
ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

               MotifID: 'J4_01665.1'
             Signature: {'cWW-tWH-F-tWH-cWW-tSS-F-tHW-tSS-cWW-cWW'}
                 NumNT: 18
          NumBasepairs: 11
            Structured: 1
             NumStacks: 14
                NumBPh: 1
                 NumBR: 0
          NumInstances: 1
              Truncate: [3×1 double]
              NumFixed: 52
              OwnScore: -11.3190
           OwnSequence: {'GAG*CAUAACG*CCAAAG*UGC'}
          DeficitCoeff: 1
         CoreEditCoeff: 3
       SequenceLengths: 18
    MeanSequenceLength: 18
       DeficitEditData: [341×2 double]

1 sequences from 3D structures
Using 341 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  22.4932 because the cutoff seemed overly generous
Group   1, J4_01665.1  has acceptance rules AlignmentScore >= -31.3190, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  31.5174
TP   100.00%, TN    97.95%, min    97.95%,   1 3D sequences,     0 alignment sequences,  341 random sequences,    7 random matches, 18 NTs, cWW-tWH-F-tWH-cWW-tSS-F-tHW-tSS-cWW-cWW
Sensitivity 100.00%, Specificity  97.95%, Minimum  97.95% using method 8
Number of false positives with core edit > 0 is 7
1 * Deficit + 3 * Core Edit <= 20.1985
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_04237.1'
                     Signature: {'cWW-F-F-F-cWH-F-F-F-F-cWW-F-F-F-F-cWW-F-F-F-F-F-F-F-F-F-F'}
                         NumNT: 29
                  NumBasepairs: 9
                    Structured: 1
                     NumStacks: 21
                        NumBPh: 1
                         NumBR: 1
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 80
                      OwnScore: -21.1059
                   OwnSequence: {'GUGGUGGAAUUGGUAGACACGC*GUG*CUUA*UC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 30
            MeanSequenceLength: 30
               DeficitEditData: [0×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 0 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
No random sequence matches, so essentially no model-specific cutoff imposed
Decreased cutoff to  25.0000 so that it is possible to reject matches
Group   2, J4_04237.1  has acceptance rules AlignmentScore >= -41.1059, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  46.1059
TP   100.00%, TN      NaN%, min   100.00%,   1 3D sequences,     0 alignment sequences,    0 random sequences,    0 random matches, 29 NTs, cWW-F-F-F-cWH-F-F-F-F-cWW-F-F-F-F-cWW-F-F-F-F-F-F-F-F-F-F
Sensitivity 100.00%, Specificity    NaN%, Minimum 100.00% using method 12
Number of false positives with core edit > 0 is 0
1 * Deficit + 3 * Core Edit <= 25.0000
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_04930.2'
                     Signature: {'cWW-F-F-tWW-cWW-cWW-cHW-cWW-F'}
                         NumNT: 15
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 12
                        NumBPh: 2
                         NumBR: 1
                  NumInstances: 6
                      Truncate: [3×1 double]
                      NumFixed: 52
                      OwnScore: [-8.7931 -8.4926 -7.5389 -7.5389 -11.1306 -10.7478]
                   OwnSequence: {1×6 cell}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [15 15 15 15 15 15]
            MeanSequenceLength: 15
               DeficitEditData: [2081×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

6 sequences from 3D structures
Using 2081 random sequences, 0 from an alignment, and 6 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  22.2367 because the cutoff seemed overly generous
Group   3, J4_04930.2  has acceptance rules AlignmentScore >= -27.5389, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  27.5389
TP   100.00%, TN    97.93%, min    97.93%,   6 3D sequences,     0 alignment sequences, 2081 random sequences,   43 random matches, 15 NTs, cWW-F-F-tWW-cWW-cWW-cHW-cWW-F
Sensitivity 100.00%, Specificity  97.93%, Minimum  97.93% using method 8
Number of false positives with core edit > 0 is 43
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2
Motif index 3
Motif index 4
Motif index 5
Motif index 6


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_07491.1'
                     Signature: {'cWW-F-F-tWS-F-F-cWW-cWW-cWW'}
                         NumNT: 13
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 10
                        NumBPh: 1
                         NumBR: 1
                  NumInstances: 9
                      Truncate: [3×1 double]
                      NumFixed: 56
                      OwnScore: [-6.9591 -6.9591 -5.8605 -5.8605 -6.4404 -5.8605 -6.4404 -9.2938 -9.2938]
                   OwnSequence: {1×9 cell}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [12 12 12 12 12 12 12 12 12]
            MeanSequenceLength: 12
               DeficitEditData: [7500×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

9 sequences from 3D structures
Using 7500 random sequences, 0 from an alignment, and 9 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group   4, J4_07491.1  has acceptance rules AlignmentScore >= -25.8605, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  22.5136
TP   100.00%, TN    96.00%, min    96.00%,   9 3D sequences,     0 alignment sequences, 7497 random sequences,  300 random matches, 13 NTs, cWW-F-F-tWS-F-F-cWW-cWW-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 300
1 * Deficit + 3 * Core Edit <= 16.6531
Motif index 1
Motif index 2
Motif index 3
Motif index 4
Motif index 5
Motif index 6
Motif index 7
Motif index 8
Motif index 9


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_10313.2'
                     Signature: {'cWW-cWW-tHW-F-F-F-F-F-F-cWW-cWW'}
                         NumNT: 16
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 10
                        NumBPh: 1
                         NumBR: 1
                  NumInstances: 5
                      Truncate: [3×1 double]
                      NumFixed: 68
                      OwnScore: [-8.2549 -8.2049 -9.0522 -10.1508 -11.0481]
                   OwnSequence: {1×5 cell}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [16 16 16 16 16]
            MeanSequenceLength: 16
               DeficitEditData: [2245×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

5 sequences from 3D structures
Using 2245 random sequences, 0 from an alignment, and 5 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  22.1584 because the cutoff seemed overly generous
Group   5, J4_10313.2  has acceptance rules AlignmentScore >= -28.2049, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  28.2101
TP   100.00%, TN    98.00%, min    98.00%,   5 3D sequences,     0 alignment sequences, 2245 random sequences,   45 random matches, 16 NTs, cWW-cWW-tHW-F-F-F-F-F-F-cWW-cWW
Sensitivity 100.00%, Specificity  98.00%, Minimum  98.00% using method 8
Number of false positives with core edit > 0 is 45
1 * Deficit + 3 * Core Edit <= 20.0052
Motif index 1
Motif index 2
Motif index 3
Motif index 4
Motif index 5


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_10408.3'
                     Signature: {'cWW-F-F-F-F-F-cWW-cWW-cHS-F-F-F-cWW-F'}
                         NumNT: 15
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 11
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 58
                      OwnScore: [-14.5459 -15.1894]
                   OwnSequence: {'GAUUAG*CAC*GGGGUCG*CAUC'  'AUAUAG*CGC*GAGGUCG*CUAU'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [19 19]
            MeanSequenceLength: 19
               DeficitEditData: [527×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 527 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  20.4354 because the cutoff seemed overly generous
Group   6, J4_10408.3  has acceptance rules AlignmentScore >= -34.5459, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  34.5459
TP   100.00%, TN    96.39%, min    96.39%,   2 3D sequences,     0 alignment sequences,  527 random sequences,   19 random matches, 15 NTs, cWW-F-F-F-F-F-cWW-cWW-cHS-F-F-F-cWW-F
Sensitivity 100.00%, Specificity  96.39%, Minimum  96.39% using method 8
Number of false positives with core edit > 0 is 19
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_10571.1'
                     Signature: {'cWW-F-F-F-cWW-F-F-cWW-F'}
                         NumNT: 12
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 7
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 46
                      OwnScore: -9.1255
                   OwnSequence: {'UGG*CAC*GCAGG*UA'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 12
            MeanSequenceLength: 12
               DeficitEditData: [18476×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 18476 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group   7, J4_10571.1  has acceptance rules AlignmentScore >= -29.1255, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  28.0855
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 18476 random sequences,  739 random matches, 12 NTs, cWW-F-F-F-cWW-F-F-cWW-F
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 739
1 * Deficit + 3 * Core Edit <= 18.9600
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_11418.1'
                     Signature: {'cWW-F-F-tSH-cHH-F-F-tHS-cWW-cWW-F-F-cWW'}
                         NumNT: 19
                  NumBasepairs: 8
                    Structured: 1
                     NumStacks: 12
                        NumBPh: 2
                         NumBR: 1
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 64
                      OwnScore: -9.9234
                   OwnSequence: {'ACGAAG*CGUG*CAG*CGUACU'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 18
            MeanSequenceLength: 18
               DeficitEditData: [231×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 231 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  22.7427 because the cutoff seemed overly generous
Group   8, J4_11418.1  has acceptance rules AlignmentScore >= -29.9234, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  31.5409
TP   100.00%, TN    97.84%, min    97.84%,   1 3D sequences,     0 alignment sequences,  231 random sequences,    5 random matches, 19 NTs, cWW-F-F-tSH-cHH-F-F-tHS-cWW-cWW-F-F-cWW
Sensitivity 100.00%, Specificity  97.84%, Minimum  97.84% using method 8
Number of false positives with core edit > 0 is 5
1 * Deficit + 3 * Core Edit <= 21.6176
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_12209.1'
                     Signature: {'cWW-F-F-F-cWW-tWH-F-cWW-F-F-F-tWS-tWH-F-F-F-F-F-cSH-cWW-F'}
                         NumNT: 27
                  NumBasepairs: 14
                    Structured: 1
                     NumStacks: 20
                        NumBPh: 4
                         NumBR: 6
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 88
                      OwnScore: -14.3146
                   OwnSequence: {'CACAGAGAAGAGAC*GGUGAAACG*CG*CACG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 28
            MeanSequenceLength: 28
               DeficitEditData: [0×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 0 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
No random sequence matches, so essentially no model-specific cutoff imposed
Decreased cutoff to  25.0000 so that it is possible to reject matches
Group   9, J4_12209.1  has acceptance rules AlignmentScore >= -34.3146, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  39.3146
TP   100.00%, TN      NaN%, min   100.00%,   1 3D sequences,     0 alignment sequences,    0 random sequences,    0 random matches, 27 NTs, cWW-F-F-F-cWW-tWH-F-cWW-F-F-F-tWS-tWH-F-F-F-F-F-cSH-cWW-F
Sensitivity 100.00%, Specificity    NaN%, Minimum 100.00% using method 12
Number of false positives with core edit > 0 is 0
1 * Deficit + 3 * Core Edit <= 25.0000
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_16596.1'
                     Signature: {'cWW-F-F-F-cWW-F-cWW-F-cWW-cWW-F-F'}
                         NumNT: 17
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 11
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 3
                      Truncate: [3×1 double]
                      NumFixed: 66
                      OwnScore: [-13.5452 -13.0343 -17.0267]
                   OwnSequence: {'GGAAAG*CAGA*UAC*GAAUGC'  'GGAAAG*CACA*UAC*GAAUGC'  'GGGAAG*CACG*CAC*GGAAACC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [18 18 19]
            MeanSequenceLength: 18.3333
               DeficitEditData: [1392×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

3 sequences from 3D structures
Using 1392 random sequences, 0 from an alignment, and 3 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  21.2185 because the cutoff seemed overly generous
Group  10, J4_16596.1  has acceptance rules AlignmentScore >= -33.0343, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  33.0343
TP   100.00%, TN    97.63%, min    97.63%,   3 3D sequences,     0 alignment sequences, 1392 random sequences,   33 random matches, 17 NTs, cWW-F-F-F-cWW-F-cWW-F-cWW-cWW-F-F
Sensitivity 100.00%, Specificity  97.63%, Minimum  97.63% using method 8
Number of false positives with core edit > 0 is 33
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2
Motif index 3


