SequenceLength# of motifsMotifs
UGUGGAAGGAGUGGCUGGGUUG222
GACCUAGAUCACCC142
CAUUGCACCUCG122
CAUUGCACUCCG123
CAAGCGGUAAG113
CAGCCUGGUAG112
CAGUCGGUAG102
CUCCUCGCUG102
ACUCUAAAU92
ACUGCAGAU92
CAGUGGUAG92
CCUUUCACG92
GCGAAAGAC92
GCUCAUAAC92
GGUAAGUUC92
GUCAUCAGC92
GUGAGAAUC92
GUGAGAGUC92
GUUCGAAUC92
AGGCAAUU82
GAUAAUGC82
GUUAAAAC82
GUUUCUAC82
CGAAUAG72
CGGCGAG72
CUGUUCG72
GAAACAC72
GGAAUAC72
GUAACGC72
GUUUAUC72
UACUAUA72
AGAAAU62
CAACCG62
CAUUCG63
CCUCGG62
CGAAAG64
CGAACG62
CGAGAG63
CGCAAG62
CGCGUG65
CGGAAG62
CGUAAG62
CGUAGG62
CGUGAG63
CUGUUG62
CUUCGG63
GGAAAC67
GGCGAC63
GGGAAC62
GUGUCC62
GUUCGC62
UGAAAA63
UGUAAG62
CGAAG52
CUCUG52
CUUCG52
CUUUG52
GGUAC52
GUCUC53
CUUG42

Copyright 2024 BGSU RNA group. Page generated in 0.0185 s