A PHP Error was encountered

Severity: Warning

Message: session_start(): Cannot send session cookie - headers already sent by (output started at /var/www/rna3dhub/system/core/Exceptions.php:170)

Filename: views/menu_view.php

Line Number: 3

A PHP Error was encountered

Severity: Warning

Message: session_start(): Cannot send session cache limiter - headers already sent (output started at /var/www/rna3dhub/system/core/Exceptions.php:170)

Filename: views/menu_view.php

Line Number: 3

Exact match 716; New id, no parents 14; New id, 1 parent 8; Updated, 1 parent 4;

#Equivalence classRepresentativeResolutionNtsClass members
1NR_all_28742.1
Exact match
3IZF|A (3IZF)
  • 25S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
3396(1) 3IZF|A
2NR_all_91486.1
Exact match
3O58|1 (3O58)
  • 25S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 1
3396(2) 3O58|1, 3O5H|1
3NR_all_74702.1
Exact match
3JYX|5 (3JYX)
  • 26S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): 5
3170(1) 3JYX|5
4NR_all_17462.1
Exact match
1S1I|3 (1S1I)
  • 5.8S/25S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): 3
2999(1) 1S1I|3
5NR_all_00542.1
Exact match
Haloarcula marismortui
1S72|0 (1FFK)
  • 23S RRNA, 23S RIBOSOMAL RNA, 50S RIBOSOM[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 0
2.4 Å2922(67) 1FFK|0, 1FFZ|A, 1FG0|A, 1JJ2|0, 1K73|A, 1K8A|A, 1K9M|A, 1KC8|A, 1KD1|A, 1KQS|0, 1M1K|A, 1M90|A, 1N8R|A, 1NJI|A, 1Q7Y|A, 1Q81|A, 1Q82|A, 1Q86|A, 1QVF|0, 1QVG|0, 1S72|0, 1VQ4|0, 1VQ5|0, 1VQ6|0, 1VQ7|0, 1VQ8|0, 1VQ9|0, 1VQK|0, 1VQL|0, 1VQM|0, 1VQN|0, 1VQO|0, 1VQP|0, 1W2B|0, 1YHQ|0, 1YI2|0, 1YIJ|0, 1YIT|0, 1YJ9|0, 1YJN|0, 1YJW|0, 2OTJ|0, 2OTL|0, 2QA4|0, 2QEX|0, 3CC2|0, 3CC4|0, 3CC7|0, 3CCE|0, 3CCJ|0, 3CCL|0, 3CCM|0, 3CCQ|0, 3CCR|0, 3CCS|0, 3CCU|0, 3CCV|0, 3CD6|0, 3CMA|0, 3CME|0, 3CPW|0, 3CXC|0, 3G4S|0, 3G6E|0, 3G71|0, 3I55|0, 3I56|0
6NR_all_01824.1
Exact match
Escherichia coli
1C2W|B (1C2W)
  • 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): B
7.5 Å2904(1) 1C2W|B
7NR_all_15566.2
Exact match
2QBG|B (1VS6)
  • 23S RIBOSOMAL RNA, 23S rRNA, 50S ribosom[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2904(51) 1VS6|B, 1VS8|B, 1VT2|A, 2AW4|B, 2AWB|B, 2GYA|0, 2GYC|0, 2I2T|B, 2I2V|B, 2J28|B, 2QAM|B, 2QAO|B, 2QBA|B, 2QBC|B, 2QBE|B, 2QBG|B, 2QBI|B, 2QBK|B, 2QOV|B, 2QOX|B, 2QOZ|B, 2QP1|B, 2VHM|B, 2VHN|B, 2WWQ|B, 2Z4L|B, 2Z4N|B, 3BBX|B, 3DF2|B, 3DF4|B, 3E1B|B, 3E1D|B, 3FIK|B, 3I1N|A, 3I1P|A, 3I1R|A, 3I1T|A, 3I20|A, 3I22|A, 3IZT|B, 3IZU|B, 3KCR|8, 3OAS|A, 3OAT|A, 3OFC|A, 3OFD|A, 3OFQ|A, 3OFR|A, 3OFZ|A, 3OG0|A, 3ORB|A
8NR_all_86444.3
Exact match
3PYO|A (1VSA)
  • 23S LARGE SUBUNIT RIBOSOMAL RNA, 23S rib[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2889(71) 1VSA|w, 1VSP|w, 1YL3|A, 2B66|A, 2B9N|A, 2B9P|A, 2HGJ|A, 2HGQ|A, 2HGU|A, 2J01|A, 2J03|A, 2V47|A, 2V49|A, 2WDI|A, 2WDJ|A, 2WDL|A, 2WDN|A, 2WH2|A, 2WH4|A, 2WRJ|A, 2WRL|A, 2WRO|A, 2WRR|A, 2X9S|A, 2X9U|A, 2XG0|A, 2XG2|A, 2XQE|A, 2XTG|A, 2XUX|A, 2Y0V|A, 2Y0X|A, 2Y0Z|A, 2Y11|A, 2Y13|A, 2Y15|A, 2Y17|A, 2Y19|A, 3D5B|A, 3D5D|A, 3F1F|A, 3F1H|A, 3FIN|A, 3HUX|A, 3HUZ|A, 3I8F|A, 3I8I|A, 3I9C|A, 3I9E|A, 3KIR|A, 3KIT|A, 3KIW|A, 3KIY|A, 3KNI|A, 3KNK|A, 3KNM|A, 3KNO|A, 3MRZ|A, 3MS1|A, 3OH5|A, 3OH7|A, 3OHJ|A, 3OHK|A, 3OHZ|A, 3OI1|A, 3OI3|A, 3OI5|A, 3PYO|A, 3PYR|A, 3PYT|A, 3PYV|A
9NR_all_41181.1
Exact match
1PNU|0 (1PNU)
  • 23S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 0
2887(7) 1PNU|0, 1PNY|0, 1VOR|B, 1VOU|B, 1VOW|B, 1VOY|B, 1VP0|B
10NR_all_38396.2
Exact match
Deinococcus radiodurans
2ZJR|X (1J5A)
  • 23S RRNA, 23S ribosomal RNA, 23S RIBOSOM[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
3.5 Å2880(35) 1J5A|A, 1JZX|A, 1JZY|A, 1JZZ|A, 1K01|A, 1NJM|0, 1NJN|0, 1NJO|0, 1NJP|0, 1NKW|0, 1NWX|0, 1NWY|0, 1OND|0, 1P9X|0, 1SM1|0, 1XBP|0, 1Y69|0, 1Z58|2, 2AAR|0, 2D3O|0, 2O43|A, 2O44|A, 2O45|A, 2OGM|0, 2OGN|0, 2OGO|0, 2ZJP|X, 2ZJQ|X, 2ZJR|X, 3CF5|X, 3DLL|X, 3FWO|A, 3JQ4|A, 3PIO|X, 3PIP|X
11NR_all_74831.1
Exact match
3BBO|A (3BBO)
  • 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
2810(1) 3BBO|A
12NR_all_35497.1
Exact match
3O30|1 (3O2Z)
  • 18S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 1
1800(2) 3O2Z|1, 3O30|1
13NR_all_82112.1
Exact match
3IZE|A (3IZE)
  • 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
1800(1) 3IZE|A
14NR_all_41724.1
Exact match
3JYV|A (3JYV)
  • 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
1761(1) 3JYV|A
15NR_all_53536.1
Exact match
2XZM|A (2XZM)
  • 18S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1753(2) 2XZM|A, 2XZN|A
16NR_all_70824.2
Exact match
2AW7|A (1VS5)
  • 16S RIBOSOMAL RNA, 16S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1542(49) 1VS5|A, 1VS7|A, 2AVY|A, 2AW7|A, 2GY9|A, 2GYB|A, 2I2P|A, 2I2U|A, 2QAL|A, 2QAN|A, 2QB9|A, 2QBB|A, 2QBD|A, 2QBF|A, 2QBH|A, 2QBJ|A, 2QOU|A, 2QOW|A, 2QOY|A, 2QP0|A, 2VHO|A, 2VHP|A, 2WWL|A, 2Z4K|A, 2Z4M|A, 3DF1|A, 3DF3|A, 3E1A|1, 3E1C|1, 3FIH|A, 3I1M|A, 3I1O|A, 3I1Q|A, 3I1S|A, 3I1Z|A, 3I21|A, 3IZV|A, 3IZW|A, 3KC4|A, 3OAQ|A, 3OAR|A, 3OFA|A, 3OFB|A, 3OFO|A, 3OFP|A, 3OFX|A, 3OFY|A, 3OR9|A, 3ORA|A
17NR_all_41791.1
Exact match
1GIX|A (1GIX)
  • 30S 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1522(4) 1GIX|A, 1JGO|A, 1JGP|A, 1JGQ|A
18NR_all_42982.3
Exact match
Thermus thermophilus
1FJG|A (1FJG)
  • 16S RIBOSOMAL RNA, 16S RRNA, 18S ribosom[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å1522(115) 1FJG|A, 1FKA|A, 1HNW|A, 1HNX|A, 1HNZ|A, 1HR0|A, 1I94|A, 1I95|A, 1I96|A, 1I97|A, 1IBK|A, 1IBL|A, 1IBM|A, 1J5E|A, 1N32|A, 1N33|A, 1N34|A, 1N36|A, 1PNS|A, 1PNX|A, 1S1H|A, 1VOQ|A, 1VOS|A, 1VOV|A, 1VOX|A, 1VOZ|A, 1XMO|A, 1XMQ|A, 1XNQ|A, 1XNR|A, 1YL4|A, 2B64|A, 2B9M|A, 2B9O|A, 2E5L|A, 2F4V|A, 2HGI|A, 2HGP|A, 2HGR|A, 2HHH|A, 2J00|A, 2J02|A, 2OW8|y, 2QNH|y, 2UU9|A, 2UUA|A, 2UUB|A, 2UUC|A, 2UXB|A, 2UXC|A, 2UXD|A, 2V46|A, 2V48|A, 2VQE|A, 2VQF|A, 2WDG|A, 2WDH|A, 2WDK|A, 2WDM|A, 2WH1|A, 2WH3|A, 2WRI|A, 2WRK|A, 2WRN|A, 2WRQ|A, 2X9R|A, 2X9T|A, 2XFZ|A, 2XG1|A, 2XQD|A, 2XSY|A, 2XUY|A, 2Y0U|A, 2Y0W|A, 2Y0Y|A, 2Y10|A, 2Y12|A, 2Y14|A, 2Y16|A, 2Y18|A, 2ZM6|A, 3D5A|A, 3D5C|A, 3F1E|A, 3F1G|A, 3FIC|A, 3HUW|A, 3HUY|A, 3I8G|A, 3I8H|A, 3I9B|A, 3I9D|A, 3KIQ|a, 3KIS|a, 3KIU|a, 3KIX|a, 3KNH|A, 3KNJ|A, 3KNL|A, 3KNN|A, 3MR8|A, 3MS0|A, 3OGE|A, 3OGY|A, 3OHC|A, 3OHD|A, 3OHY|A, 3OI0|A, 3OI2|A, 3OI4|A, 3OTO|A, 3PYN|A, 3PYQ|A, 3PYS|A, 3PYU|A
19NR_all_68162.1
Exact match
3BBN|A (3BBN)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
1491(1) 3BBN|A
20NR_all_09024.1
Exact match
2A64|A (2A64)
  • ribonuclease P RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.3 Å417(1) 2A64|A
21NR_all_09073.1
Exact match
3G78|A (3EOG)
  • Group IIC intron, Group II intron
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.4 Å412(4) 3EOG|A, 3EOH|A, 3G78|A, 3IGI|A
22NR_all_30139.1
Exact match
3BWP|A (3BWP)
  • Group IIC intron
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å412(1) 3BWP|A
23NR_all_48207.1
Exact match
Bluetongue virus
1H1K|I (1H1K)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): I
10.0 Å412(1) 1H1K|I
24NR_all_43849.1
Exact match
Escherichia coli
3IZ4|A (3IZ4)
  • Modified E. coli transfer-messenger RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
13.6 Å377(1) 3IZ4|A
25NR_all_05704.1
Exact match
Thermus thermophilus
3IYR|A (3IYR)
  • tmRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
13.0 Å349(1) 3IYR|A
26NR_all_71075.1
Exact match
Thermus thermophilus
3IYQ|A (3IYQ)
  • tmRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
13.0 Å349(1) 3IYQ|A
27NR_all_54986.1
Exact match
3Q1Q|B (3Q1Q)
  • RNase P RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.8 Å347(2) 3Q1Q|B, 3Q1R|B
28NR_all_76149.1
Exact match
2A2E|A (2A2E)
  • RNA subunit of RNase P
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.9 Å338(1) 2A2E|A
29NR_all_87213.1
Exact match
Thermus thermophilus
2OM7|D (2OM7)
  • 16S ribosomal RNA (H5)
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): D
7.3 Å303(1) 2OM7|D
30NR_all_64531.1
Exact match
Haloarcula marismortui
2J37|Z (2J37)
  • RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): Z
8.7 Å280(1) 2J37|Z
31NR_all_06533.1
Exact match
3DHS|A (3DHS)
  • RNase P RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.6 Å268(1) 3DHS|A
32NR_all_94796.1
Exact match
Tetrahymena thermophila
1X8W|A (1GRZ)
  • LSU R-RNA GROUP I INTRON, Tetrahymena ri[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
5.0 Å247(2) 1GRZ|A, 1X8W|A
33NR_all_00578.1
Exact match
Staphylococcus phage Twort
1Y0Q|A (1Y0Q)
  • Group I ribozyme, RNA (238-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.6 Å229(2) 1Y0Q|A, 2RKJ|C
34NR_all_03131.1
Exact match
1U6B|B (1U6B)
  • 197-MER, Group I intron P9, Group I intr[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.1 Å197(6) 1U6B|B, 1ZZN|B, 3BO2|B, 3BO3|B, 3BO4|B, 3IIN|B
35NR_all_49538.1
Exact match
2NOQ|A (2NOQ)
  • CrPV IRES
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
7.3 Å190(1) 2NOQ|A
36NR_all_38220.1
Exact match
3DIR|A (3DIG)
  • RNA (174-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å174(12) 3DIG|X, 3DIL|A, 3DIM|A, 3DIO|X, 3DIQ|A, 3DIR|A, 3DIS|A, 3DIX|A, 3DIY|A, 3DIZ|A, 3DJ0|A, 3DJ2|A
37NR_all_51418.1
New id, no parents
Fusobacterium nucleatum
3P49|A (3P49)
  • GLYCINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.6 Å169(1) 3P49|A
38NR_all_23832.1
Exact match
3D0U|A (3D0U)
  • Lysine Riboswitch RNA, RNA (161-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å161(2) 3D0U|A, 3D0X|A
39NR_all_81135.1
Exact match
1U9S|A (1U9S)
  • RIBONUCLEASE P
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å161(1) 1U9S|A
40NR_all_91098.1
Exact match
2QBZ|X (2QBZ)
  • M-Box RNA, ykoK riboswitch aptamer, M-bo[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.6 Å161(2) 2QBZ|X, 3PDR|A
41NR_all_56915.1
Exact match
synthetic construct
1GID|A (1GID)
  • P4-P6 RNA RIBOZYME DOMAIN, P4-P6 DELC209[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å158(4) 1GID|A, 1HR2|A, 1L8V|A, 2R8S|R
42NR_all_47873.1
Exact match
Bacillus subtilis
1NBS|A (1NBS)
  • RIBONUCLEASE P RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.2 Å155(1) 1NBS|A
43NR_all_68124.1
Exact match
Saccharomyces cerevisiae
3IZD|A (3IZD)
  • rRNA expansion segment ES27L in an 'out'[...]