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_19572.1'
                     Signature: {'cWW-F-cSW-F-F-tWH-cWW-F-cHW-F-cWW-F-tWS-F-cWW-F-F-F-cSH-tWH-cWW-F-F-F'}
                         NumNT: 31
                  NumBasepairs: 17
                    Structured: 1
                     NumStacks: 23
                        NumBPh: 5
                         NumBR: 6
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 98
                      OwnScore: -15.7420
                   OwnSequence: {'CACAGAGAAGAGAC*GGUGAAACG*CGC*GGCACG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 31
            MeanSequenceLength: 31
               DeficitEditData: [0×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 0 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
No random sequence matches, so essentially no model-specific cutoff imposed
Decreased cutoff to  25.0000 so that it is possible to reject matches
Group  11, J4_19572.1  has acceptance rules AlignmentScore >= -35.7420, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  40.7420
TP   100.00%, TN      NaN%, min   100.00%,   1 3D sequences,     0 alignment sequences,    0 random sequences,    0 random matches, 31 NTs, cWW-F-cSW-F-F-tWH-cWW-F-cHW-F-cWW-F-tWS-F-cWW-F-F-F-cSH-tWH-cWW-F-F-F
Sensitivity 100.00%, Specificity    NaN%, Minimum 100.00% using method 12
Number of false positives with core edit > 0 is 0
1 * Deficit + 3 * Core Edit <= 25.0000
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_22413.2'
                     Signature: {'cWW-F-cWW-F-cWW-cHW-F-F-F-cWW-F'}
                         NumNT: 15
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 7
                        NumBPh: 1
                         NumBR: 0
                  NumInstances: 3
                      Truncate: [3×1 double]
                      NumFixed: 64
                      OwnScore: [-12.9220 -10.7533 -10.7573]
                   OwnSequence: {'UUAA*UAG*UCUAGU*AA'  'GUAG*CAU*AGUGUCC*GC'  'GUAG*CAC*GGUGUCG*CC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [14 15 15]
            MeanSequenceLength: 14.6667
               DeficitEditData: [12353×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

3 sequences from 3D structures
Using 12353 random sequences, 0 from an alignment, and 3 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  12, J4_22413.2  has acceptance rules AlignmentScore >= -30.7533, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  29.7829
TP   100.00%, TN    96.00%, min    96.00%,   3 3D sequences,     0 alignment sequences, 12353 random sequences,  494 random matches, 15 NTs, cWW-F-cWW-F-cWW-cHW-F-F-F-cWW-F
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 494
1 * Deficit + 3 * Core Edit <= 19.0295
Motif index 1
Motif index 2
Motif index 3


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_24220.1'
                     Signature: {'cWW-F-F-tWS-F-F-cWW-tHS-cWW-cWW'}
                         NumNT: 15
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 12
                        NumBPh: 1
                         NumBR: 2
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 58
                      OwnScore: -9.9590
                   OwnSequence: {'AUAUAC*GAG*CC*GACU'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 14
            MeanSequenceLength: 14
               DeficitEditData: [6693×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 6693 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  13, J4_24220.1  has acceptance rules AlignmentScore >= -29.9590, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  28.7256
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 6693 random sequences,  268 random matches, 15 NTs, cWW-F-F-tWS-F-F-cWW-tHS-cWW-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 268
1 * Deficit + 3 * Core Edit <= 18.7666
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_26776.1'
                     Signature: {'cWW-tSH-F-cWW-cWW-F-tHS-cWW'}
                         NumNT: 14
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 12
                        NumBPh: 1
                         NumBR: 2
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 48
                      OwnScore: -10.5062
                   OwnSequence: {'CAG*CGGG*CAA*UGGG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 13
            MeanSequenceLength: 13
               DeficitEditData: [8425×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 8425 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  14, J4_26776.1  has acceptance rules AlignmentScore >= -30.5062, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  28.9132
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 8425 random sequences,  337 random matches, 14 NTs, cWW-tSH-F-cWW-cWW-F-tHS-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 337
1 * Deficit + 3 * Core Edit <= 18.4070
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_26796.1'
                     Signature: {'cWW-cSH-cWW-F-F-F-tHW-F-cWW-F-F-F-cWW'}
                         NumNT: 18
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 13
                        NumBPh: 2
                         NumBR: 1
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 72
                      OwnScore: -11.8726
                   OwnSequence: {'CAUUAAAUC*GCC*GUAAC*GG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 18
            MeanSequenceLength: 18
               DeficitEditData: [346×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 346 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  22.6903 because the cutoff seemed overly generous
Group  15, J4_26796.1  has acceptance rules AlignmentScore >= -31.8726, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  32.3576
TP   100.00%, TN    97.98%, min    97.98%,   1 3D sequences,     0 alignment sequences,  346 random sequences,    7 random matches, 18 NTs, cWW-cSH-cWW-F-F-F-tHW-F-cWW-F-F-F-cWW
Sensitivity 100.00%, Specificity  97.98%, Minimum  97.98% using method 8
Number of false positives with core edit > 0 is 7
1 * Deficit + 3 * Core Edit <= 20.4850
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_28426.1'
                     Signature: {'cWW-F-cWW-F-F-F-F-F-cWW-cWW'}
                         NumNT: 14
                  NumBasepairs: 4
                    Structured: 1
                     NumStacks: 8
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 60
                      OwnScore: -9.9665
                   OwnSequence: {'CACGAG*CG*UCAC*GG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 13
            MeanSequenceLength: 13
               DeficitEditData: [9666×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 9666 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  16, J4_28426.1  has acceptance rules AlignmentScore >= -29.9665, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  28.6519
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 9666 random sequences,  387 random matches, 14 NTs, cWW-F-cWW-F-F-F-F-F-cWW-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 387
1 * Deficit + 3 * Core Edit <= 18.6854
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_28473.1'
                     Signature: {'cWW-F-F-F-cWW-cWW-F-cWW-F'}
                         NumNT: 13
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 8
                        NumBPh: 1
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 50
                      OwnScore: -8.8578
                   OwnSequence: {'GAAC*GG*CACG*CAC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 12
            MeanSequenceLength: 12
               DeficitEditData: [18209×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 18209 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  17, J4_28473.1  has acceptance rules AlignmentScore >= -28.8578, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  25.9392
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 18206 random sequences,  728 random matches, 13 NTs, cWW-F-F-F-cWW-cWW-F-cWW-F
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 728
1 * Deficit + 3 * Core Edit <= 17.0814
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_34476.1'
                     Signature: {'cWW-F-F-F-F-tWS-tHS-F-cWW-cWW-F-F-tHS-cWW'}
                         NumNT: 21
                  NumBasepairs: 10
                    Structured: 1
                     NumStacks: 18
                        NumBPh: 2
                         NumBR: 4
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 58
                      OwnScore: [-13.1340 -13.1340]
                   OwnSequence: {'GACUG*CAUAG*UGAAU*AUUAAC'  'GACUG*CAUAG*UGAUU*AUUAAC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [20 20]
            MeanSequenceLength: 20
               DeficitEditData: [73×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 73 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  24.7246 because the cutoff seemed overly generous
Group  18, J4_34476.1  has acceptance rules AlignmentScore >= -33.1340, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  37.4407
TP   100.00%, TN    98.63%, min    98.63%,   2 3D sequences,     0 alignment sequences,   73 random sequences,    1 random matches, 21 NTs, cWW-F-F-F-F-tWS-tHS-F-cWW-cWW-F-F-tHS-cWW
Sensitivity 100.00%, Specificity  98.63%, Minimum  98.63% using method 8
Number of false positives with core edit > 0 is 1
1 * Deficit + 3 * Core Edit <= 24.3067
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_35578.2'
                     Signature: {'cWW-F-cWW-F-F-F-tHW-F-cWW-cWW'}
                         NumNT: 15
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 11
                        NumBPh: 1
                         NumBR: 1
                  NumInstances: 3
                      Truncate: [3×1 double]
                      NumFixed: 64
                      OwnScore: [-8.2564 -8.8206 -8.2564]
                   OwnSequence: {'GAGUAACG*UC*GUAG*CC'  'GAGUAAUG*UG*CUAG*CC'  'GAGUAACG*UC*GUAG*CC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [15 15 15]
            MeanSequenceLength: 15
               DeficitEditData: [2794×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

3 sequences from 3D structures
Using 2794 random sequences, 0 from an alignment, and 3 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  20.2685 because the cutoff seemed overly generous
Group  19, J4_35578.2  has acceptance rules AlignmentScore >= -28.2564, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  28.2564
TP   100.00%, TN    96.56%, min    96.56%,   3 3D sequences,     0 alignment sequences, 2793 random sequences,   96 random matches, 15 NTs, cWW-F-cWW-F-F-F-tHW-F-cWW-cWW
Sensitivity 100.00%, Specificity  96.56%, Minimum  96.56% using method 8
Number of false positives with core edit > 0 is 96
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2
Motif index 3


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_36296.1'
                     Signature: {'cWW-F-F-F-cWW-cWW-F-cWW'}
                         NumNT: 12
                  NumBasepairs: 4
                    Structured: 1
                     NumStacks: 9
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 5
                      Truncate: [3×1 double]
                      NumFixed: 52
                      OwnScore: [-14.6546 -12.2032 -12.1942 -16.3006 -14.9016]
                   OwnSequence: {1×5 cell}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [15 15 15 15 14]
            MeanSequenceLength: 14.8000
               DeficitEditData: [19772×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

5 sequences from 3D structures
Using 19772 random sequences, 0 from an alignment, and 5 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  20, J4_36296.1  has acceptance rules AlignmentScore >= -32.1942, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  30.2302
TP   100.00%, TN    96.00%, min    96.00%,   5 3D sequences,     0 alignment sequences, 19772 random sequences,  791 random matches, 12 NTs, cWW-F-F-F-cWW-cWW-F-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 791
1 * Deficit + 3 * Core Edit <= 18.0360
Motif index 1
Motif index 2
Motif index 3
Motif index 4
Motif index 5


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_36540.1'
                     Signature: {'cWW-cWW-F-F-F-cWW-F-cWW-F-F'}
                         NumNT: 14
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 8
                        NumBPh: 0
                         NumBR: 1
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 54
                      OwnScore: [-10.1653 -10.1653]
                   OwnSequence: {'GG*CGAA*UUGAU*AACC'  'GG*CGAA*UUGAU*AACC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [14 14]
            MeanSequenceLength: 14
               DeficitEditData: [9736×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 9736 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  20.0424 because the cutoff seemed overly generous
Group  21, J4_36540.1  has acceptance rules AlignmentScore >= -30.1653, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  30.1653
TP   100.00%, TN    96.05%, min    96.05%,   2 3D sequences,     0 alignment sequences, 9736 random sequences,  385 random matches, 14 NTs, cWW-cWW-F-F-F-cWW-F-cWW-F-F
Sensitivity 100.00%, Specificity  96.05%, Minimum  96.05% using method 8
Number of false positives with core edit > 0 is 385
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_36568.1'
                     Signature: {'cWW-tSS-cWW-cWW-cWW-tWH-tWH-F-cWW-F'}
                         NumNT: 17
                  NumBasepairs: 11
                    Structured: 1
                     NumStacks: 13
                        NumBPh: 0
                         NumBR: 2
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 52
                      OwnScore: [-10.0468 -10.0468]
                   OwnSequence: {'GAG*CAUGUG*CAAAG*CGC'  'GAG*CAUGUG*CAAAG*CGC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [16 16]
            MeanSequenceLength: 16
               DeficitEditData: [726×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 726 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  20.0372 because the cutoff seemed overly generous
Group  22, J4_36568.1  has acceptance rules AlignmentScore >= -30.0468, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  30.0468
TP   100.00%, TN    96.01%, min    96.01%,   2 3D sequences,     0 alignment sequences,  726 random sequences,   29 random matches, 17 NTs, cWW-tSS-cWW-cWW-cWW-tWH-tWH-F-cWW-F
Sensitivity 100.00%, Specificity  96.01%, Minimum  96.01% using method 8
Number of false positives with core edit > 0 is 29
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_40439.2'
                     Signature: {'cWW-F-cWW-F-F-F-F-F-cWW-F-cWW'}
                         NumNT: 15
                  NumBasepairs: 4
                    Structured: 1
                     NumStacks: 8
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 3
                      Truncate: [3×1 double]
                      NumFixed: 64
                      OwnScore: [-9.4169 -8.8493 -8.8493]
                   OwnSequence: {'CAAGAG*CA*UAAAU*AG'  'CAAGAG*CG*CAAUU*AG'  'CAAGAG*CG*CAAUU*AG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [14 14 14]
            MeanSequenceLength: 14
               DeficitEditData: [6629×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

