A PHP Error was encountered

Severity: Warning

Message: session_start(): Cannot send session cookie - headers already sent by (output started at /var/www/rna3dhub/system/core/Exceptions.php:170)

Filename: views/menu_view.php

Line Number: 3

A PHP Error was encountered

Severity: Warning

Message: session_start(): Cannot send session cache limiter - headers already sent (output started at /var/www/rna3dhub/system/core/Exceptions.php:170)

Filename: views/menu_view.php

Line Number: 3

Exact match 1123; New id, no parents 1;

#Equivalence classRepresentativeResolutionNtsClass members
1NR_all_28742.1
Exact match
3IZF|A (3IZF)
  • 25S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
3396(1) 3IZF|A
2NR_all_34490.1
Exact match
3U5H|5 (3O58)
  • 25S ribosomal RNA, 25S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 5
3396(4) 3O58|1, 3O5H|1, 3U5D|1, 3U5H|5
3NR_all_15777.1
Exact match
4A1B|1 (4A18)
  • 26S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 1
3354(4) 4A18|1, 4A19|1, 4A1B|1, 4A1D|1
4NR_all_74702.1
Exact match
3JYX|5 (3JYX)
  • 26S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): 5
3170(1) 3JYX|5
5NR_all_17462.1
Exact match
1S1I|3 (1S1I)
  • 5.8S/25S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): 3
2999(1) 1S1I|3
6NR_all_00542.2
Exact match
Haloarcula marismortui
1S72|0 (1FFK)
  • 23S RRNA, 23S RIBOSOMAL RNA, 50S RIBOSOM[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 0
2.4 Å2922(68) 1FFK|0, 1FFZ|A, 1FG0|A, 1JJ2|0, 1K73|A, 1K8A|A, 1K9M|A, 1KC8|A, 1KD1|A, 1KQS|0, 1M1K|A, 1M90|A, 1N8R|A, 1NJI|A, 1Q7Y|A, 1Q81|A, 1Q82|A, 1Q86|A, 1QVF|0, 1QVG|0, 1S72|0, 1VQ4|0, 1VQ5|0, 1VQ6|0, 1VQ7|0, 1VQ8|0, 1VQ9|0, 1VQK|0, 1VQL|0, 1VQM|0, 1VQN|0, 1VQO|0, 1VQP|0, 1W2B|0, 1YHQ|0, 1YI2|0, 1YIJ|0, 1YIT|0, 1YJ9|0, 1YJN|0, 1YJW|0, 2OTJ|0, 2OTL|0, 2QA4|0, 2QEX|0, 3CC2|0, 3CC4|0, 3CC7|0, 3CCE|0, 3CCJ|0, 3CCL|0, 3CCM|0, 3CCQ|0, 3CCR|0, 3CCS|0, 3CCU|0, 3CCV|0, 3CD6|0, 3CMA|0, 3CME|0, 3CPW|0, 3CXC|0, 3G4S|0, 3G6E|0, 3G71|0, 3I55|0, 3I56|0, 3OW2|0
7NR_all_01824.1
Exact match
Escherichia coli
1C2W|B (1C2W)
  • 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): B
7.5 Å2904(1) 1C2W|B
8NR_all_15566.7
Exact match
2QBG|B (1VS6)
  • 23S RIBOSOMAL RNA, 23S rRNA, 50S ribosom[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2904(63) 1VS6|B, 1VS8|B, 1VT2|A, 2AW4|B, 2AWB|B, 2GYA|0, 2GYC|0, 2I2T|B, 2I2V|B, 2J28|B, 2QAM|B, 2QAO|B, 2QBA|B, 2QBC|B, 2QBE|B, 2QBG|B, 2QBI|B, 2QBK|B, 2QOV|B, 2QOX|B, 2QOZ|B, 2QP1|B, 2VHM|B, 2VHN|B, 2WWQ|B, 2Z4L|B, 2Z4N|B, 3BBX|B, 3DF2|B, 3DF4|B, 3E1B|B, 3E1D|B, 3FIK|B, 3I1N|A, 3I1P|A, 3I1R|A, 3I1T|A, 3I20|A, 3I22|A, 3IZT|B, 3IZU|B, 3J01|8, 3J0T|B, 3J0W|B, 3J0Y|B, 3J11|B, 3J12|B, 3J14|B, 3J19|A, 3KCR|8, 3OAS|A, 3OAT|A, 3OFC|A, 3OFD|A, 3OFQ|A, 3OFR|A, 3OFZ|A, 3OG0|A, 3ORB|A, 3R8S|A, 3R8T|A, 3SGF|A, 3UOS|A
9NR_all_86444.8
Exact match
3V2F|A (1VSA)
  • 23S LARGE SUBUNIT RIBOSOMAL RNA, 23S rib[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2889(95) 1VSA|w, 1VSP|w, 1YL3|A, 2B66|A, 2B9N|A, 2B9P|A, 2HGJ|A, 2HGQ|A, 2HGU|A, 2J01|A, 2J03|A, 2V47|A, 2V49|A, 2WDI|A, 2WDJ|A, 2WDL|A, 2WDN|A, 2WH2|A, 2WH4|A, 2WRJ|A, 2WRL|A, 2WRO|A, 2WRR|A, 2X9S|A, 2X9U|A, 2XG0|A, 2XG2|A, 2XQE|A, 2XTG|A, 2XUX|A, 2Y0V|A, 2Y0X|A, 2Y0Z|A, 2Y11|A, 2Y13|A, 2Y15|A, 2Y17|A, 2Y19|A, 3D5B|A, 3D5D|A, 3F1F|A, 3F1H|A, 3FIN|A, 3HUX|A, 3HUZ|A, 3I8F|A, 3I8I|A, 3I9C|A, 3I9E|A, 3KIR|A, 3KIT|A, 3KIW|A, 3KIY|A, 3KNI|A, 3KNK|A, 3KNM|A, 3KNO|A, 3MRZ|A, 3MS1|A, 3OH5|A, 3OH7|A, 3OHJ|A, 3OHK|A, 3OHZ|A, 3OI1|A, 3OI3|A, 3OI5|A, 3PYO|A, 3PYR|A, 3PYT|A, 3PYV|A, 3TVE|A, 3TVH|A, 3UXQ|A, 3UXR|A, 3UYE|A, 3UYG|A, 3UZ1|A, 3UZ2|A, 3UZ8|A, 3UZ9|A, 3UZF|A, 3UZH|A, 3UZK|A, 3UZN|A, 3V23|A, 3V25|A, 3V27|A, 3V29|A, 3V2D|A, 3V2F|A, 3ZVP|A, 4ABS|A, 4DHA|A, 4DHC|A
10NR_all_41181.1
Exact match
1PNU|0 (1PNU)
  • 23S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 0
2887(7) 1PNU|0, 1PNY|0, 1VOR|B, 1VOU|B, 1VOW|B, 1VOY|B, 1VP0|B
11NR_all_38396.2
Exact match
Deinococcus radiodurans
2ZJR|X (1J5A)
  • 23S RRNA, 23S ribosomal RNA, 23S RIBOSOM[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
3.5 Å2880(35) 1J5A|A, 1JZX|A, 1JZY|A, 1JZZ|A, 1K01|A, 1NJM|0, 1NJN|0, 1NJO|0, 1NJP|0, 1NKW|0, 1NWX|0, 1NWY|0, 1OND|0, 1P9X|0, 1SM1|0, 1XBP|0, 1Y69|0, 1Z58|2, 2AAR|0, 2D3O|0, 2O43|A, 2O44|A, 2O45|A, 2OGM|0, 2OGN|0, 2OGO|0, 2ZJP|X, 2ZJQ|X, 2ZJR|X, 3CF5|X, 3DLL|X, 3FWO|A, 3JQ4|A, 3PIO|X, 3PIP|X
12NR_all_74831.1
Exact match
3BBO|A (3BBO)
  • 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
2810(1) 3BBO|A
13NR_all_00499.1
Exact match
3U5F|6 (3IZE)
  • 18S rRNA, 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): 6
1800(5) 3IZE|A, 3O2Z|1, 3O30|1, 3U5B|2, 3U5F|6
14NR_all_41724.1
Exact match
3JYV|A (3JYV)
  • 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
1761(1) 3JYV|A
15NR_all_53536.1
Exact match
2XZM|A (2XZM)
  • 18S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1753(2) 2XZM|A, 2XZN|A
16NR_all_70824.10
Exact match
2AW7|A (1VS5)
  • 16S RIBOSOMAL RNA, 16S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1542(62) 1VS5|A, 1VS7|A, 2AVY|A, 2AW7|A, 2GY9|A, 2GYB|A, 2I2P|A, 2I2U|A, 2QAL|A, 2QAN|A, 2QB9|A, 2QBB|A, 2QBD|A, 2QBF|A, 2QBH|A, 2QBJ|A, 2QOU|A, 2QOW|A, 2QOY|A, 2QP0|A, 2VHO|A, 2VHP|A, 2WWL|A, 2YKR|A, 2Z4K|A, 2Z4M|A, 3DF1|A, 3DF3|A, 3E1A|1, 3E1C|1, 3FIH|A, 3I1M|A, 3I1O|A, 3I1Q|A, 3I1S|A, 3I1Z|A, 3I21|A, 3IZV|A, 3IZW|A, 3J00|A, 3J0U|A, 3J0V|A, 3J0X|A, 3J0Z|A, 3J10|A, 3J13|A, 3J18|A, 3KC4|A, 3OAQ|A, 3OAR|A, 3OFA|A, 3OFB|A, 3OFO|A, 3OFP|A, 3OFX|A, 3OFY|A, 3OR9|A, 3ORA|A, 3SFS|A, 3UOQ|A, 4A2I|A, 4ADV|A
17NR_all_30193.1
Exact match
1PNX|A (1PNS)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1527(7) 1PNS|A, 1PNX|A, 1VOQ|A, 1VOS|A, 1VOV|A, 1VOX|A, 1VOZ|A
18NR_all_41791.1
Exact match
1GIX|A (1GIX)
  • 30S 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1522(4) 1GIX|A, 1JGO|A, 1JGP|A, 1JGQ|A
19NR_all_42982.9
Exact match
Thermus thermophilus
1FJG|A (1FJG)