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
8.6 Å151(1) 3IZD|A
44NR_all_41615.1
Exact match
2IL9|A (2IL9)
  • Ribosomal Binding Domain of the IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å142(1) 2IL9|A
45NR_all_21935.1
Exact match
2NZ4|P (2NZ4)
  • GlmS ribozyme, glmS glucosamine-6-phosph[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
2.5 Å141(6) 2NZ4|P, 3G8S|P, 3G8T|P, 3G96|P, 3G9C|P, 3L3C|P
46NR_all_93754.1
Exact match
3HHN|C (3HHN)
  • Class I ligase ribozyme, self-ligation p[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å137(1) 3HHN|C
47NR_all_12582.1
Exact match
Methanocaldococcus jannaschii
3NDB|M (3NDB)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): M
3.0 Å136(1) 3NDB|M
48NR_all_07735.1
Exact match
1MFQ|A (1L9A)
  • signal recognition particle RNA S domain[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å128(4) 1L9A|B, 1MFQ|A, 1RY1|A, 2GO5|A
49NR_all_42875.1
Exact match
3IVK|C (3IVK)
  • class I ligase product
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.1 Å128(1) 3IVK|C
50NR_all_73572.1
Exact match
2HO7|B (2GCS)
  • glmS ribozyme RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.1 Å125(13) 2GCS|B, 2GCV|B, 2H0S|B, 2H0W|B, 2H0X|B, 2H0Z|B, 2HO6|B, 2HO7|B, 2Z74|B, 2Z75|B, 3B4A|B, 3B4B|B, 3B4C|B
51NR_all_00120.1
Exact match
Escherichia coli
1C2X|C (1C2X)
  • 5S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): C
7.5 Å120(1) 1C2X|C
52NR_all_66389.1
Exact match
Bacillus phage phi29
1FOQ|A (1FOQ)
  • BACTERIOPHAGE PHI29 PROHEAD RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
120(1) 1FOQ|A
53NR_all_25858.1
Exact match
Escherichia coli
3IZZ|B (3IZZ)
  • Helix 69, 71, 89, 92, 95 (Large Subunit)
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): B
10.8 Å118(1) 3IZZ|B
54NR_all_15942.1
Exact match
Escherichia coli
2XKV|B (2XKV)
  • 4.5S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): B
13.5 Å114(1) 2XKV|B
55NR_all_61433.1
Exact match
3F2Q|X (3F2Q)
  • FMN riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
3.0 Å112(6) 3F2Q|X, 3F2T|X, 3F2W|X, 3F2X|X, 3F2Y|X, 3F30|X
56NR_all_41494.1
Exact match
Homo sapiens
3KTV|A (3KTV)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.8 Å108(1) 3KTV|A
57NR_all_00293.1
Exact match
Deinococcus radiodurans
2XXA|F (2XXA)
  • 4.5S RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): F
3.9 Å106(1) 2XXA|F
58NR_all_53654.1
Exact match
Turnip crinkle virus
2KRL|A (2KRL)
  • RNA (102-MER)
  • SOLUTION SCATTERING, SOLUTION NMR
  • Chain(s): ; model(s): A
102(1) 2KRL|A
59NR_all_20407.1
Exact match
1S9S|A (1S9S)
  • MLV Psi encapsidation site
  • SOLUTION NMR
  • Chain(s): ; model(s): A
101(1) 1S9S|A
60NR_all_62949.1
Exact match
1YSH|B (1YSH)
  • RNA (101-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): B
9.5 Å101(1) 1YSH|B
61NR_all_89550.1
Exact match
1U6P|B (1U6P)
  • 101-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): B
101(1) 1U6P|B
62NR_all_45604.1
Exact match
Methanocaldococcus jannaschii
1LNG|B (1LNG)
  • 7S.S SRP RNA, RNA (101-MER), 7S RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å97(3) 1LNG|B, 1Z43|A, 2V3C|M
63NR_all_48559.1
Exact match
Sulfolobus solfataricus
3KTW|C (3KTW)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.2 Å96(1) 3KTW|C
64NR_all_54685.1
Exact match
Thermus thermophilus
1SER|T (1SER)
  • TRNASER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
2.9 Å94(1) 1SER|T
65NR_all_76064.1
Exact match
2GIS|A (2GIS)
  • SAM-I riboswitch, RNA (94-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å94(9) 2GIS|A, 3GX2|A, 3GX3|A, 3GX5|A, 3GX6|A, 3GX7|A, 3IQN|A, 3IQP|A, 3IQR|A
66NR_all_44112.1
Exact match
3IWN|A (3IWN)
  • C-di-GMP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.2 Å93(1) 3IWN|A
67NR_all_05663.1
Exact match
Vibrio cholerae
3MUR|R (3IRW)
  • c-di-GMP Riboswitch, G20A mutant c-di-GM[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.7 Å92(6) 3IRW|R, 3MUM|R, 3MUR|R, 3MUT|R, 3MUV|R, 3MXH|R
68NR_all_40755.1
Exact match
Methanopyrus kandleri
3ADC|C (3ADC)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å92(1) 3ADC|C
69NR_all_78938.1
Exact match
3CUL|C (3CUL)
  • RNA (92-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å92(2) 3CUL|C, 3CUN|C
70NR_all_83537.1
Exact match
1M5O|B (1M5K)
  • RNA HAIRPIN RIBOZYME
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.4 Å92(4) 1M5K|B, 1M5O|B, 1M5P|B, 1M5V|B
71NR_all_96119.1
Exact match
Methanopyrus kandleri
3ADD|C (3ADB)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å92(2) 3ADB|C, 3ADD|C
72NR_all_99643.1
Exact match
Homo sapiens
3A3A|A (3A3A)
  • selenocysteine tRNA, tRNASec
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å90(2) 3A3A|A, 3HL2|E
73NR_all_01495.1
Exact match
Vibrio cholerae
3OWZ|A (3OWI)
  • Domain II of glycine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å88(9) 3OWI|A, 3OWW|A, 3OWZ|A, 3OX0|A, 3OXB|A, 3OXD|A, 3OXE|A, 3OXJ|A, 3OXM|A
74NR_all_56214.1
Exact match
2ZZM|B (2ZZM)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.7 Å88(1) 2ZZM|B
75NR_all_62086.1
Exact match
1WZ2|C (1WZ2)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.2 Å88(1) 1WZ2|C
76NR_all_06781.1
Exact match
2NR0|E (2NR0)
  • leucyl tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.9 Å87(1) 2NR0|E
77NR_all_44920.1
Exact match
2NQP|F (2NQP)
  • transfer RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): F
3.5 Å87(1) 2NQP|F
78NR_all_66622.1
Exact match
3K0J|E (3K0J)
  • RNA (87-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.1 Å87(1) 3K0J|E
79NR_all_96321.1
Exact match
2NRE|F (2NRE)
  • leucyl tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): F
4.0 Å87(1) 2NRE|F
80NR_all_48708.1
Exact match
Thermus thermophilus
1H3E|B (1H3E)
  • WILD-TYPE TRNATYR(GUA)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.9 Å86(1) 1H3E|B
81NR_all_12005.1
Exact match
Thermus thermophilus
486D|F (486D)
  • PENULTIMATE STEM OF 16S RRNA IN THE 70S [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): F
7.5 Å85(1) 486D|F
82NR_all_09860.1
Exact match
2HOJ|A (2HOJ)
  • thi-box riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å83(5) 2HOJ|A, 2HOK|A, 2HOL|A, 2HOM|A, 2HOO|A
83NR_all_23507.1
Exact match
2HOP|A (2HOP)
  • thi-box riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.3 Å83(1) 2HOP|A
84NR_all_83623.1
Exact match
Thermus thermophilus
2BTE|B (2BTE)
  • TRNALEU TRANSCRIPT WITH ANTICODON CAG, T[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.9 Å83(3) 2BTE|B, 2BYT|B, 2V0G|B
85NR_all_45031.1
Exact match
3AM1|B (3AM1)
  • ASL-truncated tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.4 Å81(1) 3AM1|B
86NR_all_65213.1
Exact match
2GDI|X (2GDI)
  • TPP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.1 Å80(1) 2GDI|X
87NR_all_25651.1
Exact match
2FK6|R (2FK6)
  • TRNA(THR)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å79(1) 2FK6|R
88NR_all_31075.1
Exact match
2ZUE|B (2ZUE)
  • tRNA-Arg
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.0 Å78(2) 2ZUE|B, 2ZUF|B
89NR_all_09325.1
Exact match
1J1U|B (1J1U)
  • tRNA(Tyr)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.0 Å77(1) 1J1U|B
90NR_all_14670.1
Exact match
3A2K|C (3A2K)
  • bacterial tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.7 Å77(1) 3A2K|C
91NR_all_17062.1
Exact match
Arabidopsis thaliana
3D2V|A (2CKY)
  • NUCLEIC ACID, TPP-specific riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å77(4) 2CKY|A, 3D2G|A, 3D2V|A, 3D2X|A
92NR_all_33296.1
Exact match
1J2B|C (1J2B)
  • tRNA(Val)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.3 Å77(1) 1J2B|C
93NR_all_34928.1
Exact match
3DEG|B (2FMT)
  • FORMYL-METHIONYL-TRNAFMET2, Initiator tR[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å77(4) 2FMT|C, 3CW5|A, 3CW6|A, 3DEG|B
94NR_all_77062.1
Exact match
1P5P|A (1P5O)
  • 77-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
77(2) 1P5O|A, 1P5P|A
95NR_all_86203.1
Exact match
Thermus thermophilus
1H4S|T (1H4Q)
  • TRNAPRO(CGG)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
3.0 Å77(2) 1H4Q|T, 1H4S|T
96NR_all_99224.1
Exact match
Escherichia coli
1C0A|B (1C0A)
  • ASPARTYL TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.4 Å77(1) 1C0A|B
97NR_all_16200.1
Exact match
2DER|C (2DER)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.1 Å76(3) 2DER|C, 2DET|C, 2DEU|C
98NR_all_19264.1
Exact match
Escherichia coli
2K4C|A (2K4C)
  • 76-MER
  • SOLUTION NMR, SOLUTION SCATTERING
  • Chain(s): ; model(s): A
76(1) 2K4C|A
99NR_all_30095.1
Exact match
Bos taurus
3IZY|N (3IZY)
  • tRNA-Phe
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): N
10.8 Å76(1) 3IZY|N
100NR_all_32839.1
Exact match
Escherichia coli
3FOZ|C (2ZM5)
  • tRNA(Phe)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å76(3) 2ZM5|C, 2ZXU|C, 3FOZ|C
101NR_all_37816.1
Exact match
Thermus thermophilus
3BBV|z (3BBV)
  • tRNA(Phe)
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): z
10.0 Å76(1) 3BBV|z
102NR_all_40963.1
Exact match
Saccharomyces cerevisiae
1FCW|A (1EHZ)
  • TRANSFER RNA (PHE), PHENYLALANINE TRANSF[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å76(14) 1EHZ|A, 1EVV|A, 1FCW|A, 1MJ1|C, 1ML5|a, 1OB2|B, 1OB5|B, 1SZ1|E, 1TN2|A, 1TRA|A, 1TTT|D, 4TNA|A, 4TRA|A, 6TNA|A
103NR_all_50147.1
Exact match
3L0U|A (3L0U)
  • Unmodified tRNAPhe
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å76(1) 3L0U|A
104NR_all_69026.1
Exact match
2DLC|Y (2DLC)
  • T-RNA (76-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Y
2.4 Å76(1) 2DLC|Y
105NR_all_82081.1
Exact match
Bos taurus
1FIR|A (1FIR)
  • HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA([...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.3 Å76(1) 1FIR|A
106NR_all_88312.1
Exact match
1F7V|B (1F7U)
  • TRNA(ARG)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.2 Å76(2) 1F7U|B, 1F7V|B
107NR_all_92158.1
Exact match
Thermus thermophilus
3KFU|K (3KFU)
  • tRNA-Asn
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): K
3.0 Å76(1) 3KFU|K
108NR_all_94602.1
Exact match
Saccharomyces cerevisiae
1I9V|A (1I9V)
  • PHENYLALANINE TRANSFER RNA, P/I-site tRN[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å76(3) 1I9V|A, 1ZO1|F, 1ZO3|A
109NR_all_94693.1
Exact match
Thermus thermophilus
1EIY|C (1EIY)
  • TRNA(PHE), TRNAPHE
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.3 Å76(2) 1EIY|C, 2IY5|T
110NR_all_97371.1
Exact match
Escherichia coli
1QF6|B (1QF6)
  • THREONINE TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.9 Å76(1) 1QF6|B
111NR_all_08014.1
Exact match
2CT8|C (2CSX)
  • RNA (75-MER), RNA (74-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.7 Å75(2) 2CSX|C, 2CT8|C
112NR_all_10650.1
Exact match
1QU2|T (1FFY)
  • ISOLEUCYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
2.2 Å75(3) 1FFY|T, 1QU2|T, 1QU3|T
113NR_all_16381.1
Exact match
2CV1|C (1G59)
  • TRNA(GLU), tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å75(7) 1G59|B, 1N77|C, 1N78|C, 2CV0|C, 2CV1|C, 2CV2|C, 2DXI|C
114NR_all_17454.1
Exact match
2AZX|C (2AZX)
  • 72-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å75(1) 2AZX|C
115NR_all_49960.1
Exact match
Saccharomyces cerevisiae
2TRA|A (2TRA)
  • TRNAASP
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å75(2) 2TRA|A, 3TRA|A
116NR_all_53610.1
Exact match
2ZZN|C (2ZZN)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å75(1) 2ZZN|C
117NR_all_56698.1
Exact match
2DR8|B (1VFG)
  • RNA (75-MER), tRNA (32-MER), tRNA (33-ME[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å75(19) 1VFG|C, 2DR5|B, 2DR7|B, 2DR8|B, 2DR9|B, 2DRA|B, 2DRB|B, 2DVI|B, 2ZH1|B, 2ZH2|B, 2ZH3|B, 2ZH4|B, 2ZH5|B, 2ZH6|B, 2ZH7|B, 2ZH8|B, 2ZH9|B, 2ZHA|B, 2ZHB|B
118NR_all_64724.1
Exact match
Saccharomyces cerevisiae
1YFG|A (1YFG)
  • YEAST INITIATOR TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å75(1) 1YFG|A
119NR_all_66248.1
Exact match
1GAX|C (1GAX)
  • TRNA(VAL), tRNA (Val)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å75(2) 1GAX|C, 1IVS|C
120NR_all_67648.1
Exact match
1IL2|C (1ASY)
  • T-RNA (75-MER), ASPARTYL TRANSFER RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å75(3) 1ASY|R, 1ASZ|R, 1IL2|C
121NR_all_72899.1
Exact match
2IHX|B (2IHX)
  • uPsi RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
75(1) 2IHX|B
122NR_all_17635.1
Exact match
Escherichia coli
1U0B|A (1U0B)
  • Cysteinyl-tRNA synthetase
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å74(1) 1U0B|A
123NR_all_25646.1
Exact match
Escherichia coli
1B23|R (1B23)
  • CYSTEINYL TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.6 Å74(1) 1B23|R
124NR_all_34181.1
Exact match
Escherichia coli
3MOJ|A (3MOJ)
  • RNA (69-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å74(1) 3MOJ|A
125NR_all_82213.1
Exact match
3AL0|E (3AKZ)
  • tRNAGln
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å74(2) 3AKZ|E, 3AL0|E
126NR_all_82370.1
Exact match
2D6F|E (2D6F)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.2 Å74(1) 2D6F|E
127NR_all_54214.1
Exact match
Escherichia coli
1EFW|C (1EFW)
  • ASPARTYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å73(1) 1EFW|C
128NR_all_00873.1
Exact match
2ZNI|C (2ZNI)
  • bacterial tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.1 Å72(1) 2ZNI|C
129NR_all_64624.1
Exact match
1O0C|B (1EUQ)
  • GLUTAMINYL TRNA, GLUTAMINE TRNA APTAMER,[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.1 Å72(14) 1EUQ|B, 1EUY|B, 1EXD|B, 1GTR|B, 1GTS|B, 1O0B|B, 1O0C|B, 1QRS|B, 1QRT|B, 1QRU|B, 1QTQ|B, 1ZJW|B, 2RD2|B, 2RE8|B
130NR_all_75503.1
Exact match
Hepatitis delta virus
1VBY|B (1DRZ)
  • RNA (HEPATITIS DELTA VIRUS GENOMIC RIBOZ[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å72(12) 1DRZ|B, 1SJ3|R, 1SJ4|R, 1SJF|B, 1VBX|B, 1VBY|B, 1VBZ|B, 1VC0|B, 1VC5|B, 1VC6|B, 2OIH|B, 2OJ3|B
131NR_all_86158.1
Exact match
Bos taurus
2AKE|B (2AKE)
  • transfer RNA-Trp
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.1 Å72(2) 2AKE|B, 2DR2|B
132NR_all_26106.1
Exact match
2DU3|D (2DU3)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.6 Å71(4) 2DU3|D, 2DU4|C, 2DU5|D, 2DU6|D
133NR_all_32809.1
Exact match
2OIU|P (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
2.6 Å71(1) 2OIU|P
134NR_all_68911.1
Exact match
Rattus norvegicus
2L3J|B (2L3J)
  • RNA (71-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): B
71(1) 2L3J|B
135NR_all_68988.1
Exact match
Bacillus subtilis
3LA5|A (3LA5)
  • Adenosine RIboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.7 Å71(1) 3LA5|A
136NR_all_74104.1
Exact match