3 sequences from 3D structures
Using 6629 random sequences, 0 from an alignment, and 3 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  23, J4_40439.2  has acceptance rules AlignmentScore >= -28.8493, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  24.8476
TP   100.00%, TN    96.00%, min    96.00%,   3 3D sequences,     0 alignment sequences, 6629 random sequences,  265 random matches, 15 NTs, cWW-F-cWW-F-F-F-F-F-cWW-F-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 265
1 * Deficit + 3 * Core Edit <= 15.9984
Motif index 1
Motif index 2
Motif index 3


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_43687.1'
                     Signature: {'cWW-cWW-cWW-cWW-cWW'}
                         NumNT: 10
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 8
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 38
                      OwnScore: [-8.5986 -9.7620]
                   OwnSequence: {'UG*CUA*UCU*AA'  'GC*GGC*GACG*CC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [9 10]
            MeanSequenceLength: 9.5000
               DeficitEditData: [17771×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 17771 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Increased cutoff to   9.5000 so that at least a few sequences with core edit distance 1 can meet the cutoff
Group  24, J4_43687.1  has acceptance rules AlignmentScore >= -28.5986, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  18.0986
TP   100.00%, TN    91.96%, min    91.96%,   2 3D sequences,     0 alignment sequences, 17703 random sequences, 1424 random matches, 10 NTs, cWW-cWW-cWW-cWW-cWW
Sensitivity 100.00%, Specificity  91.96%, Minimum  91.96% using method 11
Number of false positives with core edit > 0 is 1424
1 * Deficit + 3 * Core Edit <= 9.5000
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_44058.1'
                     Signature: {'cWW-cWW-F-cWW-F-cWW-cWW-F-cWW-F'}
                         NumNT: 16
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 8
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 50
                      OwnScore: -13.0406
                   OwnSequence: {'GGAAA*UGCG*CAC*GGAUAC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 17
            MeanSequenceLength: 17
               DeficitEditData: [1889×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 1889 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  25, J4_44058.1  has acceptance rules AlignmentScore >= -33.0406, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  32.7644
TP   100.00%, TN    95.98%, min    95.98%,   1 3D sequences,     0 alignment sequences, 1889 random sequences,   76 random matches, 16 NTs, cWW-cWW-F-cWW-F-cWW-cWW-F-cWW-F
Sensitivity 100.00%, Specificity  95.98%, Minimum  95.98% using method 6
Number of false positives with core edit > 0 is 76
1 * Deficit + 3 * Core Edit <= 19.7237
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_45582.1'
                     Signature: {'cWW-F-cWW-cWW-cWW-cWW'}
                         NumNT: 11
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 7
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 42
                      OwnScore: -7.8706
                   OwnSequence: {'CGA*UG*CGG*CAG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 10
            MeanSequenceLength: 10
               DeficitEditData: [16975×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 16975 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  26, J4_45582.1  has acceptance rules AlignmentScore >= -27.8706, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  18.3636
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 16950 random sequences,  678 random matches, 11 NTs, cWW-F-cWW-cWW-cWW-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 678
1 * Deficit + 3 * Core Edit <= 10.4930
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_45801.2'
                     Signature: {'cWW-cWW-cSS-F-tHH-cWW-cSH-tWH-F-tHS-F-cWW'}
                         NumNT: 19
                  NumBasepairs: 11
                    Structured: 1
                     NumStacks: 16
                        NumBPh: 4
                         NumBR: 3
                  NumInstances: 6
                      Truncate: [3×1 double]
                      NumFixed: 64
                      OwnScore: [-12.6390 -12.9057 -12.1282 -11.2831 -12.2538 -16.1335]
                   OwnSequence: {1×6 cell}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [19 19 19 19 19 18]
            MeanSequenceLength: 18.8333
               DeficitEditData: [335×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

6 sequences from 3D structures
Using 335 random sequences, 0 from an alignment, and 6 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  21.0887 because the cutoff seemed overly generous
Group  27, J4_45801.2  has acceptance rules AlignmentScore >= -31.2831, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  31.2831
TP   100.00%, TN    97.31%, min    97.31%,   6 3D sequences,     0 alignment sequences,  335 random sequences,    9 random matches, 19 NTs, cWW-cWW-cSS-F-tHH-cWW-cSH-tWH-F-tHS-F-cWW
Sensitivity 100.00%, Specificity  97.31%, Minimum  97.31% using method 8
Number of false positives with core edit > 0 is 9
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2
Motif index 3
Motif index 4
Motif index 5
Motif index 6


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_46448.1'
                     Signature: {'cWW-cWS-tSH-cWW-cWW-cWW'}
                         NumNT: 11
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 6
                        NumBPh: 0
                         NumBR: 1
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 44
                      OwnScore: -6.8542
                   OwnSequence: {'CGU*AA*UG*UUAG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 10
            MeanSequenceLength: 10
               DeficitEditData: [8695×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 8695 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  28, J4_46448.1  has acceptance rules AlignmentScore >= -26.8542, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  18.4342
TP   100.00%, TN    95.99%, min    95.99%,   1 3D sequences,     0 alignment sequences, 8658 random sequences,  347 random matches, 11 NTs, cWW-cWS-tSH-cWW-cWW-cWW
Sensitivity 100.00%, Specificity  95.99%, Minimum  95.99% using method 6
Number of false positives with core edit > 0 is 347
1 * Deficit + 3 * Core Edit <= 11.5800
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_47478.1'
                     Signature: {'cWW-F-cWW-cWS-cHW-cWW-cWW'}
                         NumNT: 11
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 7
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 48
                      OwnScore: -8.2881
                   OwnSequence: {'GAAC*GA*UUG*CC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 10
            MeanSequenceLength: 10
               DeficitEditData: [20857×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 20857 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  29, J4_47478.1  has acceptance rules AlignmentScore >= -28.2881, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  18.2349
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 20825 random sequences,  834 random matches, 11 NTs, cWW-F-cWW-cWS-cHW-cWW-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 834
1 * Deficit + 3 * Core Edit <= 9.9468
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_48692.1'
                     Signature: {'cWW-tHW-F-F-cWW-cWW-cWW'}
                         NumNT: 12
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 9
                        NumBPh: 1
                         NumBR: 1
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 46
                      OwnScore: -7.4400
                   OwnSequence: {'AUAAU*AG*CC*GAUU'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 12
            MeanSequenceLength: 12
               DeficitEditData: [12142×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 12142 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  30, J4_48692.1  has acceptance rules AlignmentScore >= -27.4400, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  24.3633
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 12142 random sequences,  486 random matches, 12 NTs, cWW-tHW-F-F-cWW-cWW-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 486
1 * Deficit + 3 * Core Edit <= 16.9233
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_48907.1'
                     Signature: {'cWW-cWW-cWW-cWW'}
                         NumNT: 8
                  NumBasepairs: 4
                    Structured: 1
                     NumStacks: 6
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 36
                      OwnScore: [-5.9967 -5.9967]
                   OwnSequence: {'GC*GG*CG*CC'  'GC*GG*CG*CC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [7 7]
            MeanSequenceLength: 7
               DeficitEditData: [8086×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 8086 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Increased cutoff to   9.5000 so that at least a few sequences with core edit distance 1 can meet the cutoff
Group  31, J4_48907.1  has acceptance rules AlignmentScore >= -25.9967, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  15.4967
TP   100.00%, TN    82.49%, min    82.49%,   2 3D sequences,     0 alignment sequences, 7636 random sequences, 1337 random matches,  8 NTs, cWW-cWW-cWW-cWW
Sensitivity 100.00%, Specificity  82.49%, Minimum  82.49% using method 11
Number of false positives with core edit > 0 is 1337
1 * Deficit + 3 * Core Edit <= 9.5000
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_51403.1'
                     Signature: {'cWW-cHH-tSH-F-cWW-F-cWW-cSS-cWW-F-cWW'}
                         NumNT: 18
                  NumBasepairs: 8
                    Structured: 1
                     NumStacks: 13
                        NumBPh: 1
                         NumBR: 1
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 58
                      OwnScore: -11.6907
                   OwnSequence: {'CUAUG*CGUC*GAG*CGUGUG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 17
            MeanSequenceLength: 17
               DeficitEditData: [1037×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 1037 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  21.2915 because the cutoff seemed overly generous
Group  32, J4_51403.1  has acceptance rules AlignmentScore >= -31.6907, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  31.6907
TP   100.00%, TN    97.30%, min    97.30%,   1 3D sequences,     0 alignment sequences, 1037 random sequences,   28 random matches, 18 NTs, cWW-cHH-tSH-F-cWW-F-cWW-cSS-cWW-F-cWW
Sensitivity 100.00%, Specificity  97.30%, Minimum  97.30% using method 8
Number of false positives with core edit > 0 is 28
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_54165.1'
                     Signature: {'cWW-F-F-F-cWW-cWW-cWW-cWW-cWW-F-F'}
                         NumNT: 17
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 11
                        NumBPh: 1
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 54
                      OwnScore: -11.5425
                   OwnSequence: {'GAGU*AAC*GGAACG*CAGC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 16
            MeanSequenceLength: 16
               DeficitEditData: [1646×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 1646 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  21.1294 because the cutoff seemed overly generous
Group  33, J4_54165.1  has acceptance rules AlignmentScore >= -31.5425, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  31.5425
TP   100.00%, TN    97.33%, min    97.33%,   1 3D sequences,     0 alignment sequences, 1646 random sequences,   44 random matches, 17 NTs, cWW-F-F-F-cWW-cWW-cWW-cWW-cWW-F-F
Sensitivity 100.00%, Specificity  97.33%, Minimum  97.33% using method 8
Number of false positives with core edit > 0 is 44
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_57327.1'
                     Signature: {'cWW-F-F-F-F-F-F-F-F-cWW-F-cWW-F-F-F'}
                         NumNT: 18
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 10
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 70
                      OwnScore: -14.9668
                   OwnSequence: {'UAUCGCC*GGCAC*GCUUUCC*GUA'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 21
            MeanSequenceLength: 21
               DeficitEditData: [2×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 2 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  34, J4_57327.1  has acceptance rules AlignmentScore >= -34.9668, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  39.9668
TP   100.00%, TN   100.00%, min   100.00%,   1 3D sequences,     0 alignment sequences,    2 random sequences,    0 random matches, 18 NTs, cWW-F-F-F-F-F-F-F-F-cWW-F-cWW-F-F-F
Sensitivity 100.00%, Specificity 100.00%, Minimum 100.00% using method 1
Number of false positives with core edit > 0 is 0
1 * Deficit + 3 * Core Edit <= 25.0000
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_57344.1'
                     Signature: {'cWW-F-cWW-F-cWW-cSH-cWW'}
                         NumNT: 11
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 7
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 52
                      OwnScore: -6.5534
                   OwnSequence: {'CUG*CG*CAGC*GG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 10
            MeanSequenceLength: 10
               DeficitEditData: [11476×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 11476 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  35, J4_57344.1  has acceptance rules AlignmentScore >= -26.5534, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  19.2204
TP   100.00%, TN    95.96%, min    95.96%,   1 3D sequences,     0 alignment sequences, 11456 random sequences,  463 random matches, 11 NTs, cWW-F-cWW-F-cWW-cSH-cWW
Sensitivity 100.00%, Specificity  95.96%, Minimum  95.96% using method 6
Number of false positives with core edit > 0 is 463
1 * Deficit + 3 * Core Edit <= 12.6670
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_59634.1'
                     Signature: {'cWW-F-F-F-cHS-F-F-F-F-F-F-F-F'}
                         NumNT: 15
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 12
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 62
                      OwnScore: -13.0345
                   OwnSequence: {'UUAGCU*AGCG*UGGGCG*CA'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 17
            MeanSequenceLength: 17
               DeficitEditData: [284×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 284 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  23.8178 because the cutoff seemed overly generous
Group  36, J4_59634.1  has acceptance rules AlignmentScore >= -33.0345, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  35.3197
TP   100.00%, TN    97.89%, min    97.89%,   1 3D sequences,     0 alignment sequences,  284 random sequences,    6 random matches, 15 NTs, cWW-F-F-F-cHS-F-F-F-F-F-F-F-F
Sensitivity 100.00%, Specificity  97.89%, Minimum  97.89% using method 8
Number of false positives with core edit > 0 is 6
1 * Deficit + 3 * Core Edit <= 22.2853
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_59845.1'
                     Signature: {'cWW-tSW-F-cWW-F-F-cWW-F-F-cWW-F-F'}
                         NumNT: 16
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 11
                        NumBPh: 0
                         NumBR: 3
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 64
                      OwnScore: [-9.8476 -9.5307]
                   OwnSequence: {'AGU*AG*CACAC*GAUAGGU'  'AGU*AG*UACAC*GGUAGGU'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [16 16]
            MeanSequenceLength: 16
               DeficitEditData: [1564×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 1564 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  21.2451 because the cutoff seemed overly generous
Group  37, J4_59845.1  has acceptance rules AlignmentScore >= -29.5307, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  29.5307
TP   100.00%, TN    97.70%, min    97.70%,   2 3D sequences,     0 alignment sequences, 1564 random sequences,   36 random matches, 16 NTs, cWW-tSW-F-cWW-F-F-cWW-F-F-cWW-F-F
Sensitivity 100.00%, Specificity  97.70%, Minimum  97.70% using method 8
Number of false positives with core edit > 0 is 36
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_60168.1'
                     Signature: {'cWW-F-F-F-F-F-cWW-F-F-F-cWW-F-tSS-F-cWW'}
                         NumNT: 20
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 11
                        NumBPh: 2
                         NumBR: 2
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 76
                      OwnScore: [-15.0098 -14.2763]
                   OwnSequence: {'CAAG*CGUAG*CGAGU*GCGUUUAG'  'CAAG*CGAAG*CGAG*CGUUAAG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [21 19]
            MeanSequenceLength: 20
               DeficitEditData: [396×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 396 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  20.4048 because the cutoff seemed overly generous
Group  38, J4_60168.1  has acceptance rules AlignmentScore >= -34.2763, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  34.2763
TP   100.00%, TN    96.72%, min    96.72%,   2 3D sequences,     0 alignment sequences,  396 random sequences,   13 random matches, 20 NTs, cWW-F-F-F-F-F-cWW-F-F-F-cWW-F-tSS-F-cWW
Sensitivity 100.00%, Specificity  96.72%, Minimum  96.72% using method 8
Number of false positives with core edit > 0 is 13
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_61477.2'
                     Signature: {'cWW-tSW-F-tHS-tHS-F-cWW-cWW-F-tHS-cWW'}
                         NumNT: 19
                  NumBasepairs: 10
                    Structured: 1
                     NumStacks: 16
                        NumBPh: 2
                         NumBR: 3
                  NumInstances: 4
                      Truncate: [3×1 double]
                      NumFixed: 50
                      OwnScore: [-11.1901 -12.1830 -11.0851 -11.0851]
                   OwnSequence: {'AACUG*CACAG*UGAC*GUAAU'  'GACUG*CACAG*CGAC*GUAAC'  'GACUG*CACAG*UGAC*GUAAC'  'GACUG*CACAG*UGAC*GUAAC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [18 18 18 18]
            MeanSequenceLength: 18
               DeficitEditData: [159×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