  • 16S RIBOSOMAL RNA, 16S RRNA, 16S SMALL S[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å1522(133) 1FJG|A, 1FKA|A, 1HNW|A, 1HNX|A, 1HNZ|A, 1HR0|A, 1I94|A, 1I95|A, 1I96|A, 1I97|A, 1IBK|A, 1IBL|A, 1IBM|A, 1J5E|A, 1N32|A, 1N33|A, 1N34|A, 1N36|A, 1XMO|A, 1XMQ|A, 1XNQ|A, 1XNR|A, 1YL4|A, 2B64|A, 2B9M|A, 2B9O|A, 2E5L|A, 2F4V|A, 2HGI|A, 2HGP|A, 2HGR|A, 2HHH|A, 2J00|A, 2J02|A, 2OW8|y, 2QNH|y, 2UU9|A, 2UUA|A, 2UUB|A, 2UUC|A, 2UXB|A, 2UXC|A, 2UXD|A, 2V46|A, 2V48|A, 2VQE|A, 2VQF|A, 2WDG|A, 2WDH|A, 2WDK|A, 2WDM|A, 2WH1|A, 2WH3|A, 2WRI|A, 2WRK|A, 2WRN|A, 2WRQ|A, 2X9R|A, 2X9T|A, 2XFZ|A, 2XG1|A, 2XQD|A, 2XSY|A, 2XUY|A, 2Y0U|A, 2Y0W|A, 2Y0Y|A, 2Y10|A, 2Y12|A, 2Y14|A, 2Y16|A, 2Y18|A, 2ZM6|A, 3D5A|A, 3D5C|A, 3F1E|A, 3F1G|A, 3FIC|A, 3HUW|A, 3HUY|A, 3I8G|A, 3I8H|A, 3I9B|A, 3I9D|A, 3KIQ|a, 3KIS|a, 3KIU|a, 3KIX|a, 3KNH|A, 3KNJ|A, 3KNL|A, 3KNN|A, 3MR8|A, 3MS0|A, 3OGE|A, 3OGY|A, 3OHC|A, 3OHD|A, 3OHY|A, 3OI0|A, 3OI2|A, 3OI4|A, 3OTO|A, 3PYN|A, 3PYQ|A, 3PYS|A, 3PYU|A, 3T1H|A, 3T1Y|A, 3TVF|A, 3TVG|A, 3UXS|A, 3UXT|A, 3UYD|A, 3UYF|A, 3UZ3|A, 3UZ4|A, 3UZ6|A, 3UZ7|A, 3UZG|A, 3UZI|A, 3UZL|A, 3UZM|A, 3V22|A, 3V24|A, 3V26|A, 3V28|A, 3V2C|A, 3V2E|A, 3ZVO|A, 4ABR|A, 4DH9|A, 4DHB|A
20NR_all_63739.1
Exact match
1S1H|A (1S1H)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
1507(1) 1S1H|A
21NR_all_68162.1
Exact match
3BBN|A (3BBN)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
1491(1) 3BBN|A
22NR_all_09024.1
Exact match
2A64|A (2A64)
  • ribonuclease P RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.3 Å417(1) 2A64|A
23NR_all_09073.3
Exact match
3G78|A (3BWP)
  • Group IIC intron, Group II intron, Mutan[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å412(6) 3BWP|A, 3EOG|A, 3EOH|A, 3G78|A, 3IGI|A, 4DS6|A
24NR_all_48207.1
Exact match
Bluetongue virus
1H1K|I (1H1K)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): I
10.0 Å412(1) 1H1K|I
25NR_all_43849.1
Exact match
Escherichia coli
3IZ4|A (3IZ4)
  • Modified E. coli transfer-messenger RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
13.6 Å377(1) 3IZ4|A
26NR_all_05704.1
Exact match
Thermus thermophilus
3IYR|A (3IYR)
  • tmRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
13.0 Å349(1) 3IYR|A
27NR_all_71075.1
Exact match
Thermus thermophilus
3IYQ|A (3IYQ)
  • tmRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
13.0 Å349(1) 3IYQ|A
28NR_all_54986.2
Exact match
3Q1Q|B (2A2E)
  • RNA subunit of RNase P, RNase P RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.9 Å338(3) 2A2E|A, 3Q1Q|B, 3Q1R|B
29NR_all_87213.1
Exact match
Thermus thermophilus
2OM7|D (2OM7)
  • 16S ribosomal RNA (H5)
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): D
7.3 Å303(1) 2OM7|D
30NR_all_64531.1
Exact match
Haloarcula marismortui
2J37|Z (2J37)
  • RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): Z
8.7 Å280(1) 2J37|Z
31NR_all_06533.1
Exact match
3DHS|A (3DHS)
  • RNase P RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.6 Å268(1) 3DHS|A
32NR_all_94796.1
Exact match
Tetrahymena thermophila
1X8W|A (1GRZ)
  • LSU R-RNA GROUP I INTRON, Tetrahymena ri[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
5.0 Å247(2) 1GRZ|A, 1X8W|A
33NR_all_31636.1
Exact match
Staphylococcus phage Twort
2RKJ|C (2RKJ)
  • RNA (238-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
4.5 Å246(1) 2RKJ|C
34NR_all_22091.1
Exact match
Saccharomyces cerevisiae
3J16|J (3J16)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): J
7.2 Å233(1) 3J16|J
35NR_all_17528.1
Exact match
Staphylococcus phage Twort
1Y0Q|A (1Y0Q)
  • Group I ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.6 Å229(1) 1Y0Q|A
36NR_all_03131.1
Exact match
1U6B|B (1U6B)
  • 197-MER, Group I intron P9, Group I intr[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.1 Å197(6) 1U6B|B, 1ZZN|B, 3BO2|B, 3BO3|B, 3BO4|B, 3IIN|B
37NR_all_49538.1
Exact match
2NOQ|A (2NOQ)
  • CrPV IRES
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
7.3 Å190(1) 2NOQ|A
38NR_all_38220.1
Exact match
3DIR|A (3DIG)
  • RNA (174-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å174(12) 3DIG|X, 3DIL|A, 3DIM|A, 3DIO|X, 3DIQ|A, 3DIR|A, 3DIS|A, 3DIX|A, 3DIY|A, 3DIZ|A, 3DJ0|A, 3DJ2|A
39NR_all_51418.1
Exact match
Fusobacterium nucleatum
3P49|A (3P49)
  • GLYCINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.6 Å169(1) 3P49|A
40NR_all_23832.1
Exact match
3D0U|A (3D0U)
  • Lysine Riboswitch RNA, RNA (161-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å161(2) 3D0U|A, 3D0X|A
41NR_all_81135.1
Exact match
1U9S|A (1U9S)
  • RIBONUCLEASE P
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å161(1) 1U9S|A
42NR_all_91098.1
Exact match
2QBZ|X (2QBZ)
  • M-Box RNA, ykoK riboswitch aptamer, M-bo[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.6 Å161(2) 2QBZ|X, 3PDR|A
43NR_all_56915.1
Exact match
synthetic construct
1GID|A (1GID)
  • P4-P6 RNA RIBOZYME DOMAIN, P4-P6 DELC209[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å158(4) 1GID|A, 1HR2|A, 1L8V|A, 2R8S|R
44NR_all_47873.1
Exact match
Bacillus subtilis
1NBS|A (1NBS)
  • RIBONUCLEASE P RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.2 Å155(1) 1NBS|A
45NR_all_54637.1
Exact match
4A1C|2 (4A17)
  • 5.8S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 2
154(4) 4A17|2, 4A1A|2, 4A1C|2, 4A1E|2
46NR_all_68124.1
Exact match
Saccharomyces cerevisiae
3IZD|A (3IZD)
  • rRNA expansion segment ES27L in an 'out'[...]
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
8.6 Å151(1) 3IZD|A
47NR_all_41615.1
Exact match
2IL9|A (2IL9)
  • Ribosomal Binding Domain of the IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å142(1) 2IL9|A
48NR_all_21935.1
Exact match
2NZ4|P (2NZ4)
  • GlmS ribozyme, glmS glucosamine-6-phosph[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
2.5 Å141(6) 2NZ4|P, 3G8S|P, 3G8T|P, 3G96|P, 3G9C|P, 3L3C|P
49NR_all_31528.1
Exact match
3IVK|C (3HHN)
  • Class I ligase ribozyme, self-ligation p[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å137(4) 3HHN|C, 3IVK|C, 3R1H|C, 3R1L|C
50NR_all_07735.2
Exact match
1MFQ|A (1L9A)
  • signal recognition particle RNA S domain[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å128(5) 1L9A|B, 1MFQ|A, 1RY1|A, 2GO5|A, 3KTV|A
51NR_all_40253.1
Exact match