3HAY|E (3HAY)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
5.0 Å71(1) 3HAY|E
137NR_all_93274.1
Exact match
Vibrio vulnificus
1Y26|X (1Y26)
  • Vibrio vulnificus A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.1 Å71(1) 1Y26|X
138NR_all_16022.1
Exact match
Bacillus subtilis
3IVN|A (3IVN)
  • A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å70(1) 3IVN|A
139NR_all_46985.1
Exact match
1KXK|A (1KXK)
  • ai5g group II Self-splicing intron
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å70(1) 1KXK|A
140NR_all_69983.1
Exact match
3EPH|E (3EPH)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.0 Å69(4) 3EPH|E, 3EPJ|E, 3EPK|E, 3EPL|E
141NR_all_95949.1
Exact match
2QUS|A (2QUS)
  • Hammerhead ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.4 Å69(1) 2QUS|A
142NR_all_06442.1
Exact match
1P6V|B (1P6V)
  • 45-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.2 Å68(1) 1P6V|B
143NR_all_10641.2
Updated, 1 parent
Bacillus subtilis
3FO4|A (1Y27)
  • Bacillus subtilis xpt, 65-MER, Guanine r[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.4 Å68(18) 1Y27|X, 2B57|A, 2EES|A, 2EET|A, 2EEU|A, 2EEV|A, 2EEW|A, 2G9C|A, 2XNZ|A, 3DS7|A, 3FO4|A, 3FO6|A, 3G4M|A, 3GAO|A, 3GER|A, 3GES|A, 3GOG|A, 3GOT|A
144NR_all_53266.1
Exact match
3ICQ|D (3ICQ)
  • RNA (62-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.2 Å67(1) 3ICQ|D
145NR_all_10870.1
Exact match
Murine leukemia virus
2L1F|B (2L1F)
  • RNA (66-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): B
66(1) 2L1F|B
146NR_all_09711.1
Exact match
2HVY|E (2HVY)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.3 Å65(1) 2HVY|E
147NR_all_51765.1
Exact match
3EGZ|B (3EGZ)
  • Tetracycline aptamer and artificial ribo[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.2 Å65(1) 3EGZ|B
148NR_all_06991.1
Exact match
Homo sapiens
3NKB|B (3NKB)
  • The hepatitis delta virus ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å64(1) 3NKB|B
149NR_all_46760.1
Exact match
3HAX|E (3HAX)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.1 Å63(1) 3HAX|E
150NR_all_58821.1
Exact match
2CZJ|B (2CZJ)
  • tmRNA (63-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.0 Å63(1) 2CZJ|B
151NR_all_95960.1
Exact match
Saccharomyces cerevisiae
2WWB|D (2WW9)
  • 25S RRNA, 5.8S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): D
8.6 Å63(3) 2WW9|D, 2WWA|D, 2WWB|D
152NR_all_10343.1
Exact match
Xenopus laevis
1UN6|E (1UN6)
  • 5S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.1 Å61(1) 1UN6|E
153NR_all_61217.1
Exact match
1MMS|C (1MMS)
  • 23S RIBOSOMAL RNA, RNA, RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å58(3) 1MMS|C, 1OLN|C, 2JQ7|B
154NR_all_65359.1
Exact match
3HJW|D (3HJW)
  • RNA (58-MER), H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.4 Å58(6) 3HJW|D, 3LWO|D, 3LWP|D, 3LWQ|D, 3LWR|D, 3LWV|D
155NR_all_81219.1
Exact match
Haloarcula marismortui
1QA6|C (1C04)
  • 23S RRNA FRAGMENT, 58 NUCLEOTIDE RIBOSOM[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
5.0 Å58(4) 1C04|E, 1HC8|C, 1QA6|C, 1Y39|C
156NR_all_14317.1
Exact match
2QUW|B (2QUW)
  • Hammerhead ribozyme, cleaved fragment
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.2 Å57(1) 2QUW|B
157NR_all_46544.1
Exact match
Thermus thermophilus
1F7Y|B (1DK1)
  • RRNA FRAGMENT, 16S RIBOSOMAL RNA FRAGMEN[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å57(3) 1DK1|B, 1F7Y|B, 1KUQ|B
158NR_all_33454.1
Exact match
3F4G|Y (3F4E)
  • FMN riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Y
3.1 Å56(3) 3F4E|Y, 3F4G|Y, 3F4H|Y
159NR_all_54817.1
Exact match
1MZP|B (1MZP)
  • fragment of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.7 Å55(1) 1MZP|B
160NR_all_65888.1
Exact match
2HGH|B (2HGH)
  • 55-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): B
55(1) 2HGH|B
161NR_all_84490.1
Exact match
Bacillus subtilis
2KZL|A (2KZL)
  • RNA (55-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
55(1) 2KZL|A
162NR_all_87156.1
Exact match
1P5M|A (1P5M)
  • 55-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
55(1) 1P5M|A
163NR_all_62455.1
Exact match
Ralstonia solanacearum
3NPN|A (3NPN)
  • S-ADENOSYLHOMOCYSTEINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å54(2) 3NPN|A, 3NPQ|A
164NR_all_18779.1
Exact match
1KH6|A (1KH6)
  • JIIIabc
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å53(1) 1KH6|A
165NR_all_19088.1
Exact match
3E5C|A (3E5C)
  • SMK box (SAM-III) Riboswitch, SMK box (S[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å53(3) 3E5C|A, 3E5E|A, 3E5F|A
166NR_all_91132.1
Exact match
2QWY|A (2QWY)
  • SAM-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å52(1) 2QWY|A
167NR_all_99345.1
Exact match
Homo sapiens
1E8O|E (1E8O)
  • 7SL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.2 Å50(1) 1E8O|E
168NR_all_27246.1
Exact match
2PXV|B (1DUL)
  • 4.5 S RNA DOMAIN IV, 4.5S RNA DOMAIN IV,[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.8 Å49(14) 1DUL|B, 1HQ1|B, 2PXB|B, 2PXD|B, 2PXE|B, 2PXF|B, 2PXK|B, 2PXL|B, 2PXP|B, 2PXQ|B, 2PXT|B, 2PXU|B, 2PXV|B, 3LQX|B
169NR_all_35446.1
Exact match
1U63|B (1U63)
  • 49 NT FRAGMENT OF MRNA FOR L1
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.4 Å49(1) 1U63|B
170NR_all_94204.1
Exact match
1RMN|A (1RMN)
  • RNA (49-MER)
  • FLUORESCENCE TRANSFER
  • Chain(s): ; model(s): A
49(1) 1RMN|A
171NR_all_28616.1
Exact match
Methanocaldococcus jannaschii
2VPL|B (2VPL)
  • FRAGMENT OF MRNA FOR L1-OPERON CONTAININ[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å48(1) 2VPL|B
172NR_all_58362.1
Exact match
Drosophila melanogaster
2KUW|A (2KUW)
  • K10 TLS RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
48(1) 2KUW|A
173NR_all_85342.1
Exact match
Drosophila melanogaster
2KUU|A (2KE6)
  • K10 TLS RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
48(4) 2KE6|A, 2KUR|A, 2KUU|A, 2KUV|A
174NR_all_18340.1
Exact match
1S03|A (1S03)
  • 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.7 Å47(1) 1S03|A
175NR_all_53440.1
Exact match
1XJR|A (1XJR)
  • s2m RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.7 Å47(1) 1XJR|A
176NR_all_54211.1
Exact match
Sulfolobus solfataricus
1QZW|B (1QZW)
  • 7S RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
4.1 Å47(1) 1QZW|B
177NR_all_59191.1
Exact match
1YMO|A (1YMO)
  • Telomerase RNA P2b-P3 pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
47(3) 1YMO|A, 2K95|A, 2K96|A
178NR_all_68477.1
Exact match
3CIY|C (3CIY)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.4 Å46(1) 3CIY|C
179NR_all_80133.1
Exact match
2NUE|C (2NUE)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å46(1) 2NUE|C
180NR_all_83022.1
Exact match
3IAB|R (3IAB)
  • P3 domain of the RNA component of RNase [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.7 Å46(1) 3IAB|R
181NR_all_40684.1
New id, no parents
1DUH|A (1DUH)
  • 4.5S RNA DOMAIN IV
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.7 Å45(1) 1DUH|A
182NR_all_66266.1
Exact match
1Z2J|A (1Z2J)
  • HIV-1 frameshift site RNA, HIV-1 framesh[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
45(2) 1Z2J|A, 1ZC5|A
183NR_all_03603.1
Exact match
1G1X|E (1G1X)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.6 Å44(1) 1G1X|E
184NR_all_29655.1
Exact match
Turnip yellow mosaic virus
1A60|A (1A60)
  • TYMV PSEUDOKNOT
  • SOLUTION NMR
  • Chain(s): ; model(s): A
44(1) 1A60|A
185NR_all_35166.1
Exact match
2OEU|A (2OEU)
  • Hammerhead Ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å43(1) 2OEU|A
186NR_all_57376.1
Exact match
Escherichia coli
1CQL|A (1CQ5)
  • SRP RNA DOMAIN IV, SRP DOMAIN IV RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
43(2) 1CQ5|A, 1CQL|A
187NR_all_79102.1
Exact match
2ADT|A (2ADT)
  • 43-MER, RNA (43-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
43(6) 2ADT|A, 2I7E|A, 2I7Z|A, 2JYF|A, 2JYH|A, 2JYJ|A
188NR_all_88898.1
Exact match
2FEY|A (2FEY)
  • stem-loop IV of Tetrahymena telomerase R[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
43(1) 2FEY|A
189NR_all_05702.1
Exact match
Homo sapiens
2L2J|A (2L2J)
  • RNA (42-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
42(2) 2L2J|A, 2L2K|A
190NR_all_17383.1
Exact match
Homo sapiens
2KX8|A (2KX8)
  • 7SK
  • SOLUTION NMR
  • Chain(s): ; model(s): A
42(1) 2KX8|A
191NR_all_47285.1
Exact match
Spinacia oleracea
1MNX|A (1MNX)
  • Loop E from 5S rRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
42(1) 1MNX|A
192NR_all_27727.1
Exact match
Escherichia coli
1A51|A (1A51)
  • 5S RRNA LOOP D/LOOP E
  • SOLUTION NMR
  • Chain(s): ; model(s): A
41(1) 1A51|A
193NR_all_47619.1
Exact match
2AU4|A (2AU4)
  • Class I RNA aptamer to GTP
  • SOLUTION NMR
  • Chain(s): ; model(s): A
41(1) 2AU4|A
194NR_all_52401.1
Exact match
synthetic construct
3PLA|G (3PLA)
  • C/D guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
3.2 Å40(1) 3PLA|G
195NR_all_73096.1
Exact match
1AM0|A (1AM0)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
40(1) 1AM0|A
196NR_all_79080.1
Exact match
3P22|A (3P22)
  • Core ENE hairpin from KSHV PAN RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å40(1) 3P22|A
197NR_all_90185.1
Exact match
2HUA|A (2HUA)
  • CSFV IRES Domain IIa
  • SOLUTION NMR
  • Chain(s): ; model(s): A
40(1) 2HUA|A
198NR_all_04485.1
Exact match
2D1B|A (2D1B)
  • RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
39(1) 2D1B|A
199NR_all_19240.1
Exact match
2D1A|A (2D1A)
  • RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
39(1) 2D1A|A
200NR_all_74923.1
Exact match
2ZY6|A (2ZY6)
  • phenylalanyl transfer RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å39(1) 2ZY6|A
201NR_all_17048.1
Exact match
1F1T|A (1F1T)
  • MALACHITE GREEN APTAMER RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å38(1) 1F1T|A
202NR_all_25746.1
Exact match
2HW8|B (1ZHO)
  • mRNA, 36-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.6 Å38(2) 1ZHO|B, 2HW8|B
203NR_all_29813.1
Exact match
1YKV|B (1YKQ)
  • Diels-Alder ribozyme, RNA Diels-Alder ri[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.5 Å38(3) 1YKQ|B, 1YKV|B, 1YLS|B
204NR_all_36056.1
Exact match
2KHY|A (2KHY)
  • RNA (38-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 2KHY|A
205NR_all_69494.1
Exact match
1TXS|A (1TXS)
  • Enteroviral 5'-UTR
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 1TXS|A
206NR_all_71399.1
Exact match
Hepatitis C virus
2KU0|A (2KTZ)
  • HCV IRES Domain IIa RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(2) 2KTZ|A, 2KU0|A
207NR_all_89850.1
Exact match
1M5L|A (1M5L)
  • modified HIV-1 packaging signal stem-loo[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 1M5L|A
208NR_all_93959.1
Exact match
synthetic construct
1B36|A (1B36)
  • RNA (RNA LOOP B)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 1B36|A
209NR_all_96317.1
Exact match
1U3K|A (1A9L)
  • PRE-TRNA BULGE-HELIX-BULGE MOTIF, ABISS7[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(3) 1A9L|A, 1U3K|A, 2A9L|A
210NR_all_96594.1
Exact match
1Q8N|A (1Q8N)
  • RNA Aptamer
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 1Q8N|A
211NR_all_44143.1
Exact match
Escherichia coli
2BH2|C (2BH2)
  • 23S RIBOSOMAL RNA 1932-1968
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å37(1) 2BH2|C
212NR_all_74609.1
Exact match
1I6U|C (1I6U)
  • 16S RRNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å37(1) 1I6U|C
213NR_all_87881.1
Exact match
1KOG|I (1KOG)
  • Threonyl-tRNA synthetase mRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): I
3.5 Å37(1) 1KOG|I
214NR_all_03037.1
Exact match
2L1V|A (2L1V)
  • 36-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 2L1V|A
215NR_all_05562.1
Exact match
2FDT|A (2FDT)
  • 36-mer
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 2FDT|A
216NR_all_11732.1
Exact match
1N8X|A (1N8X)
  • HIV-1 STEM LOOP SL1 MONOMERIC RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 1N8X|A
217NR_all_29004.1
Exact match
1RAW|A (1RAW)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 1RAW|A
218NR_all_32059.1
Exact match
2TPK|A (2TPK)
  • RNA (MRNA PSEUDOKNOT)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 2TPK|A
219NR_all_40452.1
Exact match
Mason-Pfizer monkey virus
1E95|A (1E95)
  • RNA (5'-(*GP*CP*GP*GP*CP*CP*AP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 1E95|A
220NR_all_52542.1
Exact match
2XDB|G (2XD0)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
3.0 Å36(3) 2XD0|G, 2XDB|G, 2XDD|F
221NR_all_87382.1
Exact match
3GS5|C (3GS5)
  • RNA (36-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å36(1) 3GS5|C
222NR_all_05469.1
Exact match
2PCV|A (2PCV)
  • U65 Box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 2PCV|A
223NR_all_13145.1
Exact match
1ET4|A (1DDY)
  • VITAMIN B12 BINDING RNA, RNA APTAMER, 35[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å35(2) 1DDY|A, 1ET4|A
224NR_all_22080.1
Exact match
3OVA|C (3OUY)
  • RNA (35-MER), RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.7 Å35(5) 3OUY|C, 3OV7|C, 3OVA|C, 3OVB|C, 3OVS|C
225NR_all_50911.1
Exact match
1ULL|A (1ULL)
  • RNA (5'-R (GP*GP*CP*UP*GP*GP*AP*CP*UP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 1ULL|A
226NR_all_51421.1
Exact match
2PCW|A (2PCW)
  • U65 box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 2PCW|A
227NR_all_58528.1
Exact match
1FMN|A (1FMN)
  • RNA (5'-R(*GP*GP*CP*GP*UP*GP*UP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 1FMN|A
228NR_all_63564.1
Exact match
2GM0|A (2GM0)
  • RNA (35-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 2GM0|A
229NR_all_75138.1
Exact match
2L3E|A (2L3E)
  • 35-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 2L3E|A
230NR_all_76819.1
Exact match
3ID5|D (3ID5)
  • half C/D RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
4.0 Å35(1) 3ID5|D
231NR_all_00567.1
Exact match
Escherichia coli
1MJI|C (1MJI)
  • 5S rRNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å34(1) 1MJI|C
232NR_all_08029.1
Exact match
1NBK|A (1NBK)
  • RNA aptamer
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1NBK|A
233NR_all_12702.1
Exact match
2F88|A (2F88)
  • D5-PL RNA RIBOZYME DOMAIN
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 2F88|A
234NR_all_18555.1
Exact match
Rattus norvegicus
2L3C|B (2L3C)
  • RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): B
34(1) 2L3C|B
235NR_all_21269.1
Exact match
1R7W|A (1R7W)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1R7W|A
236NR_all_26428.1
Exact match
1P5N|A (1P5N)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1P5N|A
237NR_all_28379.1
Exact match