4 sequences from 3D structures
Using 159 random sequences, 0 from an alignment, and 4 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  23.6505 because the cutoff seemed overly generous
Group  39, J4_61477.2  has acceptance rules AlignmentScore >= -31.0851, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  31.8422
TP   100.00%, TN    98.11%, min    98.11%,   4 3D sequences,     0 alignment sequences,  159 random sequences,    3 random matches, 19 NTs, cWW-tSW-F-tHS-tHS-F-cWW-cWW-F-tHS-cWW
Sensitivity 100.00%, Specificity  98.11%, Minimum  98.11% using method 8
Number of false positives with core edit > 0 is 3
1 * Deficit + 3 * Core Edit <= 20.7571
Motif index 1
Motif index 2
Motif index 3
Motif index 4


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_61885.2'
                     Signature: {'cWW-F-cWW-cWW-F-F-F-tHW-F-F-F-F-F-cWW-F-F-F'}
                         NumNT: 22
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 19
                        NumBPh: 4
                         NumBR: 1
                  NumInstances: 4
                      Truncate: [3×1 double]
                      NumFixed: 74
                      OwnScore: [-11.4143 -11.4143 -12.4359 -13.9595]
                   OwnSequence: {1×4 cell}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [22 22 22 22]
            MeanSequenceLength: 22
               DeficitEditData: [6×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

4 sequences from 3D structures
Using 6 random sequences, 0 from an alignment, and 4 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  40, J4_61885.2  has acceptance rules AlignmentScore >= -31.4143, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  36.4143
TP   100.00%, TN   100.00%, min   100.00%,   4 3D sequences,     0 alignment sequences,    6 random sequences,    0 random matches, 22 NTs, cWW-F-cWW-cWW-F-F-F-tHW-F-F-F-F-F-cWW-F-F-F
Sensitivity 100.00%, Specificity 100.00%, Minimum 100.00% using method 1
Number of false positives with core edit > 0 is 0
1 * Deficit + 3 * Core Edit <= 25.0000
Motif index 1
Motif index 2
Motif index 3
Motif index 4


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_63076.1'
                     Signature: {'cWW-tSS-cWW-cWW-cWW'}
                         NumNT: 9
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 5
                        NumBPh: 0
                         NumBR: 1
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 40
                      OwnScore: [-6.2152 -6.2152]
                   OwnSequence: {'AC*GCAG*CC*GU'  'AC*GCAG*CC*GU'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [9 9]
            MeanSequenceLength: 9
               DeficitEditData: [15213×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 15213 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Increased cutoff to   9.5000 so that at least a few sequences with core edit distance 1 can meet the cutoff
Group  41, J4_63076.1  has acceptance rules AlignmentScore >= -26.2152, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  15.7152
TP   100.00%, TN    94.52%, min    94.52%,   2 3D sequences,     0 alignment sequences, 15195 random sequences,  832 random matches,  9 NTs, cWW-tSS-cWW-cWW-cWW
Sensitivity 100.00%, Specificity  94.52%, Minimum  94.52% using method 11
Number of false positives with core edit > 0 is 832
1 * Deficit + 3 * Core Edit <= 9.5000
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_64075.1'
                     Signature: {'cWW-tWW-cWW-F-F-cHW-F-cWW-tSS-cSS-cSH-tWH-tHS-cWW'}
                         NumNT: 20
                  NumBasepairs: 12
                    Structured: 1
                     NumStacks: 19
                        NumBPh: 3
                         NumBR: 3
                  NumInstances: 4
                      Truncate: [3×1 double]
                      NumFixed: 62
                      OwnScore: [-12.1880 -13.6122 -12.8715 -12.8715]
                   OwnSequence: {1×4 cell}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [20 20 20 20]
            MeanSequenceLength: 20
               DeficitEditData: [55×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

4 sequences from 3D structures
Using 55 random sequences, 0 from an alignment, and 4 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  20.8834 because the cutoff seemed overly generous
Group  42, J4_64075.1  has acceptance rules AlignmentScore >= -32.1880, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  32.1880
TP   100.00%, TN    98.18%, min    98.18%,   4 3D sequences,     0 alignment sequences,   55 random sequences,    1 random matches, 20 NTs, cWW-tWW-cWW-F-F-cHW-F-cWW-tSS-cSS-cSH-tWH-tHS-cWW
Sensitivity 100.00%, Specificity  98.18%, Minimum  98.18% using method 8
Number of false positives with core edit > 0 is 1
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2
Motif index 3
Motif index 4


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_64571.2'
                     Signature: {'cWW-F-cWW-tSS-cWW-F-cWW'}
                         NumNT: 11
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 7
                        NumBPh: 2
                         NumBR: 1
                  NumInstances: 4
                      Truncate: [3×1 double]
                      NumFixed: 48
                      OwnScore: [-11.3329 -10.3807 -10.3807 -11.3317]
                   OwnSequence: {'CGAUAAA*UC*GCUU*AG'  'CGAUAAA*UC*GCGC*GG'  'CGAUAAA*UC*GCGC*GG'  'CGAAAG*CC*GAGC*GG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [14 14 14 13]
            MeanSequenceLength: 13.7500
               DeficitEditData: [12791×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

4 sequences from 3D structures
Using 12791 random sequences, 0 from an alignment, and 4 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  43, J4_64571.2  has acceptance rules AlignmentScore >= -30.3807, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  26.8325
TP   100.00%, TN    96.00%, min    96.00%,   4 3D sequences,     0 alignment sequences, 12790 random sequences,  512 random matches, 11 NTs, cWW-F-cWW-tSS-cWW-F-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 512
1 * Deficit + 3 * Core Edit <= 16.4518
Motif index 1
Motif index 2
Motif index 3
Motif index 4


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_65052.1'
                     Signature: {'cWW-cWW-cWW-F-cWW-tWS-cWW'}
                         NumNT: 12
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 7
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 46
                      OwnScore: -8.4224
                   OwnSequence: {'CUG*CGC*GA*UCUG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 11
            MeanSequenceLength: 11
               DeficitEditData: [19187×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 19187 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  44, J4_65052.1  has acceptance rules AlignmentScore >= -28.4224, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  22.5119
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 19186 random sequences,  767 random matches, 12 NTs, cWW-cWW-cWW-F-cWW-tWS-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 767
1 * Deficit + 3 * Core Edit <= 14.0895
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_65285.1'
                     Signature: {'cWW-F-F-F-F-F-cWW-cWW-F-cWW-F'}
                         NumNT: 13
                  NumBasepairs: 4
                    Structured: 1
                     NumStacks: 8
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 56
                      OwnScore: [-15.8151 -18.0213]
                   OwnSequence: {'GUGG*CGGC*GCUUUACC*GC'  'AUAG*CAUU*AGAGGUCC*GU'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [17 17]
            MeanSequenceLength: 17
               DeficitEditData: [1890×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 1890 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  45, J4_65285.1  has acceptance rules AlignmentScore >= -35.8151, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  33.7253
TP   100.00%, TN    95.98%, min    95.98%,   2 3D sequences,     0 alignment sequences, 1890 random sequences,   76 random matches, 13 NTs, cWW-F-F-F-F-F-cWW-cWW-F-cWW-F
Sensitivity 100.00%, Specificity  95.98%, Minimum  95.98% using method 6
Number of false positives with core edit > 0 is 76
1 * Deficit + 3 * Core Edit <= 17.9102
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_69051.2'
                     Signature: {'cWW-F-cWW-F-tHW-F-cWW-F-F-F-F-F-cWW-cWW'}
                         NumNT: 20
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 14
                        NumBPh: 2
                         NumBR: 2
                  NumInstances: 6
                      Truncate: [3×1 double]
                      NumFixed: 72
                      OwnScore: [-9.6977 -9.1099 -10.8916 -8.3579 -9.8173 -10.9169]
                   OwnSequence: {1×6 cell}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [20 20 20 20 20 20]
            MeanSequenceLength: 20
               DeficitEditData: [33×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