Caldanaerobacter subterraneus
3V7E|C (3V7E)
  • SAM-I riboswitch aptamer with an enginee[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å126(1) 3V7E|C
52NR_all_73572.1
Exact match
2HO7|B (2GCS)
  • glmS ribozyme RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.1 Å125(13) 2GCS|B, 2GCV|B, 2H0S|B, 2H0W|B, 2H0X|B, 2H0Z|B, 2HO6|B, 2HO7|B, 2Z74|B, 2Z75|B, 3B4A|B, 3B4B|B, 3B4C|B
53NR_all_00120.1
Exact match
Escherichia coli
1C2X|C (1C2X)
  • 5S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): C
7.5 Å120(1) 1C2X|C
54NR_all_66389.1
Exact match
Bacillus phage phi29
1FOQ|A (1FOQ)
  • BACTERIOPHAGE PHI29 PROHEAD RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
120(1) 1FOQ|A
55NR_all_25858.1
Exact match
Escherichia coli
3IZZ|B (3IZZ)
  • Helix 69, 71, 89, 92, 95 (Large Subunit)
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): B
10.8 Å118(1) 3IZZ|B
56NR_all_46481.1
Exact match
Oryctolagus cuniculus
3J0Q|2 (3J0L)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): 2
9.8 Å112(4) 3J0L|2, 3J0O|2, 3J0P|2, 3J0Q|2
57NR_all_52507.1
Exact match
Saccharomyces cerevisiae
2LKR|A (2LKR)
  • RNA (111-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
111(1) 2LKR|A
58NR_all_00293.1
Exact match
Deinococcus radiodurans
2XXA|F (2XXA)
  • 4.5S RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): F
3.9 Å106(1) 2XXA|F
59NR_all_53654.1
Exact match
Turnip crinkle virus
2KRL|A (2KRL)
  • RNA (102-MER)
  • SOLUTION SCATTERING, SOLUTION NMR
  • Chain(s): ; model(s): A
102(1) 2KRL|A
60NR_all_20407.1
Exact match
1S9S|A (1S9S)
  • MLV Psi encapsidation site
  • SOLUTION NMR
  • Chain(s): ; model(s): A
101(1) 1S9S|A
61NR_all_51680.1
Exact match
[Eubacterium] siraeum
3SUX|X (3SUH)
  • Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.7 Å101(3) 3SUH|X, 3SUX|X, 3SUY|X
62NR_all_62949.1
Exact match
1YSH|B (1YSH)
  • RNA (101-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): B
9.5 Å101(1) 1YSH|B
63NR_all_89550.1
Exact match
1U6P|B (1U6P)
  • 101-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): B
101(1) 1U6P|B
64NR_all_77022.1
Exact match
2GTT|W (2GTT)
  • RNA (99-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): W
3.5 Å99(1) 2GTT|W
65NR_all_45604.2
Exact match
Methanocaldococcus jannaschii
1LNG|B (1LNG)
  • 7S.S SRP RNA, RNA (101-MER), 7S RNA, SRP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å97(4) 1LNG|B, 1Z43|A, 2V3C|M, 3NDB|M
66NR_all_48559.1
Exact match
Sulfolobus solfataricus
3KTW|C (3KTW)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.2 Å96(1) 3KTW|C
67NR_all_47823.1
Exact match
Caldanaerobacter subterraneus
4AOB|A (4AOB)
  • SAM-I RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å94(1) 4AOB|A
68NR_all_54685.1
Exact match
Thermus thermophilus
1SER|T (1SER)
  • TRNASER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
2.9 Å94(1) 1SER|T
69NR_all_76064.2
Exact match
3GX5|A (2GIS)
  • SAM-I riboswitch, RNA (94-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å94(10) 2GIS|A, 2YDH|A, 3GX2|A, 3GX3|A, 3GX5|A, 3GX6|A, 3GX7|A, 3IQN|A, 3IQP|A, 3IQR|A
70NR_all_44112.1
Exact match
3IWN|A (3IWN)
  • C-di-GMP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.2 Å93(1) 3IWN|A
71NR_all_40755.1
Exact match
Methanopyrus kandleri
3ADC|C (3ADC)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å92(1) 3ADC|C
72NR_all_78938.1
Exact match
3CUN|C (3CUL)
  • RNA (92-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å92(2) 3CUL|C, 3CUN|C
73NR_all_83537.1
Exact match
1M5O|B (1M5K)
  • RNA HAIRPIN RIBOZYME
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.4 Å92(4) 1M5K|B, 1M5O|B, 1M5P|B, 1M5V|B
74NR_all_85047.1
Exact match
Vibrio cholerae
3UCZ|R (3IRW)
  • c-di-GMP Riboswitch, G20A mutant c-di-GM[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.7 Å92(10) 3IRW|R, 3MUM|R, 3MUR|R, 3MUT|R, 3MUV|R, 3MXH|R, 3UCU|R, 3UCZ|R, 3UD3|R, 3UD4|R
75NR_all_96119.1
Exact match
Methanopyrus kandleri
3ADD|C (3ADB)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å92(2) 3ADB|C, 3ADD|C
76NR_all_99643.2
Exact match
Homo sapiens
3RG5|A (3A3A)
  • selenocysteine tRNA, tRNASec, tRNA(Sec)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å90(3) 3A3A|A, 3HL2|E, 3RG5|A
77NR_all_09277.1
Exact match
3SD3|A (3SD3)
  • Tetrahydrofolate riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å89(1) 3SD3|A
78NR_all_01495.1
Exact match
Vibrio cholerae
3OWZ|A (3OWI)
  • Domain II of glycine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å88(9) 3OWI|A, 3OWW|A, 3OWZ|A, 3OX0|A, 3OXB|A, 3OXD|A, 3OXE|A, 3OXJ|A, 3OXM|A
79NR_all_56214.1
Exact match
2ZZM|B (2ZZM)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.7 Å88(1) 2ZZM|B
80NR_all_62086.1
Exact match
1WZ2|C (1WZ2)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.2 Å88(1) 1WZ2|C
81NR_all_06781.1
Exact match
2NR0|E (2NR0)
  • leucyl tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.9 Å87(1) 2NR0|E
82NR_all_79796.1
Exact match
4AQ7|B (2NQP)
  • transfer RNA, E. COLI TRNALEU UAA ISOACC[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.5 Å87(5) 2NQP|F, 4AQ7|B, 4ARC|B, 4ARI|B, 4AS1|B
83NR_all_96321.1
Exact match
2NRE|F (2NRE)
  • leucyl tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): F
4.0 Å87(1) 2NRE|F
84NR_all_48708.1
Exact match
Thermus thermophilus
1H3E|B (1H3E)
  • WILD-TYPE TRNATYR(GUA)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.9 Å86(1) 1H3E|B
85NR_all_12005.1
Exact match
Thermus thermophilus
486D|F (486D)
  • PENULTIMATE STEM OF 16S RRNA IN THE 70S [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): F
7.5 Å85(1) 486D|F
86NR_all_29574.1
Exact match
Hepatitis C virus
3T4B|A (3T4B)
  • HCV IRES pseudoknot domain plus crystall[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.6 Å84(1) 3T4B|A
87NR_all_54178.1
Exact match
2HOJ|A (2HOJ)
  • thi-box riboswitch, RNA (87-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å83(7) 2HOJ|A, 2HOK|A, 2HOL|A, 2HOM|A, 2HOO|A, 2HOP|A, 3K0J|E
88NR_all_83623.1
Exact match
Thermus thermophilus
2BTE|B (2BTE)