1T28|A (1T28)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1T28|A
238NR_all_33169.1
Exact match
1RNK|A (1RNK)
  • RNA PSEUDOKNOT
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1RNK|A
239NR_all_36767.1
Exact match
1R7Z|A (1R7Z)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1R7Z|A
240NR_all_49906.1
Exact match
2EUY|A (2EUY)
  • U65 box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 2EUY|A
241NR_all_51432.1
Exact match
1ETF|A (1ETF)
  • REV RESPONSE ELEMENT RNA, REV RESPONSIVE[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(3) 1ETF|A, 1ETG|A, 1I9F|A
242NR_all_54570.1
Exact match
2JTP|A (2JTP)
  • SIV17-50 RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 2JTP|A
243NR_all_57292.1
Exact match
3FU2|A (3FU2)
  • PreQ1 riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å34(2) 3FU2|A, 3K1V|A
244NR_all_62753.1
Exact match
1R2P|A (1R2P)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1R2P|A
245NR_all_63647.1
Exact match
1HMH|A (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å34(1) 1HMH|A
246NR_all_64252.1
Exact match
2KPV|A (2KPV)
  • RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 2KPV|A
247NR_all_97595.1
Exact match
2P89|A (2P89)
  • U65 H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 2P89|A
248NR_all_08485.1
Exact match
1O15|A (1EHT)
  • THEOPHYLLINE-BINDING RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
33(2) 1EHT|A, 1O15|A
249NR_all_16873.1
Exact match
3GCA|A (3GCA)
  • PreQ1 riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å33(1) 3GCA|A
250NR_all_48805.1
Exact match
1KPZ|A (1KPZ)
  • P1-P2 frameshifting pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
33(1) 1KPZ|A
251NR_all_73260.1
Exact match
2JXV|A (2JXV)
  • RNA (33-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
33(1) 2JXV|A
252NR_all_79801.1
Exact match
1EXY|A (1EXY)
  • RNA APTAMER, 33-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
33(1) 1EXY|A
253NR_all_84103.1
Exact match
1KPY|A (1KPY)
  • P1-P2 frameshifting pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
33(1) 1KPY|A
254NR_all_94354.1
Exact match
2OZB|C (2OZB)
  • RNA comprising the 5' Stem-Loop RNA of [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å33(1) 2OZB|C
255NR_all_04248.1
Exact match
1T4L|A (1T4L)
  • 5' terminal hairpin of snR47 precursor
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 1T4L|A
256NR_all_26958.1
Exact match
Human immunodeficiency virus 1
1G70|A (1G70)
  • HIV-1 RRE-IIB 32 NUCLEOTIDE RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 1G70|A
257NR_all_50313.1
Exact match
1KAJ|A (1KAJ)
  • RNA PSEUDOKNOT APK
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 1KAJ|A
258NR_all_54944.1
Exact match
1KPD|A (1KPD)
  • RNA PSEUDOKNOT APKA27G
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 1KPD|A
259NR_all_65077.1
Exact match
Escherichia coli
3BO1|C (3BO0)
  • Preprotein translocase secG subunit
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): C
9.6 Å32(2) 3BO0|C, 3BO1|C
260NR_all_73481.1
Exact match
1Z31|A (1Z31)
  • human telomerase PJ6 hairpin
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 1Z31|A
261NR_all_93111.1
Exact match
Canis lupus
3DKN|C (3DKN)
  • Preprotein translocase subunit secG
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): C
8.7 Å32(1) 3DKN|C
262NR_all_97025.1
Exact match
1XHP|A (1XHP)
  • U6 snRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 1XHP|A
263NR_all_00485.1
Exact match
1JO7|A (1JO7)
  • Influenza A virus promoter RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1JO7|A
264NR_all_05391.1
Exact match
1YNG|A (1YNG)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1YNG|A
265NR_all_15913.1
Exact match
1YLG|A (1YLG)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1YLG|A
266NR_all_24029.1
Exact match
1JBR|D (1JBR)
  • 31-mer SRD RNA analog, 29-MER SARCIN/RIC[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.2 Å31(2) 1JBR|D, 1JBT|C
267NR_all_30230.1
Exact match
1YNE|A (1YNE)
  • APOLIPOPROTEIN B mRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1YNE|A
268NR_all_32061.1
Exact match
Human immunodeficiency virus 1
1LVJ|A (1LVJ)
  • HIV-1 Trans Activating Region RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1LVJ|A
269NR_all_35011.1
Exact match
Escherichia coli
364D|C (357D)
  • RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.5 Å31(2) 357D|C, 364D|C
270NR_all_47677.1
Exact match
1YNC|A (1YNC)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1YNC|A
271NR_all_74015.1
Exact match
2B63|R (2B63)
  • 31-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.8 Å31(1) 2B63|R
272NR_all_92018.1
Exact match
1MFY|A (1MFY)
  • C4 promoter of influneza A virus
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1MFY|A
273NR_all_00060.1
Exact match
2LDZ|A (1LDZ)
  • LEAD-DEPENDENT RIBOZYME
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(2) 1LDZ|A, 2LDZ|A
274NR_all_00809.1
Exact match
Enterovirus B
1RFR|A (1RFR)
  • stemloop-D RNA of the 5'-cloverleaf of c[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1RFR|A
275NR_all_00934.1
Exact match
1HWQ|A (1HWQ)
  • VS RIBOZYME SUBSTRATE RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1HWQ|A
276NR_all_14325.1
Exact match
1NA2|A (1NA2)
  • telomerase RNA p2b hairpin
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1NA2|A
277NR_all_18182.1
Exact match
1KP7|A (1KP7)
  • Hepatitis C Virus Internal Ribosome Entr[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1KP7|A
278NR_all_25782.1
Exact match
3B91|B (3B58)
  • 29-mer Loop A and Loop B Ribozyme strand[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.7 Å30(14) 3B58|B, 3B5A|B, 3B5F|B, 3B5S|B, 3B91|B, 3BBI|B, 3BBK|B, 3BBM|B, 3CQS|C, 3CR1|C, 3I2Q|C, 3I2R|C, 3I2S|C, 3I2U|C
279NR_all_30417.1
Exact match
1HVU|C (1HVU)
  • RNA (33 NUCLEOTIDE RNA PSEUDOKNOT)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
4.8 Å30(1) 1HVU|C
280NR_all_43451.1
Exact match
1EKZ|B (1EKZ)
  • STAUFEN DOUBLE-STRANDED RNA BINDING DOMA[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
30(1) 1EKZ|B
281NR_all_45599.1
Exact match
1AUD|B (1AUD)
  • RNA 3UTR
  • SOLUTION NMR
  • Chain(s): ; model(s): B
30(1) 1AUD|B
282NR_all_56520.1
Exact match
1XOK|A (1XOK)
  • alfalfa mosaic virus RNA 3' UTR
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å30(1) 1XOK|A
283NR_all_59855.1
Exact match
1AJU|A (1AJU)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1AJU|A
284NR_all_65289.1
Exact match
1EBR|A (1EBR)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1EBR|A
285NR_all_94141.1
Exact match
1AKX|A (1AKX)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1AKX|A
286NR_all_03865.1
Exact match
2KX5|A (2KX5)
  • HIV TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 2KX5|A
287NR_all_04514.1
Exact match
Human immunodeficiency virus 1
1UTS|B (1UTS)
  • RNA (5'-(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
29(1) 1UTS|B
288NR_all_06925.1
Exact match
2L8H|A (2L8H)
  • HIV TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 2L8H|A
289NR_all_14241.1
Exact match
Human immunodeficiency virus 1
1UUI|B (1UUI)
  • 5'-R(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
29(1) 1UUI|B
290NR_all_17365.1
Exact match
1JID|B (1JID)
  • HELIX 6 OF HUMAN SRP RNA, SRP19 binding [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.8 Å29(2) 1JID|B, 1L1W|A
291NR_all_19397.1
Exact match
1D4R|A (1D4R)
  • 29-MER OF MODIFIED SRP RNA HELIX 6
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å29(1) 1D4R|A
292NR_all_26689.1
Exact match
3B31|A (3B31)
  • RNA (29-MER), Domain 3 of the cricket pa[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.4 Å29(4) 3B31|A, 3MJ3|B, 3MJA|B, 3MJB|A
293NR_all_29867.1
Exact match
1EBS|A (1EBS)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1EBS|A
294NR_all_36025.1
Exact match
1ANR|A (1ANR)
  • RNA REGULATORY ELEMENT TAR
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1ANR|A
295NR_all_42336.1
Exact match
Rattus norvegicus
1SCL|A (1SCL)
  • RNA SARCIN-RICIN LOOP
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1SCL|A
296NR_all_44777.1
Exact match
2KDQ|B (2KDQ)
  • HIV-1 TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
29(1) 2KDQ|B
297NR_all_49121.1
Exact match
1ARJ|N (1ARJ)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): N
29(1) 1ARJ|N
298NR_all_50748.1
Exact match
1OOA|C (1OOA)
  • RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å29(1) 1OOA|C
299NR_all_53807.1
Exact match
1EBQ|A (1EBQ)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1EBQ|A
300NR_all_55995.1
Exact match
2GIP|A (2GIO)
  • 29-MER, 28-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(2) 2GIO|A, 2GIP|A
301NR_all_58182.1
Exact match
1FQZ|A (1F84)
  • HCV-1B IRES RNA DOMAIN IIID, HEPATITIS C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(2) 1F84|A, 1FQZ|A
302NR_all_63196.1
Exact match
1L1C|C (1L1C)
  • licT mRNA antiterminator hairpin
  • SOLUTION NMR
  • Chain(s): ; model(s): C
29(1) 1L1C|C
303NR_all_63395.1
Exact match
1NBR|A (1NBR)
  • RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1NBR|A
304NR_all_76233.1
Exact match
1AQO|A (1AQO)
  • IRON RESPONSIVE ELEMENT RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1AQO|A
305NR_all_76597.1
Exact match
Human immunodeficiency virus 1
1QD3|A (1QD3)
  • HIV-1 TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1QD3|A
306NR_all_81647.1
Exact match
1JBS|C (1JBS)
  • 29-mer sarcin/ricin domain RNA analog
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.0 Å29(1) 1JBS|C
307NR_all_81804.1
Exact match
2JWV|A (2JWV)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 2JWV|A
308NR_all_82094.1
Exact match
2K5Z|A (2K5Z)
  • Duck HBV apical loop
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 2K5Z|A
309NR_all_86286.1
Exact match
Human immunodeficiency virus 1
1UUD|B (1UUD)
  • RNA (5'-(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
29(1) 1UUD|B
310NR_all_15898.1
Exact match
1MNB|B (1MNB)
  • BIV TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
28(1) 1MNB|B
311NR_all_28609.1
Exact match
2A9X|2 (2A9X)
  • BIV TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): 2
28(1) 2A9X|2
312NR_all_38320.1
Exact match
1L2X|A (1L2X)
  • RNA pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.3 Å28(3) 1L2X|A, 1L3D|A, 437D|A
313NR_all_44633.1
Exact match
1ZBN|A (1ZBN)
  • BIV mRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 1ZBN|A
314NR_all_46653.1
Exact match
2NUF|C (2NUF)
  • 28-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å28(1) 2NUF|C
315NR_all_50704.1
Exact match
Escherichia coli
28SR|A (28SP)
  • CONSERVED MOTIF IN SRP RNA, SRP DOMAIN I[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(2) 28SP|A, 28SR|A
316NR_all_56389.1
Exact match
1JWC|A (1JU7)
  • 5'-R(*GP*GP*CP*CP*AP*AP*AP*GP*GP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(2) 1JU7|A, 1JWC|A
317NR_all_58270.1
Exact match
1YG3|A (1YG3)
  • ScYLV RNA pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 1YG3|A
318NR_all_60014.1
Exact match
2AP0|A (2AP0)
  • C27A Sugarcane Yellow Leaf Virus RNA pse[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 2AP0|A
319NR_all_71759.1
Exact match
Human immunodeficiency virus 2
2KMJ|A (2KMJ)
  • RNA (28-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 2KMJ|A
320NR_all_73686.1
Exact match
Saccharomyces cerevisiae
2X7N|A (2X7N)
  • SARCIN-RICIN LOOP
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
11.8 Å28(1) 2X7N|A
321NR_all_82308.1
Exact match
2AP5|A (2AP5)
  • C27A Sugarcane Yellow Leaf Virus RNA pse[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 2AP5|A
322NR_all_92326.1
Exact match
2EZ6|C (2EZ6)
  • 28-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.1 Å28(1) 2EZ6|C
323NR_all_93265.1
Exact match
1BIV|A (1BIV)
  • BOVINE IMMUNODEFICIENCY VIRUS TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 1BIV|A
324NR_all_98221.1
Exact match
1YG4|A (1YG4)
  • ScYLV RNA pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 1YG4|A
325NR_all_02153.1
Exact match
2RP1|A (2RP1)
  • PEMV-1 mRNA pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 2RP1|A
326NR_all_07706.1
Exact match
1FYO|A (1FYO)
  • FRAGMENT OF 18S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 1FYO|A
327NR_all_09214.1
Exact match
3DVZ|A (1MSY)
  • SARCIN/RICIN DOMAIN FROM 23 S RRNA, Sarc[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å27(9) 1MSY|A, 1Q9A|A, 3DVZ|A, 3DW4|A, 3DW5|A, 3DW6|A, 3DW7|A, 480D|A, 483D|A
328NR_all_31366.1
Exact match
1BYJ|A (1BYJ)
  • RNA (16S RNA), 16S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(2) 1BYJ|A, 1PBR|A
329NR_all_32711.1
Exact match
1XSG|A (1F6X)
  • RNASE P RNA RIBOZYME, P4 DOMAIN, RNASE P[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(16) 1F6X|A, 1F6Z|A, 1F78|A, 1F79|A, 1F7F|A, 1F7G|A, 1F7H|A, 1F7I|A, 1XSG|A, 1XSH|A, 1XST|A, 1XSU|A, 2CD1|A, 2CD3|A, 2CD5|A, 2CD6|A
330NR_all_35018.1
Exact match
1TOB|A (1TOB)
  • RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 1TOB|A
331NR_all_35317.1
Exact match
1Q96|A (1Q93)
  • Sarcin/Ricin 28S rRNA, SARCIN/RICIN LOOP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å27(3) 1Q93|A, 1Q96|A, 430D|A
332NR_all_48053.1
Exact match
2RP0|A (2RP0)
  • PEMV-1 mRNA pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 2RP0|A
333NR_all_51438.1
Exact match
484D|B (484D)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): ; model(s): B
27(1) 484D|B
334NR_all_57027.1
Exact match
1YSV|A (1YSV)
  • 27-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 1YSV|A
335NR_all_75974.1
Exact match
2AHT|A (2AHT)
  • 27-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 2AHT|A
336NR_all_88020.1
Exact match
Hepatitis B virus
2IXY|A (2IXY)
  • 5'-R(*GP*GP*CP*CP*UP*CP*CP*AP*AP*GP *CP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 2IXY|A
337NR_all_93521.1
Exact match
1FYP|A (1FYP)
  • FRAGMENT OF 18S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 1FYP|A
338NR_all_01493.1
Exact match
3DD2|B (3DD2)
  • RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å26(1) 3DD2|B
339NR_all_09464.1
Exact match
387D|A (387D)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å26(1) 387D|A
340NR_all_59102.1
Exact match
3OL9|B (3OL6)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.5 Å26(6) 3OL6|B, 3OL7|B, 3OL8|B, 3OL9|B, 3OLA|B, 3OLB|B
341NR_all_59185.1
Exact match
1QWB|A (1QWB)
  • sNRE26
  • SOLUTION NMR
  • Chain(s): ; model(s): A
26(1) 1QWB|A
342NR_all_68758.1
Exact match
2RFK|E (2RFK)
  • guide RNA 2, RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å26(2) 2RFK|E, 3HJY|D