6 sequences from 3D structures
Using 33 random sequences, 0 from an alignment, and 6 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  46, J4_69051.2  has acceptance rules AlignmentScore >= -28.3579, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  28.1074
TP   100.00%, TN    96.97%, min    96.97%,   6 3D sequences,     0 alignment sequences,   33 random sequences,    1 random matches, 20 NTs, cWW-F-cWW-F-tHW-F-cWW-F-F-F-F-F-cWW-cWW
Sensitivity 100.00%, Specificity  96.97%, Minimum  96.97% using method 6
Number of false positives with core edit > 0 is 1
1 * Deficit + 3 * Core Edit <= 19.7494
Motif index 1
Motif index 2
Motif index 3
Motif index 4
Motif index 5
Motif index 6


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_69073.1'
                     Signature: {'cWW-cHS-cWW-cWS-cHW-cWW-cWW'}
                         NumNT: 11
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 7
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 48
                      OwnScore: -8.2881
                   OwnSequence: {'GAAC*GA*UUG*CC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 10
            MeanSequenceLength: 10
               DeficitEditData: [20857×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 20857 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  47, J4_69073.1  has acceptance rules AlignmentScore >= -28.2881, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  18.2349
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 20825 random sequences,  834 random matches, 11 NTs, cWW-cHS-cWW-cWS-cHW-cWW-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 834
1 * Deficit + 3 * Core Edit <= 9.9468
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_69568.1'
                     Signature: {'cWW-F-cWW-F-cWW-F-F-cWW'}
                         NumNT: 12
                  NumBasepairs: 4
                    Structured: 1
                     NumStacks: 7
                        NumBPh: 0
                         NumBR: 1
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 52
                      OwnScore: -10.5970
                   OwnSequence: {'CAAAUAU*AG*UGAU*AG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 14
            MeanSequenceLength: 14
               DeficitEditData: [8731×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 8731 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  48, J4_69568.1  has acceptance rules AlignmentScore >= -30.5970, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  28.1417
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 8731 random sequences,  349 random matches, 12 NTs, cWW-F-cWW-F-cWW-F-F-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 349
1 * Deficit + 3 * Core Edit <= 17.5447
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_70449.12'
                     Signature: {'cWW-F-cWW-cWW-cHS-F-cWW-cWW'}
                         NumNT: 13
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 10
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 42
                      Truncate: [3×1 double]
                      NumFixed: 50
                      OwnScore: [-8.3995 -11.2515 -9.1742 -8.8332 -9.0843 -9.2416 -9.1877 -11.4990 -11.3721 -9.4830 -8.6112 -9.4830 … ]
                   OwnSequence: {1×42 cell}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 14 15 15 15 15 15 15 15 15 15 14 15 … ]
            MeanSequenceLength: 14.8810
               DeficitEditData: [3302×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

42 sequences from 3D structures
Using 3302 random sequences, 0 from an alignment, and 42 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  49, J4_70449.12 has acceptance rules AlignmentScore >= -28.3995, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  26.7326
TP   100.00%, TN    96.00%, min    96.00%,  42 3D sequences,     0 alignment sequences, 3302 random sequences,  132 random matches, 13 NTs, cWW-F-cWW-cWW-cHS-F-cWW-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 132
1 * Deficit + 3 * Core Edit <= 18.3330
Motif index 1
Motif index 2
Motif index 3
Motif index 4
Motif index 5
Motif index 6
Motif index 7
Motif index 8
Motif index 9
Motif index 10
Motif index 11
Motif index 12
Motif index 13
Motif index 14
Motif index 15
Motif index 16
Motif index 17
Motif index 18
Motif index 19
Motif index 20
Motif index 21
Motif index 22
Motif index 23
Motif index 24
Motif index 25
Motif index 26
Motif index 27
Motif index 28
Motif index 29
Motif index 30
Motif index 31
Motif index 32
Motif index 33
Motif index 34
Motif index 35
Motif index 36
Motif index 37
Motif index 38
Motif index 39
Motif index 40
Motif index 41
Motif index 42


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_70672.1'
                     Signature: {'cWW-tSH-F-F-F-F-F-F-cSW-F-tHS-cWW-cWW-cWW-F-cWW-F'}
                         NumNT: 24
                  NumBasepairs: 9
                    Structured: 1
                     NumStacks: 19
                        NumBPh: 1
                         NumBR: 4
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 84
                      OwnScore: [-13.7023 -13.7023]
                   OwnSequence: {'CGGGGCAG*CGACC*GAC*GGAUGAGAG'  'CGGGGCAG*CGACC*GAC*GGAUGAGAG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [24 24]
            MeanSequenceLength: 24
               DeficitEditData: [0×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 0 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
No random sequence matches, so essentially no model-specific cutoff imposed
Decreased cutoff to  25.0000 so that it is possible to reject matches
Group  50, J4_70672.1  has acceptance rules AlignmentScore >= -33.7023, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  38.7023
TP   100.00%, TN      NaN%, min   100.00%,   2 3D sequences,     0 alignment sequences,    0 random sequences,    0 random matches, 24 NTs, cWW-tSH-F-F-F-F-F-F-cSW-F-tHS-cWW-cWW-cWW-F-cWW-F
Sensitivity 100.00%, Specificity    NaN%, Minimum 100.00% using method 12
Number of false positives with core edit > 0 is 0
1 * Deficit + 3 * Core Edit <= 25.0000
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_71729.2'
                     Signature: {'cWW-tSH-cHH-F-F-tHS-cWW-cWW-F-F-cWW'}
                         NumNT: 17
                  NumBasepairs: 8
                    Structured: 1
                     NumStacks: 14
                        NumBPh: 2
                         NumBR: 2
                  NumInstances: 4
                      Truncate: [3×1 double]
                      NumFixed: 62
                      OwnScore: [-8.7400 -9.6992 -8.9402 -8.7404]
                   OwnSequence: {'CGAAG*CGCC*GAG*CGUAG'  'CGAAU*AAUC*GAA*UGUAG'  'GGAAG*CGCG*CAG*CGUAC'  'CGAAG*CACC*GAA*UGUAG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [16 16 16 16]
            MeanSequenceLength: 16
               DeficitEditData: [1212×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

4 sequences from 3D structures
Using 1212 random sequences, 0 from an alignment, and 4 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  51, J4_71729.2  has acceptance rules AlignmentScore >= -28.7400, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  27.5452
TP   100.00%, TN    96.04%, min    96.04%,   4 3D sequences,     0 alignment sequences, 1212 random sequences,   48 random matches, 17 NTs, cWW-tSH-cHH-F-F-tHS-cWW-cWW-F-F-cWW
Sensitivity 100.00%, Specificity  96.04%, Minimum  96.04% using method 6
Number of false positives with core edit > 0 is 48
1 * Deficit + 3 * Core Edit <= 18.8052
Motif index 1
Motif index 2
Motif index 3
Motif index 4


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_72305.3'
                     Signature: {'cWW-F-cWW-cWW-cHS-F-cWW'}
                         NumNT: 11
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 9
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 6
                      Truncate: [3×1 double]
                      NumFixed: 48
                      OwnScore: [-10.3470 -10.3470 -10.2764 -11.8995 -15.6592 -12.8574]
                   OwnSequence: {1×6 cell}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [12 12 12 12 13 12]
            MeanSequenceLength: 12.1667
               DeficitEditData: [22143×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

6 sequences from 3D structures
Using 22143 random sequences, 0 from an alignment, and 6 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  52, J4_72305.3  has acceptance rules AlignmentScore >= -30.2764, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  23.8701
TP   100.00%, TN    96.00%, min    96.00%,   6 3D sequences,     0 alignment sequences, 22140 random sequences,  886 random matches, 11 NTs, cWW-F-cWW-cWW-cHS-F-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 886
1 * Deficit + 3 * Core Edit <= 13.5937
Motif index 1
Motif index 2
Motif index 3
Motif index 4
Motif index 5
Motif index 6


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_75852.1'
                     Signature: {'cWW-tSW-cSS-cWW-F-cSH-cWW-cWW-F-F'}
                         NumNT: 16
                  NumBasepairs: 9
                    Structured: 1
                     NumStacks: 11
                        NumBPh: 0
                         NumBR: 2
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 60
                      OwnScore: -10.2038
                   OwnSequence: {'AGU*AG*UACAC*GCAAGU'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 15
            MeanSequenceLength: 15
               DeficitEditData: [1456×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 1456 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  20.7815 because the cutoff seemed overly generous
Group  53, J4_75852.1  has acceptance rules AlignmentScore >= -30.2038, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  30.2038
TP   100.00%, TN    97.18%, min    97.18%,   1 3D sequences,     0 alignment sequences, 1456 random sequences,   41 random matches, 16 NTs, cWW-tSW-cSS-cWW-F-cSH-cWW-cWW-F-F
Sensitivity 100.00%, Specificity  97.18%, Minimum  97.18% using method 8
Number of false positives with core edit > 0 is 41
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_75971.1'
                     Signature: {'cWW-tSS-cWW-cWW-cWW-cWW'}
                         NumNT: 11
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 6
                        NumBPh: 1
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 42
                      OwnScore: -6.7717
                   OwnSequence: {'UAA*UC*GCU*AUG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 10
            MeanSequenceLength: 10
               DeficitEditData: [12665×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 12665 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  54, J4_75971.1  has acceptance rules AlignmentScore >= -26.7717, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  21.4133
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 12657 random sequences,  506 random matches, 11 NTs, cWW-tSS-cWW-cWW-cWW-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 506
1 * Deficit + 3 * Core Edit <= 14.6415
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_76405.1'
                     Signature: {'cWW-F-F-F-cWW-F-cWW-cWW-F'}
                         NumNT: 13
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 10
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 52
                      OwnScore: -8.4158
                   OwnSequence: {'UCA*UC*GAG*CAAAA'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 12
            MeanSequenceLength: 12
               DeficitEditData: [9215×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 9215 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  55, J4_76405.1  has acceptance rules AlignmentScore >= -28.4158, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  26.1944
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 9215 random sequences,  369 random matches, 13 NTs, cWW-F-F-F-cWW-F-cWW-cWW-F
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 369
1 * Deficit + 3 * Core Edit <= 17.7786
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_77044.1'
                     Signature: {'cWW-cWW-F-cWW-tHS-cWW-F-F-cWW'}
                         NumNT: 15
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 10
                        NumBPh: 1
                         NumBR: 1
                  NumInstances: 3
                      Truncate: [3×1 double]
                      NumFixed: 52
                      OwnScore: [-10.0153 -9.7746 -10.3772]
                   OwnSequence: {'GGGC*GAC*GGAAG*UGC'  'GGGC*GAC*GGAAG*CGC'  'GAGC*GAC*GGACG*CCC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [14 14 14]
            MeanSequenceLength: 14
               DeficitEditData: [8428×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

3 sequences from 3D structures
Using 8428 random sequences, 0 from an alignment, and 3 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  56, J4_77044.1  has acceptance rules AlignmentScore >= -29.7746, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  28.4925
TP   100.00%, TN    96.00%, min    96.00%,   3 3D sequences,     0 alignment sequences, 8428 random sequences,  337 random matches, 15 NTs, cWW-cWW-F-cWW-tHS-cWW-F-F-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 337
1 * Deficit + 3 * Core Edit <= 18.7178
Motif index 1
Motif index 2
Motif index 3