  • TRNALEU TRANSCRIPT WITH ANTICODON CAG, T[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.9 Å83(3) 2BTE|B, 2BYT|B, 2V0G|B
89NR_all_45031.1
Exact match
3AM1|B (3AM1)
  • ASL-truncated tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.4 Å81(1) 3AM1|B
90NR_all_65213.1
Exact match
2GDI|X (2GDI)
  • TPP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.1 Å80(1) 2GDI|X
91NR_all_25651.1
Exact match
2FK6|R (2FK6)
  • TRNA(THR)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å79(1) 2FK6|R
92NR_all_31075.1
Exact match
2ZUF|B (2ZUE)
  • tRNA-Arg
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.0 Å78(2) 2ZUE|B, 2ZUF|B
93NR_all_43604.1
Exact match
Archaeoglobus fulgidus
3AMU|B (3AMT)
  • RNA (78-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.9 Å78(2) 3AMT|B, 3AMU|B
94NR_all_09325.1
Exact match
1J1U|B (1J1U)
  • tRNA(Tyr)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.0 Å77(1) 1J1U|B
95NR_all_14670.1
Exact match
3A2K|C (3A2K)
  • bacterial tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.7 Å77(1) 3A2K|C
96NR_all_14681.1
Exact match
Escherichia coli
3QSY|D (3QSY)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.2 Å77(1) 3QSY|D
97NR_all_17062.1
Exact match
Arabidopsis thaliana
3D2V|A (2CKY)
  • NUCLEIC ACID, TPP-specific riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å77(4) 2CKY|A, 3D2G|A, 3D2V|A, 3D2X|A
98NR_all_33296.1
Exact match
1J2B|C (1J2B)
  • tRNA(Val)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.3 Å77(1) 1J2B|C
99NR_all_34928.2
Exact match
3DEG|B (2FMT)
  • FORMYL-METHIONYL-TRNAFMET2, Initiator tR[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å77(5) 2FMT|C, 3CW5|A, 3CW6|A, 3DEG|B, 3V11|D
100NR_all_56218.1
Exact match
Escherichia coli
1EFW|C (1C0A)
  • ASPARTYL TRNA, ASPARTYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å77(2) 1C0A|B, 1EFW|C
101NR_all_77062.1
Exact match
1P5P|A (1P5O)
  • 77-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
77(2) 1P5O|A, 1P5P|A
102NR_all_86203.1
Exact match
Thermus thermophilus
1H4S|T (1H4Q)
  • TRNAPRO(CGG)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
3.0 Å77(2) 1H4Q|T, 1H4S|T
103NR_all_16200.1
Exact match
2DER|C (2DER)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.1 Å76(3) 2DER|C, 2DET|C, 2DEU|C
104NR_all_19264.1
Exact match
Escherichia coli
2K4C|A (2K4C)
  • 76-MER
  • SOLUTION NMR, SOLUTION SCATTERING
  • Chain(s): ; model(s): A
76(1) 2K4C|A
105NR_all_30095.1
Exact match
Bos taurus
3IZY|N (3IZY)
  • tRNA-Phe
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): N
10.8 Å76(1) 3IZY|N
106NR_all_32839.1
Exact match
Escherichia coli
2ZM5|C (2ZM5)
  • tRNA(Phe)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å76(3) 2ZM5|C, 2ZXU|C, 3FOZ|C
107NR_all_37816.1
Exact match
Thermus thermophilus
3BBV|z (3BBV)
  • tRNA(Phe)
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): z
10.0 Å76(1) 3BBV|z
108NR_all_40963.3
Exact match
Saccharomyces cerevisiae
1I9V|A (1EHZ)
  • TRANSFER RNA (PHE), PHENYLALANINE TRANSF[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å76(18) 1EHZ|A, 1EVV|A, 1FCW|A, 1I9V|A, 1MJ1|C, 1ML5|a, 1OB2|B, 1OB5|B, 1SZ1|E, 1TN1|A, 1TN2|A, 1TRA|A, 1TTT|D, 1ZO1|F, 1ZO3|A, 4TNA|A, 4TRA|A, 6TNA|A
109NR_all_50147.1
Exact match
3L0U|A (3L0U)
  • Unmodified tRNAPhe
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å76(1) 3L0U|A
110NR_all_53030.1
Exact match
Thermus thermophilus
3TUP|T (3B0V)
  • tRNA, Thermus thermophilus tRNAPhe
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
3.5 Å76(2) 3B0V|A, 3TUP|T
111NR_all_69026.1
Exact match
2DLC|Y (2DLC)
  • T-RNA (76-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Y
2.4 Å76(1) 2DLC|Y
112NR_all_82081.1
Exact match
Bos taurus
1FIR|A (1FIR)
  • HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA([...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.3 Å76(1) 1FIR|A
113NR_all_88312.1
Exact match
1F7V|B (1F7U)
  • TRNA(ARG)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.2 Å76(2) 1F7U|B, 1F7V|B
114NR_all_92158.1
Exact match
Thermus thermophilus
3KFU|K (3KFU)
  • tRNA-Asn
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): K
3.0 Å76(1) 3KFU|K
115NR_all_94693.1
Exact match
Thermus thermophilus
1EIY|C (1EIY)
  • TRNA(PHE), TRNAPHE
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.3 Å76(2) 1EIY|C, 2IY5|T
116NR_all_97371.1
Exact match
Escherichia coli
1QF6|B (1QF6)
  • THREONINE TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.9 Å76(1) 1QF6|B
117NR_all_00477.1
Exact match
1VFG|C (1VFG)
  • RNA (75-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å75(1) 1VFG|C
118NR_all_08014.1
Exact match
2CSX|C (2CSX)
  • RNA (75-MER), RNA (74-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.7 Å75(2) 2CSX|C, 2CT8|C
119NR_all_10650.1
Exact match
1QU2|T (1FFY)
  • ISOLEUCYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
2.2 Å75(3) 1FFY|T, 1QU2|T, 1QU3|T
120NR_all_16381.1
Exact match
2CV1|C (1G59)
  • TRNA(GLU), tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å75(7) 1G59|B, 1N77|C, 1N78|C, 2CV0|C, 2CV1|C, 2CV2|C, 2DXI|C
121NR_all_17454.1
Exact match
2AZX|C (2AZX)
  • 72-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å75(1) 2AZX|C
122NR_all_40924.1
Exact match
Clostridium acetobutylicum
3Q3Z|A (3Q3Z)
  • c-di-GMP-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å75(1) 3Q3Z|A
123NR_all_49960.2
Exact match
synthetic construct
2TRA|A (1VTQ)
  • T-RNA-ASP, TRNAASP
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å75(3) 1VTQ|A, 2TRA|A, 3TRA|A
124NR_all_53610.1
Exact match
2ZZN|C (2ZZN)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å75(1) 2ZZN|C
125NR_all_64724.1
Exact match
Saccharomyces cerevisiae
1YFG|A (1YFG)
  • YEAST INITIATOR TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å75(1) 1YFG|A
126NR_all_66248.1
Exact match
1GAX|C (1GAX)
  • TRNA(VAL), tRNA (Val)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å75(2) 1GAX|C, 1IVS|C
127NR_all_67648.1
Exact match
1IL2|C (1ASY)
  • T-RNA (75-MER), ASPARTYL TRANSFER RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å75(3) 1ASY|R, 1ASZ|R, 1IL2|C