343NR_all_70900.1
Exact match
2L5Z|A (2L5Z)
  • RNA (26-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
26(1) 2L5Z|A
344NR_all_87519.1
Exact match
2F8T|C (2F8T)
  • 26-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.1 Å26(1) 2F8T|C
345NR_all_93776.1
Exact match
2A43|A (2A43)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.3 Å26(1) 2A43|A
346NR_all_04001.1
Exact match
2QUX|C (2QUX)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å25(1) 2QUX|C
347NR_all_12693.1
Exact match
1RLG|C (1RLG)
  • 25-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.7 Å25(1) 1RLG|C
348NR_all_14144.1
Exact match
1QC8|A (1QC8)
  • TAU EXON 10 SPLICING REGULATORY ELEMENT [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
25(1) 1QC8|A
349NR_all_16161.1
Exact match
2ANN|B (2ANN)
  • 5'-R(*CP*GP*CP*GP*CP*GP*GP*AP*UP*CP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å25(2) 2ANN|B, 2ANR|B
350NR_all_66292.1
Exact match
488D|D (1MME)
  • RNA HAMMERHEAD RIBOZYME, 5'-R(*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.1 Å25(9) 1MME|B, 1NYI|B, 1Q29|B, 299D|B, 300D|B, 301D|B, 359D|B, 379D|B, 488D|D
351NR_all_84843.1
Exact match
2KGP|A (2KGP)
  • RNA (25-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
25(1) 2KGP|A
352NR_all_93793.1
Exact match
1EI2|A (1EI2)
  • TAU EXON 10 SRE RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
25(1) 1EI2|A
353NR_all_95380.1
Exact match
1M82|A (1M82)
  • RNA (25-MER): THE COMPLEMENTARY RNA PROM[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
25(1) 1M82|A
354NR_all_02998.1
Exact match
2HEM|A (2HEM)
  • 5'-R(P*GP*GP*GP*AP*AP*GP*GP*CP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 2HEM|A
355NR_all_04509.1
Exact match
1NZ1|A (1NZ1)
  • SP U6 Intramolecular Stem-Loop RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1NZ1|A
356NR_all_12875.1
Exact match
3A6P|D (3A6P)
  • pre-microRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.9 Å24(1) 3A6P|D
357NR_all_12932.1
Exact match
1MT4|A (1MT4)
  • 23S ribosomal Hairpin 35
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1MT4|A
358NR_all_16247.1
Exact match
3AGV|S (3AGV)
  • 5'-R(*GP*GP*AP*GP*GP*(UFT)P*GP*(CFZ)P*(U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): S
2.2 Å24(1) 3AGV|S
359NR_all_26663.1
Exact match
2GBH|A (2GBH)
  • 5'-R(*(GMP)P*GP*GP*CP*UP*AP*AP*UP*GP*(PS[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 2GBH|A
360NR_all_40218.1
Exact match
1NC0|A (1NC0)
  • U80G U6 RNA Intramolecular Stem-Loop
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1NC0|A
361NR_all_45898.1
Exact match
Homo sapiens
1A9N|Q (1A9N)
  • RNA (5'-R(*CP*CP*UP*GP*GP*UP*AP*UP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Q
2.4 Å24(1) 1A9N|Q
362NR_all_47121.1
Exact match
2QH2|A (2QH2)
  • Human telomerase RNA CR7 terminal hairpi[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 2QH2|A
363NR_all_60930.1
Exact match
2KF0|A (1SY4)
  • U6 Intramolecular Stem-Loop RNA, RNA (5'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(3) 1SY4|A, 2KEZ|A, 2KF0|A
364NR_all_63492.1
Exact match
2NOK|A (2NOK)
  • 5'-R(*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å24(3) 2NOK|A, 2PN3|A, 2PN4|A
365NR_all_68783.1
Exact match
1RHT|A (1RHT)
  • RNA (5'-R(P*GP*GP*GP*AP*CP*UP*GP*AP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1RHT|A
366NR_all_69887.1
Exact match
1KKS|A (1KKS)
  • 5'-R(*GP*GP*AP*AP*GP*GP*CP*CP*CP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1KKS|A
367NR_all_71558.1
Exact match
1LC6|A (1LC6)
  • U6 Intramolecular Stem-loop RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1LC6|A
368NR_all_75119.1
Exact match
1SYZ|A (1SYZ)
  • U6 INTRAMOLECULAR STEM-LOOP RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1SYZ|A
369NR_all_75625.1
Exact match
2F4X|A (2F4X)
  • 5'-R(P*GP*GP*UP*UP*GP*CP*UP*GP*AP*AP*GP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 2F4X|A
370NR_all_96608.1
Exact match
1E4P|A (1E4P)
  • RNA (5'-R(*GP*UP*GP*CP*GP*AP*AP*GP*AP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1E4P|A
371NR_all_97091.1
Exact match
1NYB|B (1NYB)
  • BoxB RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
24(1) 1NYB|B
372NR_all_99925.1
Exact match
1TFN|A (1TFN)
  • RNA (5'-R(*GP*GP*GP*AP*CP*UP*GP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1TFN|A
373NR_all_00420.1
Exact match
3LOA|B (3LOA)
  • 5'-R(*GP*GP*GP*(5BU)P*GP*GP*UP*GP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å23(1) 3LOA|B
374NR_all_01945.1
Exact match
1XPF|A (1K9W)
  • HIV-1 DIS(Mal)UU RNA, 5'-R(*CP*UP*UP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å23(12) 1K9W|A, 1XP7|A, 1XPF|A, 1Y3O|A, 1Y3S|A, 1YXP|A, 1ZCI|A, 2B8S|A, 2FCX|A, 2FCY|A, 2FCZ|A, 2FD0|A
375NR_all_06987.1
Exact match
1BAU|A (1BAU)
  • SL1 RNA DIMER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1BAU|A
376NR_all_08877.1
Exact match
2O3V|A (2O3V)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å23(1) 2O3V|A
377NR_all_10974.1
Exact match
1TLR|A (1TLR)
  • RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACU[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1TLR|A
378NR_all_17381.1
Exact match
1S2F|A (1S2F)
  • 5'-R(*GP*GP*GP*GP*AP*GP*UP*GP*GP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1S2F|A
379NR_all_18811.1
Exact match
2FQN|A (2FQN)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å23(4) 2FQN|A, 2G5K|A, 2O3W|A, 2O3Y|A
380NR_all_21164.1
Exact match
2PJP|B (2PJP)
  • SECIS RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å23(1) 2PJP|B
381NR_all_30817.1
Exact match
1K5I|A (1K5I)
  • 5'-R(P*GP*GP*AP*CP*CP*CP*GP*GP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1K5I|A
382NR_all_32732.1
Exact match
3MEI|A (3MEI)
  • RNA (5'-R(*CP*CP*GP*CP*CP*GP*CP*GP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å23(1) 3MEI|A
383NR_all_39028.1
Exact match
2OIY|A (2OIJ)
  • 5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å23(4) 2OIJ|A, 2OIY|A, 2OJ0|A, 3FAR|A
384NR_all_40259.1
Exact match
1OSW|A (1OSW)
  • 5'-R(*GP*GP*AP*GP*GP*CP*GP*CP*UP*AP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1OSW|A
385NR_all_40663.1
Exact match
1BGZ|A (1BGZ)
  • RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1BGZ|A
386NR_all_42580.1
Exact match
Human immunodeficiency virus 1
1BVJ|A (1BVJ)
  • RNA (5'-R(P*GP*GP*CP*GP*AP*CP*GP*GP*UP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1BVJ|A
387NR_all_43870.1
Exact match
1NLC|A (1NLC)
  • HIV-1 DIS(MAL) genomic RNA, 5'-R(*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å23(12) 1NLC|A, 1O3Z|A, 1WVD|A, 1Y6S|A, 1Y6T|A, 1Y73|A, 1Y90|A, 1Y95|A, 1Y99|A, 3C44|A, 3DVV|A, 462D|A
388NR_all_45404.1
Exact match
1OW9|A (1OW9)
  • A mimic of the VS Ribozyme Hairpin Subst[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1OW9|A
389NR_all_55234.1
Exact match
2QH3|A (2QH3)
  • Human U64 H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 2QH3|A
390NR_all_58869.1
Exact match
1MFK|A (1MFK)
  • 5'-R(P*GP*GP*CP*GP*GP*UP*UP*GP*CP*AP*GP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1MFK|A
391NR_all_65107.1
Exact match
1JTJ|A (1JTJ)
  • HIV-1Lai SL1
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1JTJ|A
392NR_all_68199.1
Exact match
3BNQ|A (3BNQ)
  • A site of human mitochondrial ribosome, [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å23(3) 3BNQ|A, 3BNR|A, 3BNS|A
393NR_all_73214.1
Exact match
3PHP|A (3PHP)
  • RNA (5'-R(*GP*GP*UP*UP*CP*CP*GP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 3PHP|A
394NR_all_78874.1
Exact match
1S34|A (1S34)
  • 5'-R(*GP*GP*GP*GP*AP*GP*UP*GP*GP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1S34|A
395NR_all_83678.1
Exact match
1JU1|A (1JU1)
  • HIV-1Lai SL1
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1JU1|A
396NR_all_83896.1
Exact match
2QEK|A (2QEK)
  • HIV-1 subtype F DIS genomic RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å23(1) 2QEK|A
397NR_all_90066.1
Exact match
1NEM|A (1NEM)
  • 5'-R(*GP*GP*AP*CP*UP*GP*GP*GP*CP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1NEM|A
398NR_all_95705.1
Exact match
2PLY|C (1WSU)
  • 5'-R(*GP*GP*CP*GP*UP*UP*GP*CP*CP*GP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.3 Å23(3) 1WSU|E, 2PLY|C, 2UWM|C
399NR_all_96127.1
Exact match
2RO2|A (2RO2)
  • RNA (5'-R(*GP*GP*GP*AP*GP*AP*CP*CP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 2RO2|A
400NR_all_99131.1
Exact match
1XPE|A (1XPE)
  • 5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å23(2) 1XPE|A, 2B8R|A
401NR_all_00286.1
Exact match
2JUK|A (2JUK)
  • HIV-1 frameshift site RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2JUK|A
402NR_all_00665.1
Exact match
1K8W|B (1K8W)
  • 5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*UP*(FHU)P*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å22(2) 1K8W|B, 1ZL3|B
403NR_all_05603.1
Exact match
2JYM|A (2JYM)
  • RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2JYM|A
404NR_all_12483.1
Exact match
1PJY|A (1PJY)
  • HIV-1 frameshift inducing stem-loop
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1PJY|A
405NR_all_13494.1
Exact match
2GRW|A (2GRW)
  • 5'-GGACCUCUCGAAAGAGAUGUCC-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2GRW|A
406NR_all_15906.1
Exact match
2JSE|A (2JSE)
  • RNA (5'-R(*GP*GP*AP*GP*UP*GP*GP*CP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2JSE|A
407NR_all_16233.1
Exact match
1NTB|A (1NTA)
  • 5'-R(*GP*GP*AP*UP*CP*GP*CP*AP*UP*UP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å22(2) 1NTA|A, 1NTB|A
408NR_all_16991.1
Exact match
2KD8|A (2KD8)
  • 5'-R(*GP*GP*AP*UP*GP*GP*UP*UP*GP*GP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2KD8|A
409NR_all_17243.1
Exact match
1MWL|A (1J7T)
  • 5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å22(13) 1J7T|A, 1LC4|A, 1MWL|A, 1YRJ|A, 2BE0|A, 2BEE|A, 2ESI|A, 2ESJ|A, 2ET3|A, 2ET4|A, 2ET5|A, 2F4T|B, 2PWT|A
410NR_all_18764.1
Exact match
Escherichia coli
1O9M|A (1O9M)
  • EUBACTERIAL A-SITE, 5'-R(*CP*GP*CP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.4 Å22(3) 1O9M|A, 2ET8|A, 2F4U|A
411NR_all_20011.1
Exact match
2HNS|A (2HNS)
  • 5'-R(*GP*GP*CP*GP*UP*GP*AP*UP*CP*AP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2HNS|A
412NR_all_21827.1
Exact match
2K66|A (2K66)
  • 5'-R(*GP*GP*AP*GP*UP*AP*UP*GP*UP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2K66|A
413NR_all_26271.1
Exact match
2GV4|A (1N66)
  • internal loop in the Y-domain of poliovi[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(2) 1N66|A, 2GV4|A
414NR_all_32355.1
Exact match
3DH3|E (3DH3)
  • stem loop fragment of E. Coli 23S RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.0 Å22(1) 3DH3|E
415NR_all_32604.1
Exact match
1K6H|A (1K6H)
  • RNA (5'-R(P*GP*GP*CP*GP*UP*GP*UP*UP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1K6H|A
416NR_all_39139.1
Exact match
Homo sapiens
1E7K|C (1E7K)
  • RNA (5'-R(*GP*CP*CP*AP*AP*UP*GP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å22(1) 1E7K|C
417NR_all_39794.1
Exact match
3HTX|B (3HTX)
  • 5'-R(*GP*AP*UP*UP*UP*CP*UP*CP*UP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.1 Å22(1) 3HTX|B
418NR_all_42727.1
Exact match
2GV3|A (2GV3)
  • 5'-R(*GP*GP*CP*CP*AP*GP*AP*CP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2GV3|A
419NR_all_44365.1
Exact match
1F9L|A (1F9L)
  • 5'-R(*GP*GP*CP*GP*AP*AP*GP*UP*CP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1F9L|A
420NR_all_44670.1
Exact match
2G1W|A (2G1W)
  • 5'-R(*GP*GP*GP*GP*UP*GP*GP*CP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2G1W|A
421NR_all_45177.1
Exact match
1IE2|A (1IE2)
  • 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1IE2|A
422NR_all_46520.1
Exact match
1K2G|A (1K2G)
  • 5'-R(*CP*AP*GP*AP*CP*UP*UP*CP*GP*GP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1K2G|A
423NR_all_48161.1
Exact match
Equine infectious anemia virus
2W2H|R (2W2H)
  • 5'-R(*GP*CP*UP*CP*AP*GP*AP*UP*CP*UP *GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.3 Å22(1) 2W2H|R
424NR_all_59646.1
Exact match
1FJE|A (1FJE)
  • SNRE RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1FJE|A
425NR_all_60700.1
New id, no parents
3BNT|A (3BNT)
  • A site of human mitochondrial ribosome
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å22(1) 3BNT|A
426NR_all_61286.1
Exact match
1IE1|A (1IE1)
  • 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1IE1|A
427NR_all_62781.1
Exact match
1JUR|A (1JUR)
  • 5'-R(*GP*GP*CP*CP*UP*GP*AP*GP*GP*AP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1JUR|A
428NR_all_65247.1
Exact match
1IKD|A (1IKD)
  • TRNA ALA ACCEPTOR STEM
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1IKD|A
429NR_all_66082.1
Exact match
Homo sapiens
1DZ5|C (1DZ5)
  • PIE, RNA (5'-R(*GP*AP*GP*AP*CP*AP*UP*UP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): C
22(1) 1DZ5|C
430NR_all_72372.1
Exact match
1TJZ|A (1TJZ)
  • VS Ribozyme
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1TJZ|A
431NR_all_76888.1
Exact match
3FTF|C (3FTE)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å22(2) 3FTE|C, 3FTF|C
432NR_all_81088.1
Exact match
1ZE2|C (1ZE2)
  • 5'-R(*GP*GP*CP*CP*AP*CP*GP*GP*UP*(FHU)P*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å22(2) 1ZE2|C, 2AB4|B
433NR_all_86268.1
Exact match
1K6G|A (1K6G)
  • RNA (5'-R(P*GP*GP*CP*GP*UP*CP*AP*UP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1K6G|A
434NR_all_89621.1
Exact match
3BNL|A (3BNL)
  • A site of bacterial ribosome
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å22(1) 3BNL|A
435NR_all_99185.1
Exact match
2F8S|C (2F8S)
  • 5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å22(1) 2F8S|C
436NR_all_00950.1
Exact match
1JOX|A (1JOX)
  • 5'-R(*GP*GP*CP*GP*GP*UP*GP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1JOX|A
437NR_all_05510.1
Exact match
1FEU|C (1FEU)
  • 21 NT FRAGMENT OF 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.3 Å21(1) 1FEU|C
438NR_all_12035.1
Exact match
17RA|A (17RA)
  • RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 17RA|A
439NR_all_22579.1
Exact match
2I82|E (2I82)
  • 5'-R(*GP*AP*GP*GP*GP*GP*AP*UP*UP*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.1 Å21(1) 2I82|E
440NR_all_22892.1
Exact match
2ZKO|C (2ZKO)
  • RNA (5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.7 Å21(1) 2ZKO|C
441NR_all_25166.1
Exact match
2FY1|B (2FY1)
  • S1A stem-loop RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
21(1) 2FY1|B
442NR_all_30115.1
Exact match
1RPU|C (1RPU)