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_78628.1'
                     Signature: {'cWW-cWW-cWW-cWW'}
                         NumNT: 8
                  NumBasepairs: 4
                    Structured: 1
                     NumStacks: 6
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 4
                      Truncate: [3×1 double]
                      NumFixed: 36
                      OwnScore: [-6.8455 -6.8214 -8.8700 -7.6657]
                   OwnSequence: {'GG*UU*AC*GC'  'AG*UC*GG*CU'  'GAC*GC*GG*CC'  'GG*CG*CG*UC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [7 7 8 7]
            MeanSequenceLength: 7.2500
               DeficitEditData: [10035×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

4 sequences from 3D structures
Using 10035 random sequences, 0 from an alignment, and 4 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Increased cutoff to   9.5000 so that at least a few sequences with core edit distance 1 can meet the cutoff
Group  57, J4_78628.1  has acceptance rules AlignmentScore >= -26.8214, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  16.3214
TP   100.00%, TN    87.12%, min    87.12%,   4 3D sequences,     0 alignment sequences, 9058 random sequences, 1167 random matches,  8 NTs, cWW-cWW-cWW-cWW
Sensitivity 100.00%, Specificity  87.12%, Minimum  87.12% using method 11
Number of false positives with core edit > 0 is 1167
1 * Deficit + 3 * Core Edit <= 9.5000
Motif index 1
Motif index 2
Motif index 3
Motif index 4


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_80682.1'
                     Signature: {'cWW-F-F-F-F-F-cWW-cWW-F-cWW-F'}
                         NumNT: 18
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 15
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 64
                      OwnScore: [-15.9226 -17.7102]
                   OwnSequence: {'UUAAC*GCGC*GAGGUCC*GA'  'GUAGU*GCAGC*GCCUUACG*CC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [17 19]
            MeanSequenceLength: 18
               DeficitEditData: [766×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 766 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  58, J4_80682.1  has acceptance rules AlignmentScore >= -35.9226, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  35.5824
TP   100.00%, TN    95.95%, min    95.95%,   2 3D sequences,     0 alignment sequences,  766 random sequences,   31 random matches, 18 NTs, cWW-F-F-F-F-F-cWW-cWW-F-cWW-F
Sensitivity 100.00%, Specificity  95.95%, Minimum  95.95% using method 6
Number of false positives with core edit > 0 is 31
1 * Deficit + 3 * Core Edit <= 19.6598
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_89787.1'
                     Signature: {'cWW-F-cWW-F-F-F-F-F-F-F-cWW-cWW'}
                         NumNT: 16
                  NumBasepairs: 4
                    Structured: 1
                     NumStacks: 7
                        NumBPh: 3
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 68
                      OwnScore: -11.8358
                   OwnSequence: {'CAGCGAUAG*CG*CUGUC*GG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 17
            MeanSequenceLength: 17
               DeficitEditData: [1354×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 1354 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  22.2426 because the cutoff seemed overly generous
Group  59, J4_89787.1  has acceptance rules AlignmentScore >= -31.8358, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  32.4798
TP   100.00%, TN    98.01%, min    98.01%,   1 3D sequences,     0 alignment sequences, 1354 random sequences,   27 random matches, 16 NTs, cWW-F-cWW-F-F-F-F-F-F-F-cWW-cWW
Sensitivity 100.00%, Specificity  98.01%, Minimum  98.01% using method 8
Number of false positives with core edit > 0 is 27
1 * Deficit + 3 * Core Edit <= 20.6440
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_91813.1'
                     Signature: {'cWW-cWW-F-tSH-cWW-F-F-F-cWW-F'}
                         NumNT: 15
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 12
                        NumBPh: 1
                         NumBR: 2
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 46
                      OwnScore: -10.4452
                   OwnSequence: {'AUG*UU*GGGAG*CGAAGU'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 15
            MeanSequenceLength: 15
               DeficitEditData: [1671×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 1671 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  21.8868 because the cutoff seemed overly generous
Group  60, J4_91813.1  has acceptance rules AlignmentScore >= -30.4452, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  30.6168
TP   100.00%, TN    98.03%, min    98.03%,   1 3D sequences,     0 alignment sequences, 1671 random sequences,   33 random matches, 15 NTs, cWW-cWW-F-tSH-cWW-F-F-F-cWW-F
Sensitivity 100.00%, Specificity  98.03%, Minimum  98.03% using method 8
Number of false positives with core edit > 0 is 33
1 * Deficit + 3 * Core Edit <= 20.1717
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_91882.1'
                     Signature: {'cWW-F-F-F-cWW-F-cWW-cWW'}
                         NumNT: 12
                  NumBasepairs: 5
                    Structured: 1
                     NumStacks: 8
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 46
                      OwnScore: [-13.4659 -14.8904]
                   OwnSequence: {'GUGG*CGU*AAGGUUG*UC'  'GUAG*CAG*CCUUACG*CC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [15 15]
            MeanSequenceLength: 15
               DeficitEditData: [8186×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 8186 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  61, J4_91882.1  has acceptance rules AlignmentScore >= -33.4659, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  32.8190
TP   100.00%, TN    96.01%, min    96.01%,   2 3D sequences,     0 alignment sequences, 8186 random sequences,  327 random matches, 12 NTs, cWW-F-F-F-cWW-F-cWW-cWW
Sensitivity 100.00%, Specificity  96.01%, Minimum  96.01% using method 6
Number of false positives with core edit > 0 is 327
1 * Deficit + 3 * Core Edit <= 19.3531
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_94519.1'
                     Signature: {'cWW-F-F-F-F-F-cWW-F-F-F-F-cWW-cWW'}
                         NumNT: 15
                  NumBasepairs: 7
                    Structured: 1
                     NumStacks: 14
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 2
                      Truncate: [3×1 double]
                      NumFixed: 52
                      OwnScore: [-14.6104 -12.8037]
                   OwnSequence: {'AUAG*CAGG*CCGUGUCC*GU'  'AUAG*CAGC*GAAGGUCG*UU'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: [17 17]
            MeanSequenceLength: 17
               DeficitEditData: [923×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

2 sequences from 3D structures
Using 923 random sequences, 0 from an alignment, and 2 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  20.8726 because the cutoff seemed overly generous
Group  62, J4_94519.1  has acceptance rules AlignmentScore >= -32.8037, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  32.8037
TP   100.00%, TN    97.07%, min    97.07%,   2 3D sequences,     0 alignment sequences,  923 random sequences,   27 random matches, 15 NTs, cWW-F-F-F-F-F-cWW-F-F-F-F-cWW-cWW
Sensitivity 100.00%, Specificity  97.07%, Minimum  97.07% using method 8
Number of false positives with core edit > 0 is 27
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1
Motif index 2


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_97835.1'
                     Signature: {'cWW-F-F-F-cWW-cWW-cHS-F-cWW-cWW'}
                         NumNT: 15
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 9
                        NumBPh: 0
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 58
                      OwnScore: -13.5543
                   OwnSequence: {'UAUAG*CGC*GAGGUCA*UUA'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 17
            MeanSequenceLength: 17
               DeficitEditData: [2021×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 2021 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Decreased cutoff from  20.9063 because the cutoff seemed overly generous
Group  63, J4_97835.1  has acceptance rules AlignmentScore >= -33.5543, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  33.5543
TP   100.00%, TN    97.38%, min    97.38%,   1 3D sequences,     0 alignment sequences, 2021 random sequences,   53 random matches, 15 NTs, cWW-F-F-F-cWW-cWW-cHS-F-cWW-cWW
Sensitivity 100.00%, Specificity  97.38%, Minimum  97.38% using method 8
Number of false positives with core edit > 0 is 53
1 * Deficit + 3 * Core Edit <= 20.0000
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_98739.1'
                     Signature: {'cWW-F-F-F-F-cWW-F-F-F-F-F-F-F-F-cWW-cWW-F-F-F'}
                         NumNT: 23
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 15
                        NumBPh: 2
                         NumBR: 2
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 98
                      OwnScore: -13.8676
                   OwnSequence: {'CGAG*CGGAG*CGAGU*GGCGGCAUUAG'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 24
            MeanSequenceLength: 24
               DeficitEditData: [0×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 0 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
No random sequence matches, so essentially no model-specific cutoff imposed
Decreased cutoff to  25.0000 so that it is possible to reject matches
Group  64, J4_98739.1  has acceptance rules AlignmentScore >= -33.8676, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  38.8676
TP   100.00%, TN      NaN%, min   100.00%,   1 3D sequences,     0 alignment sequences,    0 random sequences,    0 random matches, 23 NTs, cWW-F-F-F-F-cWW-F-F-F-F-F-F-F-F-cWW-cWW-F-F-F
Sensitivity 100.00%, Specificity    NaN%, Minimum 100.00% using method 12
Number of false positives with core edit > 0 is 0
1 * Deficit + 3 * Core Edit <= 25.0000
Motif index 1


ans = 

  <a href="matlab:helpPopup struct" style="font-weight:bold">struct</a> with fields:

                       MotifID: 'J4_99897.1'
                     Signature: {'cWW-F-cWW-cWW-cWW-cWW-F-cWW'}
                         NumNT: 14
                  NumBasepairs: 6
                    Structured: 1
                     NumStacks: 9
                        NumBPh: 2
                         NumBR: 0
                  NumInstances: 1
                      Truncate: [3×1 double]
                      NumFixed: 48
                      OwnScore: -8.5479
                   OwnSequence: {'GUAG*CGC*GUAG*CGC'}
                  DeficitCoeff: 1
                 CoreEditCoeff: 3
               SequenceLengths: 13
            MeanSequenceLength: 13
               DeficitEditData: [6630×2 double]
              RandomQuantile80: []
              RandomQuantile96: []
              RandomQuantile98: []
                  CutoffMethod: []
              TruePositiveRate: []
              TrueNegativeRate: []
           NumberOf3DSequences: []
    NumberOfAlignmentSequences: []
       NumberOfRandomSequences: []
        NumberOfFalsePositives: []
                 DeficitCutoff: []
                CoreEditCutoff: []
             DeficitEditCutoff: []
                      MinScore: []
                      MaxScore: []
               ScoreEditCutoff: []

1 sequences from 3D structures
Using 6630 random sequences, 0 from an alignment, and 1 from 3D structures
Trying a definition of DefaultMixedScoreCutoff for J4
Group  65, J4_99897.1  has acceptance rules AlignmentScore >= -28.5479, CoreEdit <= 5, and   3.0000 * CoreEdit -   1.0000 * AlignmentScore <=  27.2247
TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 6630 random sequences,  265 random matches, 14 NTs, cWW-F-cWW-cWW-cWW-cWW-F-cWW
Sensitivity 100.00%, Specificity  96.00%, Minimum  96.00% using method 6
Number of false positives with core edit > 0 is 265
1 * Deficit + 3 * Core Edit <= 18.6768
Motif index 1