128NR_all_72899.1
Exact match
2IHX|B (2IHX)
  • uPsi RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
75(1) 2IHX|B
129NR_all_17635.1
Exact match
Escherichia coli
1U0B|A (1U0B)
  • Cysteinyl-tRNA synthetase
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å74(1) 1U0B|A
130NR_all_25646.1
Exact match
Escherichia coli
1B23|R (1B23)
  • CYSTEINYL TRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.6 Å74(1) 1B23|R
131NR_all_34181.1
Exact match
Escherichia coli
3MOJ|A (3MOJ)
  • RNA (69-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å74(1) 3MOJ|A
132NR_all_82213.1
Exact match
3AL0|E (3AKZ)
  • tRNAGln
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å74(2) 3AKZ|E, 3AL0|E
133NR_all_82370.1
Exact match
2D6F|E (2D6F)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.2 Å74(1) 2D6F|E
134NR_all_00873.1
Exact match
2ZNI|C (2ZNI)
  • bacterial tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.1 Å72(1) 2ZNI|C
135NR_all_64624.1
Exact match
1QRS|B (1EUQ)
  • GLUTAMINYL TRNA, GLUTAMINE TRNA APTAMER,[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.1 Å72(14) 1EUQ|B, 1EUY|B, 1EXD|B, 1GTR|B, 1GTS|B, 1O0B|B, 1O0C|B, 1QRS|B, 1QRT|B, 1QRU|B, 1QTQ|B, 1ZJW|B, 2RD2|B, 2RE8|B
136NR_all_75503.1
Exact match
Hepatitis delta virus
1VBY|B (1DRZ)
  • RNA (HEPATITIS DELTA VIRUS GENOMIC RIBOZ[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å72(12) 1DRZ|B, 1SJ3|R, 1SJ4|R, 1SJF|B, 1VBX|B, 1VBY|B, 1VBZ|B, 1VC0|B, 1VC5|B, 1VC6|B, 2OIH|B, 2OJ3|B
137NR_all_86158.1
Exact match
Bos taurus
2AKE|B (2AKE)
  • transfer RNA-Trp
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.1 Å72(2) 2AKE|B, 2DR2|B
138NR_all_26106.2
Exact match
2DU3|D (2DU3)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.6 Å71(3) 2DU3|D, 2DU4|C, 2DU5|D
139NR_all_32809.1
Exact match
2OIU|P (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
2.6 Å71(1) 2OIU|P
140NR_all_41701.1
Exact match
2DU6|D (2DU6)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.3 Å71(1) 2DU6|D
141NR_all_45964.1
Exact match
3HAY|E (3HAY)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
5.0 Å71(1) 3HAY|E
142NR_all_68911.1
Exact match
Rattus norvegicus
2L3J|B (2L3J)
  • RNA (71-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): B
71(1) 2L3J|B
143NR_all_68988.1
Exact match
Bacillus subtilis
3LA5|A (3LA5)
  • Adenosine RIboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.7 Å71(1) 3LA5|A
144NR_all_93274.1
Exact match
Vibrio vulnificus
1Y26|X (1Y26)
  • Vibrio vulnificus A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.1 Å71(1) 1Y26|X
145NR_all_16022.1
Exact match
Bacillus subtilis
3IVN|A (3IVN)
  • A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å70(1) 3IVN|A
146NR_all_46985.1
Exact match
1KXK|A (1KXK)
  • ai5g group II Self-splicing intron
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å70(1) 1KXK|A
147NR_all_58680.1
Exact match
Escherichia coli
2YHQ|R (2YHM)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.6 Å70(3) 2YHM|K, 2YHP|K, 2YHQ|R
148NR_all_44882.1
Exact match
2QUW|B (2QUS)
  • Hammerhead ribozyme, Hammerhead ribozyme[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.4 Å69(2) 2QUS|A, 2QUW|B
149NR_all_69983.1
Exact match
3EPH|E (3EPH)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.0 Å69(4) 3EPH|E, 3EPJ|E, 3EPK|E, 3EPL|E
150NR_all_06442.1
Exact match
1P6V|B (1P6V)
  • 45-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.2 Å68(1) 1P6V|B
151NR_all_10641.3
Exact match
Bacillus subtilis
3FO4|A (1Y27)
  • Bacillus subtilis xpt, 65-MER, Guanine r[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.4 Å68(19) 1Y27|X, 2B57|A, 2EES|A, 2EET|A, 2EEU|A, 2EEV|A, 2EEW|A, 2G9C|A, 2XNZ|A, 3DS7|A, 3FO4|A, 3FO6|A, 3G4M|A, 3GAO|A, 3GER|A, 3GES|A, 3GOG|A, 3GOT|A, 4FE5|B
152NR_all_20054.1
Exact match
2Y9B|V (2Y9A)
  • HOMO SAPIENS U4A SNRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): V
68(4) 2Y9A|V, 2Y9B|V, 2Y9C|V, 2Y9D|V
153NR_all_87760.1
Exact match
3SLQ|A (3SKI)
  • RNA (68-MER), RNA (66-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å68(8) 3SKI|A, 3SKL|A, 3SKR|A, 3SKT|A, 3SKW|A, 3SKZ|A, 3SLM|A, 3SLQ|A
154NR_all_03333.1
Exact match
3RKF|A (3RKF)
  • Guanine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å67(1) 3RKF|A
155NR_all_53266.1
Exact match
3ICQ|D (3ICQ)
  • RNA (62-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.2 Å67(1) 3ICQ|D
156NR_all_08539.1
Exact match
3R4F|A (3R4F)
  • pRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.5 Å66(1) 3R4F|A
157NR_all_10870.1
Exact match
Murine leukemia virus
2L1F|B (2L1F)
  • RNA (66-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): B
66(1) 2L1F|B
158NR_all_09711.1
Exact match
2HVY|E (2HVY)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.3 Å65(1) 2HVY|E
159NR_all_51765.1
Exact match
3EGZ|B (3EGZ)
  • Tetracycline aptamer and artificial ribo[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.2 Å65(1) 3EGZ|B
160NR_all_06991.1
Exact match
Homo sapiens
3NKB|B (3NKB)
  • The hepatitis delta virus ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å64(1) 3NKB|B
161NR_all_58821.1
Exact match
2CZJ|B (2CZJ)
  • tmRNA (63-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.0 Å63(1) 2CZJ|B
162NR_all_65233.1
Exact match
Murine leukemia virus
2LC8|A (2LC8)
  • RNA (56-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
63(1) 2LC8|A
163NR_all_74371.1
Exact match
Triticum aestivum
2WWB|D (2WWB)
  • 5.8S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): D
6.5 Å63(1) 2WWB|D
164NR_all_83987.1
Exact match
3HAX|E (3HAX)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.1 Å63(1) 3HAX|E
165NR_all_95960.2
Exact match
Saccharomyces cerevisiae
2WWA|D (2WW9)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): D
8.6 Å63(2) 2WW9|D, 2WWA|D
166NR_all_28316.1
Exact match
3RW6|F (3RW6)
  • constitutive transport element(CTE)of Ma[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): F
2.3 Å62(1) 3RW6|F
167NR_all_10343.1
Exact match
Xenopus laevis
1UN6|E (1UN6)
  • 5S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.1 Å61(1) 1UN6|E