  • 5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*UP*CP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å21(1) 1RPU|C
443NR_all_38901.1
Exact match
1D0U|A (1D0U)
  • PHAGE MS2 RNA BINDING SITE
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1D0U|A
444NR_all_40591.1
Exact match
Escherichia coli
1A4D|A (1A4D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*UP*GP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1A4D|A
445NR_all_48011.1
Exact match
1QWA|A (1QWA)
  • 18S ribosomal RNA, 5'ETS
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1QWA|A
446NR_all_49861.1
Exact match
1URN|P (1URN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
1.9 Å21(1) 1URN|P
447NR_all_51882.1
Exact match
1R9F|B (1R9F)
  • 5'-R(*CP*GP*UP*AP*CP*GP*CP*GP*GP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å21(1) 1R9F|B
448NR_all_53346.1
Exact match
1RKJ|B (1RKJ)
  • 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
21(1) 1RKJ|B
449NR_all_55938.1
Exact match
1J6S|A (1D0T)
  • PHOSPHOROTHIOATE SUBSTITUTED PHAGE MS2 R[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(4) 1D0T|A, 1GUC|A, 1J6S|A, 1R3X|A
450NR_all_57848.1
Exact match
2O3X|A (2F4S)
  • 5'-R(P*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å21(2) 2F4S|A, 2O3X|A
451NR_all_64601.1
Exact match
2BJ2|A (1BJ2)
  • RNA (5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*AP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(2) 1BJ2|A, 2BJ2|A
452NR_all_74988.1
Exact match
1JP0|A (1JP0)
  • 5'-R(*GP*GP*CP*GP*GP*UP*GP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1JP0|A
453NR_all_76419.1
Exact match
2ZI0|C (2ZI0)
  • RNA (5'-D(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å21(1) 2ZI0|C
454NR_all_81707.1
Exact match
1SZY|A (1SZY)
  • 5'-R(P*GP*GP*CP*AP*GP*GP*GP*CP*UP*CP*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1SZY|A
455NR_all_92391.1
Exact match
3BNP|A (3BNN)
  • A site of human ribosome, A site of huma[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å21(3) 3BNN|A, 3BNO|A, 3BNP|A
456NR_all_02383.1
Exact match
1A1T|B (1A1T)
  • SL3 STEM-LOOP RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
20(1) 1A1T|B
457NR_all_03112.1
Exact match
2RPT|A (2RPT)
  • RNA (5'-R(*GP*GP*CP*CP*CP*GP*CP*CP*GP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2RPT|A
458NR_all_04377.1
Exact match
1ZBH|E (1ZBH)
  • 5'-R(*CP*CP*GP*GP*CP*UP*CP*UP*UP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.0 Å20(1) 1ZBH|E
459NR_all_14101.1
Exact match
2O33|A (2O33)
  • U2 snRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2O33|A
460NR_all_27670.1
Exact match
2TOB|A (2TOB)
  • RNA (5'-R(*AP*CP*UP*UP*GP*GP*UP*UP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2TOB|A
461NR_all_33217.1
Exact match
synthetic construct
1Q2R|E (1Q2R)
  • RNA (5'-R(*AP*GP*CP*AP*CP*GP*GP*CP*UP*(N[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å20(2) 1Q2R|E, 1Q2S|E
462NR_all_41851.1
Exact match
1MFJ|A (1MFJ)
  • 5'-R(*GP*AP*CP*AP*GP*UP*CP*UP*CP*UP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 1MFJ|A
463NR_all_50849.1
Exact match
1EC6|C (1EC6)
  • 20-MER RNA HAIRPIN
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å20(1) 1EC6|C
464NR_all_55774.1
Exact match
361D|A (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å20(1) 361D|A
465NR_all_56627.1
Exact match
1ZSE|R (1ZSE)
  • RNA HAIRPIN, 5'-R(*AP*UP*GP*CP*AP*UP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.0 Å20(4) 1ZSE|R, 2B2D|R, 2BS0|R, 2BS1|R
466NR_all_65195.1
Exact match
Saccharomyces cerevisiae
1U2A|A (1U2A)
  • RNA (5'-R(P*GP*GP*UP*CP*AP*GP*UP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(2) 1U2A|A, 2U2A|A
467NR_all_67063.1
Exact match
1HLX|A (1HLX)
  • RNA (5'-R(*GP*GP*GP*AP*UP*AP*AP*CP*UP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 1HLX|A
468NR_all_69115.1
Exact match
2RPK|A (2RPK)
  • RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2RPK|A
469NR_all_69359.1
Exact match
1BN0|A (1BN0)
  • SL3 RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 1BN0|A
470NR_all_84878.1
Exact match
2JPP|C (2JPP)
  • RNA (5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): C
20(1) 2JPP|C
471NR_all_92542.1
Exact match
2O32|A (2O32)
  • 5'-R(*(PSU)P*CP*UP*CP*(OMG)P*(OMG)P*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2O32|A
472NR_all_00869.1
Exact match
Hepatitis delta virus
1ATO|A (1ATO)
  • RNA (5'-R(*GP*GP*CP*AP*CP*CP*UP*CP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 1ATO|A
473NR_all_11466.1
Exact match
2RLU|A (2RLU)
  • RNA (5'-R(*GP*GP*UP*UP*GP*CP*GP*GP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 2RLU|A
474NR_all_13113.1
Exact match
1F6U|B (1F6U)
  • HIV-1 STEM-LOOP SL2 FROM PSI-RNA PACKAGI[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
19(1) 1F6U|B
475NR_all_18199.1
Exact match
1UUU|A (1UUU)
  • RNA (5'-R(*GP*GP*CP*GP*UP*AP*CP*GP*UP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 1UUU|A
476NR_all_20253.1
Exact match
3BT7|C (3BT7)
  • RNA (5'-D(P*GP*CP*UP*GP*UP*GP*(5MU)P*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å19(1) 3BT7|C
477NR_all_25076.1
Exact match
1DFU|M (1DFU)
  • 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): M
1.8 Å19(1) 1DFU|M
478NR_all_34460.1
Exact match
2B7G|A (2B7G)
  • 5'-R(*GP*GP*AP*GP*GP*CP*UP*CP*UP*GP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 2B7G|A
479NR_all_36735.1
Exact match
1I3Y|A (1I3Y)
  • 5'-R(*GP*GP*CP*UP*GP*GP*CP*(OMU)P*GP*UP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 1I3Y|A
480NR_all_44879.1
Exact match
Enterobacteria phage MS2
2IZN|R (2IZN)
  • 5'-R(*AP*CP*AP*UP*CP*GP*CP*GP*AP*UP *UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.6 Å19(1) 2IZN|R
481NR_all_47037.1
New id, no parents
1KFO|A (1KFO)
  • 5'-R(*GP*AP*AP*UP*GP*CP*CP*UP*GP*CP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å19(1) 1KFO|A
482NR_all_48013.1
Exact match
2GJW|E (2GJW)
  • 5'-R(*GP*CP*GP*AP*CP*CP*GP*AP*CP*CP*AP*([...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å19(1) 2GJW|E
483NR_all_54172.1
Exact match
2P7E|D (1X9C)
  • 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.2 Å19(17) 1X9C|D, 1X9K|D, 1ZFT|D, 1ZFV|D, 1ZFX|D, 2BCY|D, 2BCZ|D, 2D2K|D, 2FGP|D, 2NPY|D, 2NPZ|D, 2OUE|D, 2P7D|D, 2P7E|D, 2P7F|D, 3GS1|D, 3GS8|D
484NR_all_61124.1
Exact match
1ESY|A (1ESY)
  • RNA (5'-R(P*GP*GP*CP*GP*AP*CP*UP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 1ESY|A
485NR_all_61534.1
Exact match
Caenorhabditis elegans
1SLO|A (1SLO)
  • RNA (5'-R(*UP*UP*AP*CP*CP*CP*AP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(2) 1SLO|A, 1SLP|A
486NR_all_69701.1
Exact match
1F27|A (1F27)
  • RNA (5'-R(*AP*CP*CP*GP*UP*CP*AP*GP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.3 Å19(1) 1F27|A
487NR_all_78712.1
Exact match
Homo sapiens
2XEB|A (2XEB)
  • 5'-R(P*GP*AP*UP*CP*GP*UP*AP*GP*CP*CP*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 2XEB|A
488NR_all_80327.1
Exact match
1QC0|C (1QC0)
  • 5'-R(*GP*CP*AP*CP*CP*GP*UP*UP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.6 Å19(1) 1QC0|C
489NR_all_80747.1
Exact match
2ES5|A (2B6G)
  • 5'-R(*GP*GP*AP*GP*GP*CP*UP*CP*UP*GP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(3) 2B6G|B, 2ES5|A, 2ESE|B
490NR_all_88420.1
Exact match
3CZ3|E (3CZ3)
  • RNA (5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.2 Å19(1) 3CZ3|E
491NR_all_90677.1
Exact match
1I3X|A (1I3X)
  • 5'-R(*GP*GP*CP*UP*GP*GP*CP*UP*GP*UP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 1I3X|A
492NR_all_94263.1
Exact match
2D2L|D (2D2L)
  • 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*(P1P)P*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.5 Å19(1) 2D2L|D
493NR_all_97758.1
Exact match
2C4Z|R (1AQ3)
  • RNA (5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.8 Å19(18) 1AQ3|R, 1AQ4|R, 1ZDH|R, 1ZDI|R, 1ZDK|R, 2B2E|R, 2B2G|R, 2BNY|R, 2BQ5|R, 2BU1|R, 2C4Q|R, 2C4Y|R, 2C4Z|R, 2C50|R, 2C51|R, 2IZ8|R, 2IZ9|R, 2IZM|R
494NR_all_02561.1
Exact match
2GVO|A (2GVO)
  • GUANOSINE-5'-MONOPHOSPHATE
  • SOLUTION NMR
  • Chain(s): ; model(s): A
18(1) 2GVO|A
495NR_all_21621.1
Exact match
1F5U|A (1F5U)
  • RNA (5'-R(*GP*GP*UP*GP*GP*GP*AP*GP*AP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
18(1) 1F5U|A
496NR_all_24919.1
Exact match
3KS8|E (3KS8)
  • 5'-R(*AP*GP*AP*AP*GP*GP*AP*GP*GP*GP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.4 Å18(1) 3KS8|E
497NR_all_31000.1
Exact match
1ZEV|A (1ZEV)
  • 5'-R(*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å18(2) 1ZEV|A, 3GM7|G
498NR_all_49727.1
Exact match
1AJF|A (1AJF)
  • RNA (5'-R(*GP*AP*CP*AP*GP*GP*GP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
18(1) 1AJF|A
499NR_all_58904.1
Exact match
Escherichia coli
2JLT|A (2JLT)
  • R06
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å18(1) 2JLT|A
500NR_all_72663.1
Exact match
2AZ2|C (2AZ0)
  • 5'-R(*GP*CP*AP*(5BU)P*GP*GP*AP*CP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å18(2) 2AZ0|C, 2AZ2|C
501NR_all_79168.1
Exact match
2R93|R (2R93)
  • RNA (5'-R(*UP*GP*AP*UP*UP*CP*UP*CP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
4.0 Å18(1) 2R93|R
502NR_all_79402.1
Exact match
1Z30|A (1Z30)
  • 5'-R(*GP*GP*CP*GP*UP*UP*CP*GP*UP*UP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
18(1) 1Z30|A
503NR_all_89486.1
Exact match
2QH4|A (2QH4)
  • Human U85 C/D-H/ACA scaRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
18(1) 2QH4|A
504NR_all_00045.1
Exact match
Saccharomyces cerevisiae
1LU3|A (1LU3)
  • PHENYLALANINE TRANSFER RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
16.8 Å17(1) 1LU3|A
505NR_all_01536.1
Exact match
1ATV|A (1ATV)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*AP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1ATV|A
506NR_all_04004.1
Exact match
2KRY|A (2KRY)
  • RNA (5'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*(RSQ[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KRY|A
507NR_all_07194.1
Exact match
1BZU|A (1BZU)
  • TRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1BZU|A
508NR_all_17743.1
Exact match
2KPC|A (2KPC)
  • RNA (5'-R(*UP*GP*AP*GP*CP*AP*CP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KPC|A
509NR_all_20313.1
Exact match
2OE5|B (2OE5)
  • RNA (5'-R(*GP*GP*UP*AP*CP*UP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.5 Å17(3) 2OE5|B, 2OE6|B, 2OE8|B
510NR_all_20533.1
Exact match
2KVN|A (2KVN)
  • RNA (5'-R(*GP*GP*UP*GP*AP*UP*UP*GP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KVN|A
511NR_all_21107.1
Exact match
1KOS|A (1KOS)
  • 5'-R(*CP*UP*GP*UP*GP*(5MU)P*UP*CP*GP*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1KOS|A
512NR_all_24134.1
Exact match
2D19|A (2D19)
  • 5'-R(*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2D19|A
513NR_all_28034.1
Exact match
2KPD|A (2KPD)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*CP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KPD|A
514NR_all_28340.1
Exact match
2O83|A (1LUU)
  • 5'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG)P*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(3) 1LUU|A, 1LUX|A, 2O83|A
515NR_all_30138.1
Exact match
2JRQ|A (2JRQ)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0)P*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2JRQ|A
516NR_all_36193.1
Exact match
2R92|T (2R92)
  • RNA (5'-R(*CP*UP*UP*GP*AP*CP*GP*CP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
3.8 Å17(1) 2R92|T
517NR_all_40572.1
Exact match
2G1G|A (2G1G)
  • 5'-R(*AP*CP*GP*GP*GP*CP*UP*CP*AP*UP*(T6A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2G1G|A
518NR_all_43256.1
Exact match
1U1Y|R (1U1Y)
  • 5'-R(*CP*CP*GP*GP*(2PR)P*GP*GP*AP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å17(2) 1U1Y|R, 5MSF|R
519NR_all_45868.1
Exact match
1YN1|A (1TBK)
  • VS ribozyme stem-loop V
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(3) 1TBK|A, 1YN1|A, 1YN2|A
520NR_all_52592.1
Exact match
1WKS|A (1WKS)
  • 5'-R(*GP*GP*CP*UP*UP*UP*GP*GP*AP*UP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1WKS|A
521NR_all_53628.1
Exact match
1BZ3|A (1BZ3)
  • TRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(2) 1BZ3|A, 1BZT|A
522NR_all_58221.1
Exact match
2AWQ|A (2AWQ)
  • 5'-R(*GP*GP*GP*GP*AP*(PSU)P*UP*GP*AP*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2AWQ|A
523NR_all_61274.1
Exact match
406D|A (406D)
  • RNA (5'-R(*CP*AP*CP*CP*GP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å17(1) 406D|A
524NR_all_62475.1
Exact match
1KKA|A (1KKA)
  • anticodon stem-loop of tRNA(PHE)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1KKA|A
525NR_all_64364.1
Exact match
2VUQ|A (1FL8)
  • ANTICODON DOMAIN OF TRNA(LYS), 5'-R(*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(12) 1FL8|A, 2JLU|C, 2JLV|C, 2JLW|C, 2JLX|C, 2JLY|C, 2JLZ|C, 2K65|A, 2L9E|A, 2O81|A, 2VUQ|A, 2W89|A
526NR_all_65706.1
Exact match
2JRG|A (2JRG)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0)P*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(2) 2JRG|A, 2JSG|A
527NR_all_67953.1
Exact match
1T0D|A (1T0D)
  • 5'-R(*GP*GP*UP*GP*GP*UP*GP*(MTU)P*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å17(5) 1T0D|A, 1T0E|A, 1ZX7|A, 1ZZ5|A, 2A04|A
528NR_all_69780.1
Exact match
2KRZ|A (2KRZ)
  • RNA (5'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KRZ|A
529NR_all_71012.1
Exact match
2D18|A (2D18)
  • 5'-R(*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2D18|A
530NR_all_77639.1
Exact match
2KRP|A (2KRP)
  • RNA (5'-R(*CP*UP*CP*GP*GP*CP*UP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KRP|A
531NR_all_80365.1
Exact match
1J4Y|A (1J4Y)
  • anticodon stem-loop of tRNA(Phe)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1J4Y|A
532NR_all_84417.1
Exact match
1BZ2|A (1BZ2)
  • TRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1BZ2|A
533NR_all_84845.1
Exact match
2KRV|A (2KRQ)
  • RNA (5'-R(*CP*UP*CP*GP*GP*CP*UP*IP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(3) 2KRQ|A, 2KRV|A, 2KRW|A
534NR_all_87935.1
Exact match
2JR4|A (2JR4)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*UP*AP*CP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2JR4|A
535NR_all_98584.1
Exact match
1R3E|C (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*(FHU)P*CP*GP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.1 Å17(1) 1R3E|C
536NR_all_99669.1
Exact match
1FEQ|A (1FEQ)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*UP*UP*(T6A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1FEQ|A
537NR_all_04523.1
New id, no parents
3CZW|X (3CZW)
  • RNA (5'-R(*G*UP*GP*GP*UP*CP*UP*GP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
1.4 Å16(2) 3CZW|X, 3D0M|X