  2 (  3.08%) models got the default cutoff from model size
  0 (  0.00%) models had their cutoff set by maximizing TP+TN
  0 (  0.00%) models got the default cutoff plus 2
  0 (  0.00%) models with cutoffs from TP+TN had the cutoff tightened to reduce false positives
  0 (  0.00%) models with default plus 2 had the cutoff tightened to reduce false positives
 30 ( 46.15%) models had cutoff set from random sequences only
  0 (  0.00%) random cutoff models had their cutoff made more generous
 24 ( 36.92%) random cutoff models had their cutoff made more restrictive
  0 (  0.00%) models had no random sequences and so no model-specific cutoff imposed
  0 (  0.00%) models had the cutoff set from alignment sequences only
  4 (  6.15%) models got the minimum cutoff
65 groups, total in this table is 65
Group   1, J4_01665.1  has acceptance rules -11.3190 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-11.3190 - AlignmentScore) +   3.0000 * CoreEdit <=  20.1985, method  8,TP   100.00%, TN    97.95%, min    97.95%,   1 3D sequences,     0 alignment sequences,   341 random sequences,    7 random matches, 18 NTs, cWW-tWH-F-tWH-cWW-tSS-F-tHW-tSS-cWW-cWW
Group   2, J4_04237.1  has acceptance rules -21.1059 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-21.1059 - AlignmentScore) +   3.0000 * CoreEdit <=  25.0000, method 12,TP   100.00%, TN      NaN%, min   100.00%,   1 3D sequences,     0 alignment sequences,     0 random sequences,    0 random matches, 29 NTs, cWW-F-F-F-cWH-F-F-F-F-cWW-F-F-F-F-cWW-F-F-F-F-F-F-F-F-F-F
Group   3, J4_04930.2  has acceptance rules  -7.5389 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -7.5389 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    97.93%, min    97.93%,   6 3D sequences,     0 alignment sequences,  2081 random sequences,   43 random matches, 15 NTs, cWW-F-F-tWW-cWW-cWW-cHW-cWW-F
Group   4, J4_07491.1  has acceptance rules  -5.8605 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -5.8605 - AlignmentScore) +   3.0000 * CoreEdit <=  16.6531, method  6,TP   100.00%, TN    96.00%, min    96.00%,   9 3D sequences,     0 alignment sequences,  7497 random sequences,  300 random matches, 13 NTs, cWW-F-F-tWS-F-F-cWW-cWW-cWW
Group   5, J4_10313.2  has acceptance rules  -8.2049 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.2049 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0052, method  8,TP   100.00%, TN    98.00%, min    98.00%,   5 3D sequences,     0 alignment sequences,  2245 random sequences,   45 random matches, 16 NTs, cWW-cWW-tHW-F-F-F-F-F-F-cWW-cWW
Group   6, J4_10408.3  has acceptance rules -14.5459 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-14.5459 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    96.39%, min    96.39%,   2 3D sequences,     0 alignment sequences,   527 random sequences,   19 random matches, 15 NTs, cWW-F-F-F-F-F-cWW-cWW-cHS-F-F-F-cWW-F
Group   7, J4_10571.1  has acceptance rules  -9.1255 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -9.1255 - AlignmentScore) +   3.0000 * CoreEdit <=  18.9600, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 18476 random sequences,  739 random matches, 12 NTs, cWW-F-F-F-cWW-F-F-cWW-F
Group   8, J4_11418.1  has acceptance rules  -9.9234 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -9.9234 - AlignmentScore) +   3.0000 * CoreEdit <=  21.6176, method  8,TP   100.00%, TN    97.84%, min    97.84%,   1 3D sequences,     0 alignment sequences,   231 random sequences,    5 random matches, 19 NTs, cWW-F-F-tSH-cHH-F-F-tHS-cWW-cWW-F-F-cWW
Group   9, J4_12209.1  has acceptance rules -14.3146 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-14.3146 - AlignmentScore) +   3.0000 * CoreEdit <=  25.0000, method 12,TP   100.00%, TN      NaN%, min   100.00%,   1 3D sequences,     0 alignment sequences,     0 random sequences,    0 random matches, 27 NTs, cWW-F-F-F-cWW-tWH-F-cWW-F-F-F-tWS-tWH-F-F-F-F-F-cSH-cWW-F
Group  10, J4_16596.1  has acceptance rules -13.0343 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-13.0343 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    97.63%, min    97.63%,   3 3D sequences,     0 alignment sequences,  1392 random sequences,   33 random matches, 17 NTs, cWW-F-F-F-cWW-F-cWW-F-cWW-cWW-F-F
Group  11, J4_19572.1  has acceptance rules -15.7420 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-15.7420 - AlignmentScore) +   3.0000 * CoreEdit <=  25.0000, method 12,TP   100.00%, TN      NaN%, min   100.00%,   1 3D sequences,     0 alignment sequences,     0 random sequences,    0 random matches, 31 NTs, cWW-F-cSW-F-F-tWH-cWW-F-cHW-F-cWW-F-tWS-F-cWW-F-F-F-cSH-tWH-cWW-F-F-F
Group  12, J4_22413.2  has acceptance rules -10.7533 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-10.7533 - AlignmentScore) +   3.0000 * CoreEdit <=  19.0295, method  6,TP   100.00%, TN    96.00%, min    96.00%,   3 3D sequences,     0 alignment sequences, 12353 random sequences,  494 random matches, 15 NTs, cWW-F-cWW-F-cWW-cHW-F-F-F-cWW-F
Group  13, J4_24220.1  has acceptance rules  -9.9590 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -9.9590 - AlignmentScore) +   3.0000 * CoreEdit <=  18.7666, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences,  6693 random sequences,  268 random matches, 15 NTs, cWW-F-F-tWS-F-F-cWW-tHS-cWW-cWW
Group  14, J4_26776.1  has acceptance rules -10.5062 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-10.5062 - AlignmentScore) +   3.0000 * CoreEdit <=  18.4070, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences,  8425 random sequences,  337 random matches, 14 NTs, cWW-tSH-F-cWW-cWW-F-tHS-cWW
Group  15, J4_26796.1  has acceptance rules -11.8726 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-11.8726 - AlignmentScore) +   3.0000 * CoreEdit <=  20.4850, method  8,TP   100.00%, TN    97.98%, min    97.98%,   1 3D sequences,     0 alignment sequences,   346 random sequences,    7 random matches, 18 NTs, cWW-cSH-cWW-F-F-F-tHW-F-cWW-F-F-F-cWW
Group  16, J4_28426.1  has acceptance rules  -9.9665 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -9.9665 - AlignmentScore) +   3.0000 * CoreEdit <=  18.6854, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences,  9666 random sequences,  387 random matches, 14 NTs, cWW-F-cWW-F-F-F-F-F-cWW-cWW
Group  17, J4_28473.1  has acceptance rules  -8.8578 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.8578 - AlignmentScore) +   3.0000 * CoreEdit <=  17.0814, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 18206 random sequences,  728 random matches, 13 NTs, cWW-F-F-F-cWW-cWW-F-cWW-F
Group  18, J4_34476.1  has acceptance rules -13.1340 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-13.1340 - AlignmentScore) +   3.0000 * CoreEdit <=  24.3067, method  8,TP   100.00%, TN    98.63%, min    98.63%,   2 3D sequences,     0 alignment sequences,    73 random sequences,    1 random matches, 21 NTs, cWW-F-F-F-F-tWS-tHS-F-cWW-cWW-F-F-tHS-cWW
Group  19, J4_35578.2  has acceptance rules  -8.2564 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.2564 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    96.56%, min    96.56%,   3 3D sequences,     0 alignment sequences,  2793 random sequences,   96 random matches, 15 NTs, cWW-F-cWW-F-F-F-tHW-F-cWW-cWW
Group  20, J4_36296.1  has acceptance rules -12.1942 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-12.1942 - AlignmentScore) +   3.0000 * CoreEdit <=  18.0360, method  6,TP   100.00%, TN    96.00%, min    96.00%,   5 3D sequences,     0 alignment sequences, 19772 random sequences,  791 random matches, 12 NTs, cWW-F-F-F-cWW-cWW-F-cWW
Group  21, J4_36540.1  has acceptance rules -10.1653 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-10.1653 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    96.05%, min    96.05%,   2 3D sequences,     0 alignment sequences,  9736 random sequences,  385 random matches, 14 NTs, cWW-cWW-F-F-F-cWW-F-cWW-F-F
Group  22, J4_36568.1  has acceptance rules -10.0468 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-10.0468 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    96.01%, min    96.01%,   2 3D sequences,     0 alignment sequences,   726 random sequences,   29 random matches, 17 NTs, cWW-tSS-cWW-cWW-cWW-tWH-tWH-F-cWW-F
Group  23, J4_40439.2  has acceptance rules  -8.8493 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.8493 - AlignmentScore) +   3.0000 * CoreEdit <=  15.9984, method  6,TP   100.00%, TN    96.00%, min    96.00%,   3 3D sequences,     0 alignment sequences,  6629 random sequences,  265 random matches, 15 NTs, cWW-F-cWW-F-F-F-F-F-cWW-F-cWW
Group  24, J4_43687.1  has acceptance rules  -8.5986 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.5986 - AlignmentScore) +   3.0000 * CoreEdit <=   9.5000, method 11,TP   100.00%, TN    91.96%, min    91.96%,   2 3D sequences,     0 alignment sequences, 17703 random sequences, 1424 random matches, 10 NTs, cWW-cWW-cWW-cWW-cWW
Group  25, J4_44058.1  has acceptance rules -13.0406 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-13.0406 - AlignmentScore) +   3.0000 * CoreEdit <=  19.7237, method  6,TP   100.00%, TN    95.98%, min    95.98%,   1 3D sequences,     0 alignment sequences,  1889 random sequences,   76 random matches, 16 NTs, cWW-cWW-F-cWW-F-cWW-cWW-F-cWW-F
Group  26, J4_45582.1  has acceptance rules  -7.8706 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -7.8706 - AlignmentScore) +   3.0000 * CoreEdit <=  10.4930, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 16950 random sequences,  678 random matches, 11 NTs, cWW-F-cWW-cWW-cWW-cWW
Group  27, J4_45801.2  has acceptance rules -11.2831 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-11.2831 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    97.31%, min    97.31%,   6 3D sequences,     0 alignment sequences,   335 random sequences,    9 random matches, 19 NTs, cWW-cWW-cSS-F-tHH-cWW-cSH-tWH-F-tHS-F-cWW
Group  28, J4_46448.1  has acceptance rules  -6.8542 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -6.8542 - AlignmentScore) +   3.0000 * CoreEdit <=  11.5800, method  6,TP   100.00%, TN    95.99%, min    95.99%,   1 3D sequences,     0 alignment sequences,  8658 random sequences,  347 random matches, 11 NTs, cWW-cWS-tSH-cWW-cWW-cWW
Group  29, J4_47478.1  has acceptance rules  -8.2881 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.2881 - AlignmentScore) +   3.0000 * CoreEdit <=   9.9468, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 20825 random sequences,  834 random matches, 11 NTs, cWW-F-cWW-cWS-cHW-cWW-cWW
Group  30, J4_48692.1  has acceptance rules  -7.4400 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -7.4400 - AlignmentScore) +   3.0000 * CoreEdit <=  16.9233, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 12142 random sequences,  486 random matches, 12 NTs, cWW-tHW-F-F-cWW-cWW-cWW
Group  31, J4_48907.1  has acceptance rules  -5.9967 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -5.9967 - AlignmentScore) +   3.0000 * CoreEdit <=   9.5000, method 11,TP   100.00%, TN    82.49%, min    82.49%,   2 3D sequences,     0 alignment sequences,  7636 random sequences, 1337 random matches,  8 NTs, cWW-cWW-cWW-cWW
Group  32, J4_51403.1  has acceptance rules -11.6907 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-11.6907 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    97.30%, min    97.30%,   1 3D sequences,     0 alignment sequences,  1037 random sequences,   28 random matches, 18 NTs, cWW-cHH-tSH-F-cWW-F-cWW-cSS-cWW-F-cWW