168NR_all_64868.1
Exact match
Haloarcula marismortui
1QA6|C (1C04)
  • 23S RRNA FRAGMENT, 58 NUCLEOTIDE RIBOSOM[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
5.0 Å58(8) 1C04|E, 1HC8|C, 1MMS|C, 1OLN|C, 1QA6|C, 1Y39|C, 2JQ7|B, 3J0D|A
169NR_all_65359.1
Exact match
3HJW|D (3HJW)
  • RNA (58-MER), H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.4 Å58(6) 3HJW|D, 3LWO|D, 3LWP|D, 3LWQ|D, 3LWR|D, 3LWV|D
170NR_all_46544.1
Exact match
Thermus thermophilus
1F7Y|B (1DK1)
  • RRNA FRAGMENT, 16S RIBOSOMAL RNA FRAGMEN[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å57(3) 1DK1|B, 1F7Y|B, 1KUQ|B
171NR_all_61433.3
Exact match
Fusobacterium nucleatum
3F4G|Y (2YIE)
  • FMN RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Y
2.9 Å57(11) 2YIE|Z, 2YIF|Z, 3F2Q|X, 3F2T|X, 3F2W|X, 3F2X|X, 3F2Y|X, 3F30|X, 3F4E|Y, 3F4G|Y, 3F4H|Y
172NR_all_38780.1
Exact match
1GTN|W (1GTN)
  • (GAGCC)11G 56-NUCLEOTIDE RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): W
2.5 Å56(1) 1GTN|W
173NR_all_54817.1
Exact match
1MZP|B (1MZP)
  • fragment of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.7 Å55(1) 1MZP|B
174NR_all_65888.1
Exact match
2HGH|B (2HGH)
  • 55-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): B
55(1) 2HGH|B
175NR_all_74373.1
Exact match
1GTF|W (1C9S)
  • SINGLE STRANDED RNA (55-MER), (GAGUU)10G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): W
1.9 Å55(2) 1C9S|W, 1GTF|W
176NR_all_84490.1
Exact match
Bacillus subtilis
2KZL|A (2KZL)
  • RNA (55-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
55(1) 2KZL|A
177NR_all_87156.1
Exact match
1P5M|A (1P5M)
  • 55-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
55(1) 1P5M|A
178NR_all_62455.1
Exact match
Ralstonia solanacearum
3NPN|A (3NPN)
  • S-ADENOSYLHOMOCYSTEINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å54(2) 3NPN|A, 3NPQ|A
179NR_all_18779.1
Exact match
1KH6|A (1KH6)
  • JIIIabc
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å53(1) 1KH6|A
180NR_all_19088.1
Exact match
3E5C|A (3E5C)
  • SMK box (SAM-III) Riboswitch, SMK box (S[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å53(3) 3E5C|A, 3E5E|A, 3E5F|A
181NR_all_28354.1
Exact match
Thermotoga petrophila
4ENB|A (3VRS)
  • Fluoride riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å52(5) 3VRS|A, 4EN5|A, 4ENA|A, 4ENB|A, 4ENC|A
182NR_all_91132.1
Exact match
2QWY|A (2QWY)
  • SAM-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å52(1) 2QWY|A
183NR_all_99345.1
Exact match
Homo sapiens
1E8O|E (1E8O)
  • 7SL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.2 Å50(1) 1E8O|E
184NR_all_27246.2
Exact match
2PXV|B (1DUL)
  • 4.5 S RNA DOMAIN IV, 4.5S RNA DOMAIN IV,[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.8 Å49(15) 1DUL|B, 1HQ1|B, 2PXB|B, 2PXD|B, 2PXE|B, 2PXF|B, 2PXK|B, 2PXL|B, 2PXP|B, 2PXQ|B, 2PXT|B, 2PXU|B, 2PXV|B, 2XKV|B, 3LQX|B
185NR_all_35446.1
Exact match
1U63|B (1U63)
  • 49 NT FRAGMENT OF MRNA FOR L1
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.4 Å49(1) 1U63|B
186NR_all_94204.1
Exact match
1RMN|A (1RMN)
  • RNA (49-MER)
  • FLUORESCENCE TRANSFER
  • Chain(s): ; model(s): A
49(1) 1RMN|A
187NR_all_28616.1
Exact match
Methanocaldococcus jannaschii
2VPL|B (2VPL)
  • FRAGMENT OF MRNA FOR L1-OPERON CONTAININ[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å48(1) 2VPL|B
188NR_all_58362.1
Exact match
Drosophila melanogaster
2KUW|A (2KUW)
  • K10 TLS RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
48(1) 2KUW|A
189NR_all_85342.1
Exact match
Drosophila melanogaster
2KUU|A (2KE6)
  • K10 TLS RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
48(4) 2KE6|A, 2KUR|A, 2KUU|A, 2KUV|A
190NR_all_18340.1
Exact match
1S03|A (1S03)
  • 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.7 Å47(1) 1S03|A
191NR_all_53440.1
Exact match
1XJR|A (1XJR)
  • s2m RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.7 Å47(1) 1XJR|A
192NR_all_54211.1
Exact match
Sulfolobus solfataricus
1QZW|B (1QZW)
  • 7S RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
4.1 Å47(1) 1QZW|B
193NR_all_59191.1
Exact match
1YMO|A (1YMO)
  • Telomerase RNA P2b-P3 pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
47(3) 1YMO|A, 2K95|A, 2K96|A
194NR_all_44754.1
Exact match
2NUE|C (2NUE)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å46(1) 2NUE|C
195NR_all_68477.1
Exact match
3CIY|C (3CIY)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.4 Å46(1) 3CIY|C
196NR_all_83022.1
Exact match
3IAB|R (3IAB)
  • P3 domain of the RNA component of RNase [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.7 Å46(1) 3IAB|R
197NR_all_14710.1
Exact match
3PTX|R (3PTX)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.0 Å45(1) 3PTX|R
198NR_all_39024.1
Exact match
synthetic construct
3PU1|R (3PU1)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.1 Å45(1) 3PU1|R
199NR_all_40684.1
Exact match
1DUH|A (1DUH)
  • 4.5S RNA DOMAIN IV
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.7 Å45(1) 1DUH|A
200NR_all_47722.1
Exact match
synthetic construct
3PU0|R (3PU0)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.1 Å45(1) 3PU0|R
201NR_all_66266.3
Exact match
2L94|A (1Z2J)
  • HIV-1 frameshift site RNA, HIV-1 framesh[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
45(4) 1Z2J|A, 1ZC5|A, 2JUK|A, 2L94|A
202NR_all_91174.1
Exact match
2GIC|R (2GIC)
  • 45-MER, RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å45(3) 2GIC|R, 3HHZ|R, 3PU4|R
203NR_all_94964.1
Exact match
Indiana vesiculovirus
2WYY|R (2WYY)
  • POLY-URIDINE
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): R
10.6 Å45(1) 2WYY|R
204NR_all_03603.1
Exact match
1G1X|E (1G1X)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.6 Å44(1) 1G1X|E
205NR_all_29655.1
Exact match
Turnip yellow mosaic virus
1A60|A (1A60)
  • TYMV PSEUDOKNOT
  • SOLUTION NMR
  • Chain(s): ; model(s): A
44(1) 1A60|A
206NR_all_35166.1
Exact match
2OEU|A (2OEU)
  • Hammerhead Ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å43(1) 2OEU|A
207NR_all_57376.1
Exact match
Escherichia coli
1CQL|A (1CQ5)
