0050000000000000] | Letter Distribution [0.125000000,0.125000000,0.375000000,0.375000000,0.000000000] | Position [1] | Left Index [2] | Right Index [16] // Fixed node on left for 8P9A|1|sR|G|1692 InitialNode | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [1.000000000] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [3] | Right Index [16] // New Initial node after Fixed node FixedNode | Deletion Probability [0.0050000000000000] | Letter Distribution [0.375000000,0.375000000,0.125000000,0.125000000,0.000000000] | Position [2] | Left Index [3] | Right Index [16] // Fixed node on right for 8P9A|1|sR|C|1706 InitialNode | Left Length Distribution [1.000000000] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [3] | Right Index [15] // New Initial node after Fixed node ClusterNode | Deletion Probability [0.0000001250000000] | Num Left Bases [1] | Num Right Bases [2] | Left Index [3] | Right Index [15] | Norm Constant [0.260747313858006] // Cluster node 8P9A|1|sR|A|1693:8P9A|1|sR|A|1693 and 8P9A|1|sR|A|1707:8P9A|1|sR|U|1708 Interaction | Interacting Bases [1,2] | Pair Probability [[0.107143513,0.015949783,0.009009170,0.178473784,0.000000000],[0.020039957,0.008937886,0.179074258,0.010040818,0.000000000],[0.009026741,0.176782451,0.001858409,0.020952313,0.000000000],[0.195644824,0.009431421,0.048449592,0.009185080,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction 8P9A|1|sR|A|1693 - 8P9A|1|sR|A|1707 cWW Interaction | Interacting Bases [1,3] | Pair Probability [[0.012355323,0.152486873,0.011844359,0.123890391,0.000000000],[0.017284732,0.013982885,0.107364811,0.012739948,0.000000000],[0.011690860,0.108815631,0.003146657,0.053767974,0.000000000],[0.108519843,0.013702127,0.020221404,0.228186183,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction 8P9A|1|sR|A|1693 - 8P9A|1|sR|U|1708 cWW InitialNode | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [4] | Right Index [13] // New Initial node after Cluster BasepairNode | Deletion Probability [0.0000229437914523] | Pair Probability [[0.008669617,0.114477187,0.009966792,0.180717594,0.000000000],[0.018433089,0.008829754,0.199781606,0.012536946,0.000000000],[0.010078722,0.184611572,0.001899777,0.021332914,0.000000000],[0.183060417,0.012079106,0.024337499,0.009187408,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [4] | Right Index [13] // Basepair A1694 - C1706 cWW HairpinNode | Num Bases [8] | Left Index [5] | Right Index [12] | Norm Constant [1.000000000000000] // Hairpin node G1695:C1705 Interaction | Interacting Bases [1,1] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.375000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.375000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.125000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position G1695 Interaction | Interacting Bases [2,2] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.375000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.375000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.125000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position G1696 Interaction | Interacting Bases [3,3] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.625000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.125000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position G1697 Interaction | Interacting Bases [4,4] | Pair Probability [[0.375000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.375000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.125000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position G1698 Interaction | Interacting Bases [5,5] | Pair Probability [[0.375000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.375000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.125000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position G1699 Interaction | Interacting Bases [6,6] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.375000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.125000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.375000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position C1703 Interaction | Interacting Bases [7,7] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.375000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.375000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position U1704 Interaction | Interacting Bases [8,8] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.375000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.375000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.125000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position C1705 Insertion | Location [5] | Length Distribution [0.011890606,0.475624257,0.023781213,0.476218787,0.011890606,0.000594530] | Letter Distribution [0.416666667,0.250000000,0.083333333,0.250000000,0.000000000]// Insertion in Hairpin after nucleotide 9, position 5 Insertion | Location [7] | Length Distribution [0.493381468,0.493381468,0.012635379,0.000601685] | Letter Distribution [0.166666667,0.166666667,0.166666667,0.500000000,0.000000000]// Insertion in Hairpin after nucleotide 11, position 7Sequences of instances from HL_89346.1:
> HL_89346.1 8P9A A 1691 U 1710 AGAAGGGGGCAACUCCAUCU > HL_89346.1 6ZDU C 1268 G 1286 CUUCCCGAAUUGUGGAUAG