538NR_all_20513.1
Exact match
1XWU|A (1XWU)
  • 5'-R(*CP*GP*AP*AP*AP*CP*AP*UP*AP*GP*AP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 1XWU|A
539NR_all_33570.1
Exact match
2L6I|A (2L6I)
  • RNA (5'-R(*GP*AP*UP*CP*UP*CP*UP*UP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 2L6I|A
540NR_all_47435.1
Exact match
2KYD|A (2KYD)
  • RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 2KYD|A
541NR_all_50779.1
Exact match
1JTW|A (1JTW)
  • 5'-R(*GP*GP*GP*UP*GP*CP*GP*AP*GP*AP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 1JTW|A
542NR_all_53870.1
Exact match
Pseudomonas aeruginosa
2XLI|B (2XLI)
  • 5'-R(*CP*UP*GP*CP*CP*GP*UP*AP*UP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å16(3) 2XLI|B, 2XLJ|B, 2XLK|C
543NR_all_61402.1
Exact match
2B3J|E (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.0 Å16(1) 2B3J|E
544NR_all_63636.1
Exact match
1N53|A (1N53)
  • RNA (5'-R(*GP*AP*GP*GP*GP*UP*GP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 1N53|A
545NR_all_74175.1
Exact match
2D17|A (2D17)
  • 5'-R(*CP*GP*GP*CP*AP*AP*GP*AP*GP*GP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 2D17|A
546NR_all_84368.1
Exact match
1T0K|D (1T0K)
  • 5'-R(*G*GP*AP*CP*GP*CP*AP*GP*AP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.2 Å16(1) 1T0K|D
547NR_all_85384.1
Exact match
420D|A (1YY0)
  • 5'-R(*GP*CP*AP*GP*AP*(A5M)P*UP*UP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.2 Å16(7) 1YY0|A, 1YZD|A, 1Z79|A, 1Z7F|A, 2H1M|A, 405D|A, 420D|A
548NR_all_85996.1
Exact match
2F8K|B (2F8K)
  • 5'-R(*UP*AP*AP*UP*CP*UP*UP*UP*GP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.0 Å16(1) 2F8K|B
549NR_all_89647.1
Exact match
2PN9|A (2OOM)
  • RNA 16-mer, 5'-R(*GP*GP*AP*GP*CP*CP*UP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(2) 2OOM|A, 2PN9|A
550NR_all_90662.1
Exact match
2RN1|A (1KIS)
  • RNA (5'-R(*GP*AP*GP*CP*CP*CP*UP*GP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(2) 1KIS|A, 2RN1|A
551NR_all_02056.1
Exact match
1QBP|A (1QBP)
  • 5'-R(*UP*GP*(CBV)P*(CBV)P*AP*GP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å15(1) 1QBP|A
552NR_all_09331.1
Exact match
2I91|D (2I91)
  • 5'-R(*C*GP*GP*UP*AP*GP*GP*CP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.7 Å15(1) 2I91|D
553NR_all_12271.1
Exact match
1XWP|A (1XWP)
  • 5'-R(*GP*GP*AP*GP*AP*UP*CP*GP*CP*AP*CP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 1XWP|A
554NR_all_13171.1
Exact match
1CSL|B (1CSL)
  • 5'-R(*UP*CP*UP*GP*AP*CP*GP*GP*UP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.6 Å15(1) 1CSL|B
555NR_all_21910.1
Exact match
Enterobacteria phage lambda
1QFQ|A (1HJI)
  • RNA (5-R(P*GP*CP*CP*CP*UP*GP*AP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(2) 1HJI|A, 1QFQ|A
556NR_all_55556.1
Exact match
1Q75|A (1Q75)
  • DKC mutant P2b telomerase RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 1Q75|A
557NR_all_57928.1
Exact match
397D|A (397D)
  • RNA (5'-R(*GP*GP*CP*CP*AP*GP*AP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.3 Å15(1) 397D|A
558NR_all_77352.1
Exact match
1ATW|A (1ATW)
  • RNA (5'-R(*GP*CP*UP*CP*CP*AP*GP*AP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 1ATW|A
559NR_all_80067.1
Exact match
1OQ0|A (1OQ0)
  • P6.1 RNA hairpin from hTR
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 1OQ0|A
560NR_all_92787.1
Exact match
1A4T|A (1A4T)
  • BOXB RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 1A4T|A
561NR_all_95358.1
New id, no parents
3P59|A (3P59)
  • RNA (5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å15(1) 3P59|A
562NR_all_01112.1
New id, no parents
3O7V|A (3O3I)
  • RNA (5'-R(*GP*CP*GP*AP*AP*UP*AP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å14(3) 3O3I|A, 3O6E|A, 3O7V|A
563NR_all_03700.1
Exact match
6MSF|R (6MSF)
  • RNA (5'-R(*CP*CP*AP*CP*AP*GP*UP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.8 Å14(1) 6MSF|R
564NR_all_05357.1
Exact match
1FHK|A (1FHK)
  • RNA (5'-R(*GP*GP*CP*GP*GP*UP*GP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1FHK|A
565NR_all_05585.1
Exact match
433D|A (433D)
  • 5'-R(*GP*GP*UP*AP*UP*UP*GP*CP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å14(1) 433D|A
566NR_all_11163.1
Exact match
1K4A|A (1K4A)
  • 5'-R(*GP*GP*UP*UP*CP*AP*GP*AP*AP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1K4A|A
567NR_all_14240.1
Exact match
1IK1|A (1IK1)
  • 5'-R(*GP*GP*UP*AP*CP*UP*AP*UP*GP*UP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1IK1|A
568NR_all_20238.1
Exact match
3OIN|C (3OIJ)
  • 5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*AP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å14(2) 3OIJ|C, 3OIN|C
569NR_all_28461.1
Exact match
1MHK|L (1MHK)
  • RNA 14-mer BCh12
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): L
2.5 Å14(1) 1MHK|L
570NR_all_35085.1
Exact match
1F85|A (1F85)
  • HCV-1B IRES RNA DOMAIN IIIE
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1F85|A
571NR_all_36619.1
Exact match
1MY9|A (1MY9)
  • 5'-R(*GP*GP*AP*GP*GP*UP*UP*UP*UP*GP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1MY9|A
572NR_all_40992.1
Exact match
1FUF|A (1FUF)
  • (5'-R(*GP*GP*UP*AP*UP*UP*UP*CP*GP*GP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.7 Å14(2) 1FUF|A, 1IK5|A
573NR_all_43279.1
Exact match
1KOC|B (1KOC)
  • RNA (5'-R(P*AP*CP*AP*GP*GP*UP*AP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
14(1) 1KOC|B
574NR_all_48632.1
Exact match
1DUQ|B (1DUQ)
  • THE REV BINDING ELEMENT
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.1 Å14(1) 1DUQ|B
575NR_all_50888.1
Exact match
2EVY|A (2EVY)
  • Poliovirus 5'NTR cloverleaf stem loop D [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 2EVY|A
576NR_all_53915.1
Exact match
1A3M|A (1A3M)
  • 16S RRNA (5'-R(*GP*GP*CP*GP*UP*CP*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1A3M|A
577NR_all_54271.1
Exact match
1WTS|A (1WTS)
  • RNA (5'-R(*GP*GP*AP*CP*CP*2MGP*GP*MA6P*M[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1WTS|A
578NR_all_59382.1
Exact match
Tetrahymena thermophila
1C0O|A (1C0O)
  • RNA (5'-R(*GP*GP*GP*UP*CP*UP*UP*CP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1C0O|A
579NR_all_68313.1
Exact match
1KOD|B (1KOD)
  • RNA (5'-R(P*AP*CP*GP*GP*UP*UP*AP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
14(1) 1KOD|B
580NR_all_73406.1
Exact match
7MSF|R (7MSF)
  • 5'-R(*UP*CP*GP*CP*CP*AP*AP*CP*AP*GP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.8 Å14(1) 7MSF|R
581NR_all_73664.1
Exact match
1RNA|A (1RNA)
  • RNA (5'-R(*UP*UP*AP*UP*AP*UP*AP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å14(1) 1RNA|A
582NR_all_77624.1
Exact match
1TFY|H (1TFY)
  • 5'-R(*GP*CP*GP*GP*AP*UP*AP*UP*CP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): H
3.2 Å14(1) 1TFY|H
583NR_all_83658.1
Exact match
1ROQ|A (1ROQ)
  • 5'-R(*GP*GP*UP*AP*UP*CP*AP*CP*GP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1ROQ|A
584NR_all_97342.1
Exact match
1K4B|A (1K4B)
  • 5'-R(*GP*GP*UP*UP*CP*AP*GP*UP*UP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1K4B|A
585NR_all_98879.1
Exact match
2KOC|A (2KOC)
  • RNA (5'-R(P*GP*GP*CP*AP*CP*UP*UP*CP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 2KOC|A
586NR_all_08008.1
Exact match
1VOP|A (1VOP)
  • 23S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1VOP|A
587NR_all_22379.1
Exact match
1NUJ|A (1NUJ)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å13(3) 1NUJ|A, 1NUV|A, 429D|A
588NR_all_23602.1
Exact match
1HS2|A (1HS1)
  • 5'-R(*GP*CP*GP*UP*UP*AP*AP*CP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(5) 1HS1|A, 1HS2|A, 1HS3|A, 1HS4|A, 1HS8|A
589NR_all_26248.1
Exact match
3CGR|B (3CGR)
  • RNA (5'-R(*CP*GP*CP*AP*CP*UP*AP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.1 Å13(1) 3CGR|B
590NR_all_28184.1
Exact match
3CGS|B (3CGS)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.7 Å13(1) 3CGS|B
591NR_all_39524.1
Exact match
3CJZ|A (3CJZ)
  • RNA (5'-R(*GP*GP*AP*CP*GP*(M2G)P*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å13(1) 3CJZ|A
592NR_all_40838.1
Exact match
1JZC|A (1JZC)
  • 5'-R(*GP*GP*UP*GP*CP*AP*UP*GP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1JZC|A
593NR_all_48275.1
Exact match
1I4C|A (1I4C)
  • RNA (5'-R(*GP*GP*UP*GP*CP*UP*UP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1I4C|A
594NR_all_53743.1
Exact match
3CGP|B (3CGP)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.6 Å13(2) 3CGP|B, 3CGQ|B
595NR_all_61311.1
Exact match
3MQK|D (3MQK)
  • RNA (5'-R(P*GP*UP*UP*CP*GP*AP*UP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.8 Å13(1) 3MQK|D
596NR_all_62338.1
Exact match
1TFW|G (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
2.2 Å13(1) 1TFW|G
597NR_all_66440.1
Exact match
1ESH|A (1ESH)
  • RNA (5'-R(*GP*GP*UP*GP*CP*AP*UP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(2) 1ESH|A, 1I46|A
598NR_all_67156.1
Exact match
1I9X|A (1I9X)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*GP*UP*AP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å13(1) 1I9X|A
599NR_all_69475.1
Exact match
1K8S|A (1K8S)
  • 5'-R(*GP*GP*CP*AP*GP*AP*GP*UP*GP*CP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1K8S|A
600NR_all_73105.1
Exact match
2R22|A (2R1S)
  • RNA (5'-R(*GP*CP*GP*UP*UP*(5BU)P*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å13(4) 2R1S|A, 2R20|A, 2R21|A, 2R22|A
601NR_all_85918.1
New id, no parents
413D|A (413D)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*UP*CP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å13(1) 413D|A
602NR_all_96474.1
Exact match
1I4B|A (1I4B)
  • 5'-R(*GP*GP*UP*GP*CP*UP*UP*AP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1I4B|A
603NR_all_96846.1
Exact match
Escherichia coli
1ELH|B (1ELH)
  • RNA (5'-R(*AP*AP*CP*UP*GP*CP*CP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
13(1) 1ELH|B
604NR_all_03173.1
Exact match
2K7E|A (2K7E)
  • RNA (5'-R(*GP*CP*GP*GP*UP*GP*UP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 2K7E|A
605NR_all_04525.1
Exact match
synthetic construct
1AL5|A (1AL5)
  • RNA (5'-R(*CP*GP*CP*AP*AP*AP*UP*UP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 1AL5|A
606NR_all_05548.1
Exact match
1SDR|A (1SDR)
  • RNA (5'-R(*UP*AP*AP*GP*GP*AP*GP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å12(1) 1SDR|A
607NR_all_05726.1
Exact match
Homo sapiens
3MIJ|A (3MIJ)
  • RNA (5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å12(1) 3MIJ|A
608NR_all_14942.1
New id, 1 parent
255D|A (255D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*CP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å12(1) 255D|A
609NR_all_23189.1
Exact match
Tetrahymena thermophila
1AJL|A (1AJL)
  • RNA (5'-R(*GP*GP*UP*AP*AP*UP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 1AJL|A
610NR_all_27708.1
Exact match
422D|A (422D)
  • 5'-R(*GP*AP*UP*CP*AP*CP*UP*UP*CP*GP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å12(1) 422D|A
611NR_all_31857.1
Exact match
1B7F|P (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
2.6 Å12(1) 1B7F|P
612NR_all_32218.1
Exact match
3NCU|C (3NCU)
  • 5'-R(*(GDP)P*AP*CP*GP*CP*UP*AP*GP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å12(1) 3NCU|C
613NR_all_40275.2
Updated, 1 parent
157D|A (157D)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å12(5) 157D|A, 1YYK|C, 1YYO|C, 2G92|A, 2Q1O|A
614NR_all_41533.1
New id, no parents
283D|A (283D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å12(1) 283D|A
615NR_all_41740.1
Exact match
280D|A (280D)
  • RNA (5'-R(*GP*GP*CP*GP*CP*UP*UP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.4 Å12(1) 280D|A
616NR_all_42781.1
Exact match
2KBP|A (2KBP)
  • 5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 2KBP|A
617NR_all_46973.1
Exact match
353D|A (353D)
  • RNA (5'-R(*AP*UP*CP*CP*CP*CP*CP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.4 Å12(1) 353D|A
618NR_all_48308.1
Exact match
3LRR|C (3LRR)
  • RNA (5'-R(*(ATP)P*UP*AP*UP*AP*UP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å12(1) 3LRR|C
619NR_all_51338.1
Exact match
1AJT|A (1AJT)
  • RNA (5'-R(*GP*GP*UP*AP*AP*UP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 1AJT|A
620NR_all_53385.1
Exact match
1RAU|A (1ME1)
  • 5'-R(*GP*GP*AP*CP*(U25)P*(U25)P*(C25)P*([...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(14) 1ME1|A, 1QLN|R, 1RAU|A, 1WNE|B, 1WTT|A, 2E9R|A, 2E9T|B, 2E9Z|B, 2EC0|B, 3KLV|B, 3KMQ|B, 3KMS|B, 3KNA|B, 3KOA|B
621NR_all_57397.1
Exact match
2F87|A (2F87)
  • SRP RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 2F87|A
622NR_all_62193.1
Exact match
1AFX|A (1AFX)
  • RNA (5'-R(*GP*GP*UP*GP*UP*GP*AP*AP*CP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 1AFX|A
623NR_all_63018.1
Exact match
1ZIG|A (1ZIF)
  • RNA (5'-R(*GP*GP*GP*CP*GP*AP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(3) 1ZIF|A, 1ZIG|A, 1ZIH|A
624NR_all_73356.1
Exact match
1RNG|A (1RNG)
  • RNA (5'-R(*GP*GP*CP*GP*CP*UP*UP*GP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 1RNG|A
625NR_all_75810.1
Exact match
1LNT|A (1LNT)
  • 5'-R(*GP*CP*GP*UP*CP*AP*GP*GP*UP*CP*(CBV[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.7 Å12(1) 1LNT|A
626NR_all_77780.1
Exact match
1YYW|E (1YYW)
  • 5'-R(*AP*AP*AP*UP*AP*UP*AP*UP*AP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.8 Å12(1) 1YYW|E
627NR_all_84806.1
New id, 1 parent
2Q1R|A (2Q1R)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.1 Å12(1) 2Q1R|A
628NR_all_87062.1
Exact match
2RQJ|A (2RQJ)
  • RNA (5'-R(*GP*GP*AP*GP*GP*AP*GP*GP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 2RQJ|A
629NR_all_91342.1
Exact match
3IBK|A (3IBK)
  • RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å12(1) 3IBK|A
630NR_all_92732.1
Exact match
Escherichia coli
354D|A (354D)
  • RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.5 Å12(1) 354D|A
631NR_all_92986.1
New id, 1 parent
205D|A (205D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*UP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å12(1) 205D|A
632NR_all_08326.1
Exact match
1QCU|A (1QCU)
  • 5'-R(P*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*G)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å11(1) 1QCU|A
633NR_all_32666.1
Exact match
2KXZ|A (2KXZ)
  • 5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
11(1) 2KXZ|A
634NR_all_35180.1
Exact match
2NUG|C (2NUG)
  • 5'-R(P*AP*AP*GP*GP*UP*CP*AP*UP*UP*CP*G)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.7 Å11(1) 2NUG|C
635NR_all_37056.1
Exact match
1TUT|A (1TUT)
  • 5'-R(*GP*AP*GP*GP*AP*AP*GP*GP*CP*GP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
11(1) 1TUT|A
636NR_all_47556.1