  • SRP RNA DOMAIN IV, SRP DOMAIN IV RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
43(2) 1CQ5|A, 1CQL|A
208NR_all_79102.1
Exact match
2ADT|A (2ADT)
  • 43-MER, RNA (43-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
43(6) 2ADT|A, 2I7E|A, 2I7Z|A, 2JYF|A, 2JYH|A, 2JYJ|A
209NR_all_88898.1
Exact match
2FEY|A (2FEY)
  • stem-loop IV of Tetrahymena telomerase R[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
43(1) 2FEY|A
210NR_all_05702.1
Exact match
Homo sapiens
2L2J|A (2L2J)
  • RNA (42-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
42(2) 2L2J|A, 2L2K|A
211NR_all_17383.1
Exact match
Homo sapiens
2KX8|A (2KX8)
  • 7SK
  • SOLUTION NMR
  • Chain(s): ; model(s): A
42(1) 2KX8|A
212NR_all_47285.1
Exact match
Spinacia oleracea
1MNX|A (1MNX)
  • Loop E from 5S rRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
42(1) 1MNX|A
213NR_all_47619.1
Exact match
2AU4|A (2AU4)
  • Class I RNA aptamer to GTP
  • SOLUTION NMR
  • Chain(s): ; model(s): A
41(1) 2AU4|A
214NR_all_52401.1
Exact match
3PLA|G (3PLA)
  • C/D guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
3.2 Å40(1) 3PLA|G
215NR_all_73096.1
Exact match
1AM0|A (1AM0)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
40(1) 1AM0|A
216NR_all_79080.1
Exact match
3P22|A (3P22)
  • Core ENE hairpin from KSHV PAN RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å40(1) 3P22|A
217NR_all_90185.1
Exact match
2HUA|A (2HUA)
  • CSFV IRES Domain IIa
  • SOLUTION NMR
  • Chain(s): ; model(s): A
40(1) 2HUA|A
218NR_all_03170.1
Exact match
2GJE|R (2GJE)
  • guide RNA 40-mer
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.4 Å39(1) 2GJE|R
219NR_all_04485.1
Exact match
2D1B|A (2D1B)
  • RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
39(1) 2D1B|A
220NR_all_19240.1
Exact match
2D1A|A (2D1A)
  • RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
39(1) 2D1A|A
221NR_all_74923.1
Exact match
2ZY6|A (2ZY6)
  • phenylalanyl transfer RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å39(1) 2ZY6|A
222NR_all_06010.1
Exact match
Hepatitis C virus
2KTZ|A (2KTZ)
  • HCV IRES Domain IIa RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 2KTZ|A
223NR_all_17048.1
Exact match
1F1T|A (1F1T)
  • MALACHITE GREEN APTAMER RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å38(1) 1F1T|A
224NR_all_23834.1
Exact match
1U3K|A (1U3K)
  • ABISS7
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 1U3K|A
225NR_all_25746.1
Exact match
2HW8|B (1ZHO)
  • mRNA, 36-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.6 Å38(2) 1ZHO|B, 2HW8|B
226NR_all_29813.1
Exact match
1YKV|B (1YKQ)
  • Diels-Alder ribozyme, RNA Diels-Alder ri[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.5 Å38(3) 1YKQ|B, 1YKV|B, 1YLS|B
227NR_all_36056.1
Exact match
2KHY|A (2KHY)
  • RNA (38-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 2KHY|A
228NR_all_69494.1
Exact match
1TXS|A (1TXS)
  • Enteroviral 5'-UTR
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 1TXS|A
229NR_all_86447.1
Exact match
Hepatitis C virus
2KU0|A (2KU0)
  • HCV IRES Domain IIa RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 2KU0|A
230NR_all_89850.1
Exact match
1M5L|A (1M5L)
  • modified HIV-1 packaging signal stem-loo[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 1M5L|A
231NR_all_93959.1
Exact match
synthetic construct
1B36|A (1B36)
  • RNA (RNA LOOP B)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 1B36|A
232NR_all_96317.2
Exact match
2A9L|A (1A9L)
  • PRE-TRNA BULGE-HELIX-BULGE MOTIF, ABISS7[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(2) 1A9L|A, 2A9L|A
233NR_all_96594.1
Exact match
1Q8N|A (1Q8N)
  • RNA Aptamer
  • SOLUTION NMR
  • Chain(s): ; model(s): A
38(1) 1Q8N|A
234NR_all_24129.1
Exact match
1D6K|B (1D6K)
  • 5S RRNA E-LOOP (5SE)
  • SOLUTION NMR
  • Chain(s): ; model(s): B
37(1) 1D6K|B
235NR_all_44143.1
Exact match
Escherichia coli
2BH2|C (2BH2)
  • 23S RIBOSOMAL RNA 1932-1968
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å37(1) 2BH2|C
236NR_all_74609.1
Exact match
1I6U|C (1I6U)
  • 16S RRNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å37(1) 1I6U|C
237NR_all_87881.1
Exact match
1KOG|I (1KOG)
  • Threonyl-tRNA synthetase mRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): I
3.5 Å37(1) 1KOG|I
238NR_all_05562.1
Exact match
2FDT|A (2FDT)
  • 36-mer
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 2FDT|A
239NR_all_11732.1
Exact match
1N8X|A (1N8X)
  • HIV-1 STEM LOOP SL1 MONOMERIC RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 1N8X|A
240NR_all_29004.1
Exact match
1RAW|A (1RAW)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 1RAW|A
241NR_all_32059.1
Exact match
2TPK|A (2TPK)
  • RNA (MRNA PSEUDOKNOT)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 2TPK|A
242NR_all_40452.1
Exact match
Mason-Pfizer monkey virus
1E95|A (1E95)
  • RNA (5'-(*GP*CP*GP*GP*CP*CP*AP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 1E95|A
243NR_all_46259.1
Exact match
2LA5|A (2LA5)
  • RNA (36-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(1) 2LA5|A
244NR_all_52542.1
Exact match
2XD0|G (2XD0)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
3.0 Å36(3) 2XD0|G, 2XDB|G, 2XDD|F
245NR_all_57292.2
Exact match
3FU2|A (2L1V)
  • 36-MER, PreQ1 riboswitch
  • SOLUTION NMR
  • Chain(s): ; model(s): A
36(3) 2L1V|A, 3FU2|A, 3K1V|A
246NR_all_02560.1
Exact match
3R9X|C (3R9X)
  • RNA301
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å35(1) 3R9X|C
247NR_all_05469.1
Exact match
2PCV|A (2PCV)
  • U65 Box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 2PCV|A
248NR_all_12766.1
Exact match
3OUY|C (3OUY)
  • RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.7 Å35(1) 3OUY|C
249NR_all_13145.1
Exact match
1ET4|A (1DDY)
  • VITAMIN B12 BINDING RNA, RNA APTAMER, 35[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å35(2) 1DDY|A, 1ET4|A
250NR_all_50911.1
Exact match
1ULL|A (1ULL)
  • RNA (5'-R (GP*GP*CP*UP*GP*GP*AP*CP*UP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 1ULL|A
251NR_all_51421.1
Exact match