Group  33, J4_54165.1  has acceptance rules -11.5425 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-11.5425 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    97.33%, min    97.33%,   1 3D sequences,     0 alignment sequences,  1646 random sequences,   44 random matches, 17 NTs, cWW-F-F-F-cWW-cWW-cWW-cWW-cWW-F-F
Group  34, J4_57327.1  has acceptance rules -14.9668 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-14.9668 - AlignmentScore) +   3.0000 * CoreEdit <=  25.0000, method  1,TP   100.00%, TN   100.00%, min   100.00%,   1 3D sequences,     0 alignment sequences,     2 random sequences,    0 random matches, 18 NTs, cWW-F-F-F-F-F-F-F-F-cWW-F-cWW-F-F-F
Group  35, J4_57344.1  has acceptance rules  -6.5534 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -6.5534 - AlignmentScore) +   3.0000 * CoreEdit <=  12.6670, method  6,TP   100.00%, TN    95.96%, min    95.96%,   1 3D sequences,     0 alignment sequences, 11456 random sequences,  463 random matches, 11 NTs, cWW-F-cWW-F-cWW-cSH-cWW
Group  36, J4_59634.1  has acceptance rules -13.0345 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-13.0345 - AlignmentScore) +   3.0000 * CoreEdit <=  22.2853, method  8,TP   100.00%, TN    97.89%, min    97.89%,   1 3D sequences,     0 alignment sequences,   284 random sequences,    6 random matches, 15 NTs, cWW-F-F-F-cHS-F-F-F-F-F-F-F-F
Group  37, J4_59845.1  has acceptance rules  -9.5307 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -9.5307 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    97.70%, min    97.70%,   2 3D sequences,     0 alignment sequences,  1564 random sequences,   36 random matches, 16 NTs, cWW-tSW-F-cWW-F-F-cWW-F-F-cWW-F-F
Group  38, J4_60168.1  has acceptance rules -14.2763 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-14.2763 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    96.72%, min    96.72%,   2 3D sequences,     0 alignment sequences,   396 random sequences,   13 random matches, 20 NTs, cWW-F-F-F-F-F-cWW-F-F-F-cWW-F-tSS-F-cWW
Group  39, J4_61477.2  has acceptance rules -11.0851 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-11.0851 - AlignmentScore) +   3.0000 * CoreEdit <=  20.7571, method  8,TP   100.00%, TN    98.11%, min    98.11%,   4 3D sequences,     0 alignment sequences,   159 random sequences,    3 random matches, 19 NTs, cWW-tSW-F-tHS-tHS-F-cWW-cWW-F-tHS-cWW
Group  40, J4_61885.2  has acceptance rules -11.4143 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-11.4143 - AlignmentScore) +   3.0000 * CoreEdit <=  25.0000, method  1,TP   100.00%, TN   100.00%, min   100.00%,   4 3D sequences,     0 alignment sequences,     6 random sequences,    0 random matches, 22 NTs, cWW-F-cWW-cWW-F-F-F-tHW-F-F-F-F-F-cWW-F-F-F
Group  41, J4_63076.1  has acceptance rules  -6.2152 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -6.2152 - AlignmentScore) +   3.0000 * CoreEdit <=   9.5000, method 11,TP   100.00%, TN    94.52%, min    94.52%,   2 3D sequences,     0 alignment sequences, 15195 random sequences,  832 random matches,  9 NTs, cWW-tSS-cWW-cWW-cWW
Group  42, J4_64075.1  has acceptance rules -12.1880 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-12.1880 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    98.18%, min    98.18%,   4 3D sequences,     0 alignment sequences,    55 random sequences,    1 random matches, 20 NTs, cWW-tWW-cWW-F-F-cHW-F-cWW-tSS-cSS-cSH-tWH-tHS-cWW
Group  43, J4_64571.2  has acceptance rules -10.3807 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-10.3807 - AlignmentScore) +   3.0000 * CoreEdit <=  16.4518, method  6,TP   100.00%, TN    96.00%, min    96.00%,   4 3D sequences,     0 alignment sequences, 12790 random sequences,  512 random matches, 11 NTs, cWW-F-cWW-tSS-cWW-F-cWW
Group  44, J4_65052.1  has acceptance rules  -8.4224 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.4224 - AlignmentScore) +   3.0000 * CoreEdit <=  14.0895, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 19186 random sequences,  767 random matches, 12 NTs, cWW-cWW-cWW-F-cWW-tWS-cWW
Group  45, J4_65285.1  has acceptance rules -15.8151 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-15.8151 - AlignmentScore) +   3.0000 * CoreEdit <=  17.9102, method  6,TP   100.00%, TN    95.98%, min    95.98%,   2 3D sequences,     0 alignment sequences,  1890 random sequences,   76 random matches, 13 NTs, cWW-F-F-F-F-F-cWW-cWW-F-cWW-F
Group  46, J4_69051.2  has acceptance rules  -8.3579 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.3579 - AlignmentScore) +   3.0000 * CoreEdit <=  19.7494, method  6,TP   100.00%, TN    96.97%, min    96.97%,   6 3D sequences,     0 alignment sequences,    33 random sequences,    1 random matches, 20 NTs, cWW-F-cWW-F-tHW-F-cWW-F-F-F-F-F-cWW-cWW
Group  47, J4_69073.1  has acceptance rules  -8.2881 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.2881 - AlignmentScore) +   3.0000 * CoreEdit <=   9.9468, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 20825 random sequences,  834 random matches, 11 NTs, cWW-cHS-cWW-cWS-cHW-cWW-cWW
Group  48, J4_69568.1  has acceptance rules -10.5970 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-10.5970 - AlignmentScore) +   3.0000 * CoreEdit <=  17.5447, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences,  8731 random sequences,  349 random matches, 12 NTs, cWW-F-cWW-F-cWW-F-F-cWW
Group  49, J4_70449.12 has acceptance rules  -8.3995 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.3995 - AlignmentScore) +   3.0000 * CoreEdit <=  18.3330, method  6,TP   100.00%, TN    96.00%, min    96.00%,  42 3D sequences,     0 alignment sequences,  3302 random sequences,  132 random matches, 13 NTs, cWW-F-cWW-cWW-cHS-F-cWW-cWW
Group  50, J4_70672.1  has acceptance rules -13.7023 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-13.7023 - AlignmentScore) +   3.0000 * CoreEdit <=  25.0000, method 12,TP   100.00%, TN      NaN%, min   100.00%,   2 3D sequences,     0 alignment sequences,     0 random sequences,    0 random matches, 24 NTs, cWW-tSH-F-F-F-F-F-F-cSW-F-tHS-cWW-cWW-cWW-F-cWW-F
Group  51, J4_71729.2  has acceptance rules  -8.7400 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.7400 - AlignmentScore) +   3.0000 * CoreEdit <=  18.8052, method  6,TP   100.00%, TN    96.04%, min    96.04%,   4 3D sequences,     0 alignment sequences,  1212 random sequences,   48 random matches, 17 NTs, cWW-tSH-cHH-F-F-tHS-cWW-cWW-F-F-cWW
Group  52, J4_72305.3  has acceptance rules -10.2764 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-10.2764 - AlignmentScore) +   3.0000 * CoreEdit <=  13.5937, method  6,TP   100.00%, TN    96.00%, min    96.00%,   6 3D sequences,     0 alignment sequences, 22140 random sequences,  886 random matches, 11 NTs, cWW-F-cWW-cWW-cHS-F-cWW
Group  53, J4_75852.1  has acceptance rules -10.2038 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-10.2038 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    97.18%, min    97.18%,   1 3D sequences,     0 alignment sequences,  1456 random sequences,   41 random matches, 16 NTs, cWW-tSW-cSS-cWW-F-cSH-cWW-cWW-F-F
Group  54, J4_75971.1  has acceptance rules  -6.7717 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -6.7717 - AlignmentScore) +   3.0000 * CoreEdit <=  14.6415, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences, 12657 random sequences,  506 random matches, 11 NTs, cWW-tSS-cWW-cWW-cWW-cWW
Group  55, J4_76405.1  has acceptance rules  -8.4158 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.4158 - AlignmentScore) +   3.0000 * CoreEdit <=  17.7786, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences,  9215 random sequences,  369 random matches, 13 NTs, cWW-F-F-F-cWW-F-cWW-cWW-F
Group  56, J4_77044.1  has acceptance rules  -9.7746 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -9.7746 - AlignmentScore) +   3.0000 * CoreEdit <=  18.7178, method  6,TP   100.00%, TN    96.00%, min    96.00%,   3 3D sequences,     0 alignment sequences,  8428 random sequences,  337 random matches, 15 NTs, cWW-cWW-F-cWW-tHS-cWW-F-F-cWW
Group  57, J4_78628.1  has acceptance rules  -6.8214 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -6.8214 - AlignmentScore) +   3.0000 * CoreEdit <=   9.5000, method 11,TP   100.00%, TN    87.12%, min    87.12%,   4 3D sequences,     0 alignment sequences,  9058 random sequences, 1167 random matches,  8 NTs, cWW-cWW-cWW-cWW
Group  58, J4_80682.1  has acceptance rules -15.9226 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-15.9226 - AlignmentScore) +   3.0000 * CoreEdit <=  19.6598, method  6,TP   100.00%, TN    95.95%, min    95.95%,   2 3D sequences,     0 alignment sequences,   766 random sequences,   31 random matches, 18 NTs, cWW-F-F-F-F-F-cWW-cWW-F-cWW-F
Group  59, J4_89787.1  has acceptance rules -11.8358 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-11.8358 - AlignmentScore) +   3.0000 * CoreEdit <=  20.6440, method  8,TP   100.00%, TN    98.01%, min    98.01%,   1 3D sequences,     0 alignment sequences,  1354 random sequences,   27 random matches, 16 NTs, cWW-F-cWW-F-F-F-F-F-F-F-cWW-cWW
Group  60, J4_91813.1  has acceptance rules -10.4452 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-10.4452 - AlignmentScore) +   3.0000 * CoreEdit <=  20.1717, method  8,TP   100.00%, TN    98.03%, min    98.03%,   1 3D sequences,     0 alignment sequences,  1671 random sequences,   33 random matches, 15 NTs, cWW-cWW-F-tSH-cWW-F-F-F-cWW-F
Group  61, J4_91882.1  has acceptance rules -13.4659 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-13.4659 - AlignmentScore) +   3.0000 * CoreEdit <=  19.3531, method  6,TP   100.00%, TN    96.01%, min    96.01%,   2 3D sequences,     0 alignment sequences,  8186 random sequences,  327 random matches, 12 NTs, cWW-F-F-F-cWW-F-cWW-cWW
Group  62, J4_94519.1  has acceptance rules -12.8037 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-12.8037 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    97.07%, min    97.07%,   2 3D sequences,     0 alignment sequences,   923 random sequences,   27 random matches, 15 NTs, cWW-F-F-F-F-F-cWW-F-F-F-F-cWW-cWW
Group  63, J4_97835.1  has acceptance rules -13.5543 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-13.5543 - AlignmentScore) +   3.0000 * CoreEdit <=  20.0000, method  8,TP   100.00%, TN    97.38%, min    97.38%,   1 3D sequences,     0 alignment sequences,  2021 random sequences,   53 random matches, 15 NTs, cWW-F-F-F-cWW-cWW-cHS-F-cWW-cWW
Group  64, J4_98739.1  has acceptance rules -13.8676 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * (-13.8676 - AlignmentScore) +   3.0000 * CoreEdit <=  25.0000, method 12,TP   100.00%, TN      NaN%, min   100.00%,   1 3D sequences,     0 alignment sequences,     0 random sequences,    0 random matches, 23 NTs, cWW-F-F-F-F-cWW-F-F-F-F-F-F-F-F-cWW-cWW-F-F-F
Group  65, J4_99897.1  has acceptance rules  -8.5479 - AlignmentScore <=  20.0000, CoreEdit <= 5, and   1.0000 * ( -8.5479 - AlignmentScore) +   3.0000 * CoreEdit <=  18.6768, method  6,TP   100.00%, TN    96.00%, min    96.00%,   1 3D sequences,     0 alignment sequences,  6630 random sequences,  265 random matches, 14 NTs, cWW-F-cWW-cWW-cWW-cWW-F-cWW