Exact match
2KY1|A (2KY1)
  • 5'-R(*GP*AP*CP*UP*AP*GP*AP*GP*UP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
11(1) 2KY1|A
637NR_all_52694.1
Exact match
1YZ9|C (1YZ9)
  • 5'-R(*CP*GP*AP*AP*CP*UP*UP*CP*GP*CP*G)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.1 Å11(1) 1YZ9|C
638NR_all_53565.1
Exact match
1KD5|A (1KD3)
  • 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å11(3) 1KD3|A, 1KD4|A, 1KD5|A
639NR_all_65130.1
Exact match
2KY0|A (2KY0)
  • 5'-R(*GP*AP*CP*GP*AP*GP*CP*GP*UP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
11(1) 2KY0|A
640NR_all_95548.1
Exact match
3FTM|B (3FS0)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å11(2) 3FS0|B, 3FTM|B
641NR_all_04707.1
New id, 1 parent
3NJ6|A (3NJ6)
  • 5'-R(*GP*GP*CP*AP*GP*CP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.0 Å10(1) 3NJ6|A
642NR_all_13365.1
Exact match
2AO5|A (2AO5)
  • 5'-R(*GP*GP*CP*GP*(5BU)P*GP*CP*GP*CP*U)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å10(1) 2AO5|A
643NR_all_24432.1
Exact match
1RRR|A (1OO7)
  • 5'-R(*GP*AP*AP*GP*AP*GP*AP*AP*GP*C)-3', [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(4) 1OO7|A, 1RRD|A, 1RRR|A, 404D|A
644NR_all_24935.1
Exact match
Saccharomyces cerevisiae
1LMV|B (1LMV)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*AP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
10(1) 1LMV|B
645NR_all_26934.1
Exact match
1XV0|A (1XV0)
  • 5'-R(*GP*GP*UP*GP*GP*AP*GP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(2) 1XV0|A, 2DD1|A
646NR_all_30281.1
Exact match
2DD3|A (2DD3)
  • 5'-R(*GP*GP*UP*GP*AP*AP*GP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(1) 2DD3|A
647NR_all_30623.1
Exact match
2JXQ|A (2JXQ)
  • RNA (5'-R(*GP*CP*AP*GP*AP*GP*AP*GP*CP*G)[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(2) 2JXQ|A, 2JXS|A
648NR_all_31273.1
Exact match
Saccharomyces cerevisiae
1LPW|B (1LPW)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*AP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
10(1) 1LPW|B
649NR_all_31275.1
Exact match
3EQT|C (1DI2)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.9 Å10(10) 1DI2|C, 1G3A|A, 1PBM|A, 1RC7|B, 3ADL|B, 3EQT|C, 3JXQ|A, 3JXR|A, 3LRN|C, 3OG8|C
650NR_all_37357.1
Exact match
1G2E|B (1G2E)
  • 5'-R(P*UP*AP*UP*UP*UP*AP*UP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å10(1) 1G2E|B
651NR_all_38568.1
Exact match
1A34|B (1A34)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.8 Å10(1) 1A34|B
652NR_all_39952.1
Exact match
3ADI|D (3ADI)
  • RNA (5'-R(P*CP*UP*CP*GP*AP*UP*AP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.2 Å10(1) 3ADI|D
653NR_all_49971.1
Exact match
2V6W|A (1R9S)
  • RNA strand, 5'-R(*AP*UP*CP*GP*AP*GP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
4.3 Å10(19) 1R9S|R, 1R9T|R, 1SFO|R, 2E2H|R, 2E2I|R, 2E2J|R, 2KYE|A, 2NVQ|R, 2NVX|R, 2NVZ|R, 2V6W|A, 2YU9|R, 3GTG|R, 3GTJ|R, 3GTL|R, 3GTM|M, 3GTO|R, 3GTP|R, 3GTQ|R
654NR_all_66842.1
New id, 1 parent
3NJ7|A (3NJ7)
  • 5'-R(*GP*GP*CP*AP*GP*CP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å10(1) 3NJ7|A
655NR_all_72992.1
Exact match
1DQH|B (1DQF)
  • RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.2 Å10(2) 1DQF|B, 1DQH|B
656NR_all_82946.1
Exact match
1F5G|A (1F5G)
  • 5'-R(*GP*CP*AP*GP*GP*CP*GP*UP*GP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(2) 1F5G|A, 1F5H|A
657NR_all_84180.1
Exact match
2DD2|A (2DD2)
  • 5'-R(*GP*GP*UP*GP*AP*AP*GP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(1) 2DD2|A
658NR_all_91589.1
Exact match
1YVP|C (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å10(1) 1YVP|C
659NR_all_95402.1
Exact match
1IDV|A (1IDV)
  • HEPATITIS C IRES RNA DOMAIN IIIC
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(1) 1IDV|A
660NR_all_00212.1
Exact match
438D|A (438D)
  • RNA (5'-R(*GP*GP*GP*CP*GP*CP*UP*CP*C)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å9(1) 438D|A
661NR_all_02216.1
Exact match
1MV2|A (1MV2)
  • 5'-R(*GP*GP*CP*AP*(P5P)P*GP*CP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1MV2|A
662NR_all_04668.1
Exact match
2IRO|A (2IRO)
  • 5'-R(P*GP*CP*GP*GP*AP*UP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2IRO|A
663NR_all_12770.1
Exact match
1MV6|A (1MV6)
  • 5'-R(*GP*GP*CP*(P5P)P*(P5P)P*GP*CP*CP*U)[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1MV6|A
664NR_all_14965.1
Exact match
1C4L|A (1C4L)
  • RNA (5'-R(*CP*GP*AP*CP*UP*CP*AP*GP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1C4L|A
665NR_all_19161.1
Exact match
2L8U|A (2L8U)
  • RNA (5'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2L8U|A
666NR_all_21928.1
Exact match
1MV1|A (1MV1)
  • 5'-R(*GP*GP*CP*(P5P)P*AP*GP*CP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1MV1|A
667NR_all_31302.1
Exact match
2K41|A (2K41)
  • RNA_(5'-R(*GP*UP*CP*GP*UP*GP*CP*UP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2K41|A
668NR_all_37243.1
Exact match
2K3Z|A (2K3Z)
  • RNA_(5'-R(*GP*UP*CP*GP*AP*GP*CP*UP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2K3Z|A
669NR_all_44202.1
Exact match
1FXL|B (1FXL)
  • 5'-R(P*UP*UP*UP*UP*AP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.8 Å9(1) 1FXL|B
670NR_all_46336.1
Exact match
3BSN|T (3BSN)
  • RNA (5'-R(*UP*GP*CP*CP*CP*GP*GP*GP*(N5M)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
1.8 Å9(1) 3BSN|T
671NR_all_48586.1
Exact match
2G91|A (2G91)
  • 5'-R(*GP*GP*UP*GP*CP*GP*CP*(CBR)P*C-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.5 Å9(1) 2G91|A
672NR_all_55497.1
Exact match
1J9H|A (1J9H)
  • 5'-R(*GP*UP*GP*UP*CP*GP*(CBR)P*AP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å9(1) 1J9H|A
673NR_all_60970.1
Exact match
165D|A (165D)
  • DNA/RNA (5'-R(*GP*CP*UP*UP*CP*GP*GP*CP*)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å9(1) 165D|A
674NR_all_61207.1
Exact match
2L8W|A (2L8C)
  • RNA (5'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(2) 2L8C|A, 2L8W|A
675NR_all_62131.1
Exact match
1ZH5|C (1YTY)
  • 5'-R(*UP*GP*CP*UP*GP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.3 Å9(2) 1YTY|C, 1ZH5|C
676NR_all_62306.1
New id, no parents
1SI3|B (1SI3)
  • 5'-R(*CP*GP*UP*GP*AP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.6 Å9(1) 1SI3|B
677NR_all_75988.1
Exact match
2KY2|A (2KY2)
  • 5'-R(*GP*GP*UP*AP*GP*GP*CP*CP*A)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2KY2|A
678NR_all_79050.1
Exact match
3BSO|T (3BSO)
  • RNA (5'-R(P*UP*GP*CP*CP*CP*GP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
1.7 Å9(3) 3BSO|T, 3H5X|T, 3H5Y|T
679NR_all_79529.1
Exact match
2IRN|A (2IRN)
  • 5'-R(P*GP*CP*UP*GP*AP*GP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2IRN|A
680NR_all_79635.1
Exact match
1MUV|A (1MUV)
  • 5'-R(*GP*GP*CP*AP*AP*GP*CP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1MUV|A
681NR_all_95158.1
Exact match
1JZV|B (1JZV)
  • 5'-R(*CP*AP*GP*UP*AP*CP*GP*(5IC)P*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.7 Å9(1) 1JZV|B
682NR_all_96906.1
Exact match
2H49|A (2H49)
  • 5'-R(*GP*GP*CP*UP*AP*AP*GP*AP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2H49|A
683NR_all_10280.1
Exact match
2OJ7|A (2OJ7)
  • 5'-R(P*GP*CP*UP*GP*UP*UP*GP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 2OJ7|A
684NR_all_19448.1
Exact match
2OJ8|A (2OJ8)
  • 5'-R(P*GP*CP*UP*GP*UP*UP*GP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 2OJ8|A
685NR_all_20052.2
Updated, 1 parent
3L26|C (333D)
  • RNA (5'-R(*CP*GP*CP*AP*IP*GP*CP*G)-3'), [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å8(2) 333D|A, 3L26|C
686NR_all_23344.1
Exact match
402D|A (402D)
  • RNA(5'-R(*CP*GP*CP*CP*AP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å8(1) 402D|A
687NR_all_24689.1
Exact match
2BGG|P (2BGG)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
2.2 Å8(1) 2BGG|P
688NR_all_31563.1
New id, 1 parent
1G2J|A (1G2J)
  • 5'-R(*CP*CP*CP*(PYY)P*GP*GP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å8(1) 1G2J|A
689NR_all_32282.1
Exact match
2KD4|A (2KD4)
  • 5'-R(*GP*CP*CP*GP*CP*GP*GP*C)-2'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 2KD4|A
690NR_all_32325.2
Updated, 1 parent
435D|A (1RXB)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*GP*G)-3'), [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å8(8) 1RXB|A, 259D|A, 2FZ2|D, 2WJ8|a, 2XPJ|D, 3M7N|X, 3M85|X, 435D|A
691NR_all_33185.1
Exact match
Hepatitis B virus
2IXZ|A (2IXZ)
  • 5'-R(*GP*CP*UP*GP*UP*GP*CP*CP)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 2IXZ|A
692NR_all_39230.1
Exact match
1MIS|A (1MIS)
  • RNA (5'-R(*GP*CP*GP*GP*AP*CP*GP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1MIS|A
693NR_all_41515.1
Exact match
1YFV|A (1SA9)
  • 5'-R(*GP*GP*CP*GP*AP*GP*CP*C)-3', RNA (5[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å8(2) 1SA9|A, 1YFV|A
694NR_all_44995.1
Exact match
1MWG|A (1MWG)
  • RNA (5'-R(*GP*GP*CP*AP*GP*GP*CP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1MWG|A
695NR_all_47489.1
Exact match
472D|A (472D)
  • RNA (5'-R(*GP*UP*GP*UP*UP*UP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å8(1) 472D|A
696NR_all_48227.1
Exact match
398D|A (398D)
  • RNA (5'-R(*GP*CP*AP*GP*UP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å8(1) 398D|A
697NR_all_49403.1
New id, 1 parent
3L25|C (3L25)
  • RNA (5'-R(*CP*GP*CP*AP*UP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.0 Å8(1) 3L25|C
698NR_all_50302.1
Exact match
2G3S|A (1EKD)
  • RNA (5'-R(*GP*GP*CP*GP*UP*GP*CP*C)-3'), [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(2) 1EKD|A, 2G3S|A
699NR_all_51422.1
Exact match
2A0P|A (2A0P)
  • 5'-R(*CP*CP*(S4C)P*CP*GP*GP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å8(1) 2A0P|A
700NR_all_51786.1
New id, 1 parent
1RXA|A (1RXA)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å8(1) 1RXA|A
701NR_all_53000.1
Exact match
439D|A (439D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å8(1) 439D|A
702NR_all_54704.1
Exact match
1EKA|A (1EKA)
  • RNA (5'-R(*GP*AP*GP*UP*GP*CP*UP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1EKA|A
703NR_all_70110.1
Exact match
1BYX|A (1BYX)
  • RNA (5'-R(*GP*CP*AP*GP*UP*GP*GP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1BYX|A
704NR_all_72863.1
Exact match
3GLP|A (3GLP)
  • 5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å8(1) 3GLP|A
705NR_all_73144.1
Exact match
1QET|A (1QET)
  • RNA (5'-R(*GP*GP*AP*UP*GP*UP*CP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1QET|A
706NR_all_76080.1
Exact match
409D|A (409D)
  • RNA (5'-R(*CP*CP*CP*IP*UP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å8(1) 409D|A
707NR_all_84410.1
Exact match
Thermus thermophilus
2GQ6|K (2G32)
  • RNA (5'-R(*(0C)P*(0U)P*(0G)P*(0G)P*(0G)P[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): K
1.3 Å8(6) 2G32|K, 2GPM|K, 2GQ4|K, 2GQ5|K, 2GQ6|K, 2GQ7|K
708NR_all_89315.1
Exact match
1SAQ|A (1SAQ)
  • 5'-R(*GP*IP*CP*GP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.7 Å8(1) 1SAQ|A
709NR_all_95624.1
Exact match
1ZDJ|R (1ZDJ)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å8(1) 1ZDJ|R
710NR_all_12128.1
Exact match
466D|A (434D)
  • RNA (5'-R(*UP*AP*GP*CP*UP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å7(3) 434D|A, 464D|A, 466D|A
711NR_all_17142.1
Exact match
Homo sapiens
2V7R|A (2V7R)
  • HUMAN TRNAGLY MICROHELIX
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å7(1) 2V7R|A
712NR_all_25589.1
Exact match
Escherichia coli
2VAL|A (2VAL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å7(1) 2VAL|A
713NR_all_49342.1
Exact match
3GVN|A (3GVN)
  • 5'-R(*GP*GP*UP*GP*AP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å7(1) 3GVN|A
714NR_all_72153.1
Exact match
1L3Z|A (1L3Z)
  • 5'-R(*GP*UP*AP*UP*AP*CP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å7(1) 1L3Z|A
715NR_all_83028.1
Exact match
2ERR|B (2ERR)
  • UGCAUGU
  • SOLUTION NMR
  • Chain(s): ; model(s): B
7(1) 2ERR|B
716NR_all_01174.1
New id, no parents
1MDG|A (1MDG)
  • 5'-R(*UP*(BGM)GP*AP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.5 Å6(1) 1MDG|A
717NR_all_05369.1
Exact match
2GXB|E (1T4X)
  • RNA (5'-R(*CP*GP*CP*GP*CP*G)-3'), 5'-R(P[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): E
6(2) 1T4X|A, 2GXB|E
718NR_all_23219.1
Exact match
3MDI|C (3MDI)
  • RNA (5'-R(*UP*GP*UP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.1 Å6(1) 3MDI|C
719NR_all_23753.1
Exact match
3MDG|C (3MDG)
  • RNA (5'-R(*UP*UP*GP*UP*AP*U)-3'), RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å6(2) 3MDG|C, 3Q2T|E
720NR_all_25139.1
Exact match
3G9Y|C (3G9Y)
  • RNA (5'-R(*AP*GP*GP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.4 Å6(1) 3G9Y|C
721NR_all_26991.1
Exact match
2GRB|A (2GRB)
  • 5'-R(*(U33)P*GP*IP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å6(1) 2GRB|A
722NR_all_33539.1
Exact match
1YTU|C (1YTU)
  • 5'-R(P*AP*GP*AP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å6(1) 1YTU|C
723NR_all_39956.1
New id, no parents
3HGA|X (3HGA)
  • 5'-R(*UP*(US5)P*CP*GP*CP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
1.3 Å6(1) 3HGA|X
724NR_all_49742.1
Exact match
1J8G|A (1J8G)
  • 5'-R(*UP*GP*GP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
0.6 Å6(1) 1J8G|A
725NR_all_52336.1
Exact match
2AD9|B (2AD9)
  • 5'-R(*CP*UP*CP*UP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2AD9|B
726NR_all_53425.1
Exact match
1N35|C (1N1H)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3', 5'-R(*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å6(3) 1N1H|B, 1N35|C, 1UON|C
727NR_all_67157.1
Exact match
1I9K|A (1I9K)
  • 5'-R(*UP*CP*CP*CP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
6(1) 1I9K|A
728NR_all_74832.1
Exact match
2ADC|B (2ADC)
  • 5'-R(*CP*UP*CP*UP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2ADC|B
729NR_all_77304.1
Exact match
1N38|C (1N38)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å6(1) 1N38|C
730NR_all_83414.1
Exact match
2AWE|A (2AWE)
  • 5'-R(*UP*(BGM)P*GP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å6(1) 2AWE|A
731NR_all_85202.1
Exact match
377D|A (377D)
  • RNA-DNA (5'-R(*CP*GP*UP*AP*CP*DG)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å6(1) 377D|A
732NR_all_85835.1
New id, no parents
1OSU|A (1OSU)
  • RNA (5'-R(*UP*UP*CP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å6(1) 1OSU|A
733NR_all_92374.1
New id, no parents
1P79|A (1P79)
  • 5'-R(*UP*GP*UP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.1 Å6(1) 1P79|A
734NR_all_98798.1
Exact match
1QES|A (176D)
  • DNA (5'-D(*GPN*APN*APN*CPN*TPN*CPN)-3'),[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
6(2) 176D|A, 1QES|A