2PCW|A (2PCW)
  • U65 box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 2PCW|A
252NR_all_58528.1
Exact match
1FMN|A (1FMN)
  • RNA (5'-R(*GP*GP*CP*GP*UP*GP*UP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 1FMN|A
253NR_all_63564.1
Exact match
2GM0|A (2GM0)
  • RNA (35-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 2GM0|A
254NR_all_75138.1
Exact match
2L3E|A (2L3E)
  • 35-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
35(1) 2L3E|A
255NR_all_76819.1
Exact match
3ID5|D (3ID5)
  • half C/D RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
4.0 Å35(1) 3ID5|D
256NR_all_95553.1
Exact match
2JEA|C (2JEA)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.3 Å35(1) 2JEA|C
257NR_all_00567.1
Exact match
Escherichia coli
1MJI|C (1MJI)
  • 5S rRNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å34(1) 1MJI|C
258NR_all_08029.1
Exact match
1NBK|A (1NBK)
  • RNA aptamer
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1NBK|A
259NR_all_12702.1
Exact match
2F88|A (2F88)
  • D5-PL RNA RIBOZYME DOMAIN
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 2F88|A
260NR_all_18555.1
Exact match
Rattus norvegicus
2L3C|B (2L3C)
  • RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): B
34(1) 2L3C|B
261NR_all_21269.1
Exact match
1R7W|A (1R7W)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1R7W|A
262NR_all_22080.2
Exact match
3OVA|C (3OV7)
  • RNA (34-MER), RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å34(4) 3OV7|C, 3OVA|C, 3OVB|C, 3OVS|C
263NR_all_26428.1
Exact match
1P5N|A (1P5N)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1P5N|A
264NR_all_28379.1
Exact match
1T28|A (1T28)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1T28|A
265NR_all_33169.1
Exact match
1RNK|A (1RNK)
  • RNA PSEUDOKNOT
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1RNK|A
266NR_all_36767.1
Exact match
1R7Z|A (1R7Z)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1R7Z|A
267NR_all_49906.1
Exact match
2EUY|A (2EUY)
  • U65 box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 2EUY|A
268NR_all_51432.1
Exact match
1ETF|A (1ETF)
  • REV RESPONSE ELEMENT RNA, REV RESPONSIVE[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(3) 1ETF|A, 1ETG|A, 1I9F|A
269NR_all_54570.1
Exact match
2JTP|A (2JTP)
  • SIV17-50 RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 2JTP|A
270NR_all_62753.1
Exact match
1R2P|A (1R2P)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 1R2P|A
271NR_all_63647.1
Exact match
1HMH|A (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å34(1) 1HMH|A
272NR_all_64252.1
Exact match
2KPV|A (2KPV)
  • RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 2KPV|A
273NR_all_71589.1
Exact match
3R9W|B (3R9W)
  • RNA301
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.1 Å34(1) 3R9W|B
274NR_all_76639.1
Exact match
3NVK|K (3NVK)
  • RNA (5'-R(*GP*CP*CP*GP*UP*UP*GP*AP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): K
3.2 Å34(1) 3NVK|K
275NR_all_90721.1
Exact match
Pyrococcus furiosus
3NVI|E (3NMU)
  • RNA (34-MER), RNA (5'-R(*CP*UP*CP*UP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.7 Å34(2) 3NMU|D, 3NVI|E
276NR_all_97595.1
Exact match
2P89|A (2P89)
  • U65 H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
34(1) 2P89|A
277NR_all_08485.1
Exact match
1EHT|A (1EHT)
  • THEOPHYLLINE-BINDING RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
33(2) 1EHT|A, 1O15|A
278NR_all_12829.1
Exact match
2OZB|C (2OZB)
  • RNA comprising the 5' Stem-Loop RNA of [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å33(1) 2OZB|C
279NR_all_32109.1
Exact match
3Q50|A (3GCA)
  • PreQ1 riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å33(3) 3GCA|A, 3Q50|A, 3Q51|A
280NR_all_49784.1
Exact match
3AOH|Q (3AOH)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*AP*AP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Q
4.1 Å33(1) 3AOH|Q
281NR_all_65001.1
Exact match
1KPZ|A (1KPY)
  • P1-P2 frameshifting pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
33(2) 1KPY|A, 1KPZ|A
282NR_all_73260.1
Exact match
2JXV|A (2JXV)
  • RNA (33-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
33(1) 2JXV|A
283NR_all_79801.1
Exact match
1EXY|A (1EXY)
  • RNA APTAMER, 33-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
33(1) 1EXY|A
284NR_all_08347.1
Exact match
Homo sapiens
3SIV|C (3SIV)
  • U4atac snRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.3 Å32(1) 3SIV|C
285NR_all_11102.1
Exact match
2KF0|A (1XHP)
  • U6 snRNA, RNA (5'-R(*GP*GP*UP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(2) 1XHP|A, 2KF0|A
286NR_all_26958.1
Exact match
Human immunodeficiency virus 1
1G70|A (1G70)
  • HIV-1 RRE-IIB 32 NUCLEOTIDE RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 1G70|A
287NR_all_46141.1
Exact match
3AOI|Q (3AOI)
  • RNA (5'-R(*CP*CP*CP*GP*GP*AP*AP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Q
4.3 Å32(1) 3AOI|Q
288NR_all_50313.1
Exact match
1KAJ|A (1KAJ)
  • RNA PSEUDOKNOT APK
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 1KAJ|A
289NR_all_54944.1
Exact match
1KPD|A (1KPD)
  • RNA PSEUDOKNOT APKA27G
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 1KPD|A
290NR_all_56698.2
Exact match
2DR8|B (2DR5)
  • tRNA (32-MER), tRNA (33-MER), tRNA (34-M[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å32(18) 2DR5|B, 2DR7|B, 2DR8|B, 2DR9|B, 2DRA|B, 2DRB|B, 2DVI|B, 2ZH1|B, 2ZH2|B, 2ZH3|B, 2ZH4|B, 2ZH5|B, 2ZH6|B, 2ZH7|B, 2ZH8|B, 2ZH9|B, 2ZHA|B, 2ZHB|B
291NR_all_65077.1
Exact match
Escherichia coli
3BO0|C (3BO0)
  • Preprotein translocase secG subunit
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): C
9.6 Å32(2) 3BO0|C, 3BO1|C
292NR_all_73481.1
Exact match
1Z31|A (1Z31)
  • human telomerase PJ6 hairpin
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 1Z31|A
293NR_all_83441.1
Exact match
2LBS|A (1T4L)
  • 5' terminal hairpin of snR47 precursor, [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(2) 1T4L|A, 2LBS|A
294NR_all_93111.1
Exact match
Canis lupus
3DKN|C (3DKN)
  • Preprotein translocase subunit secG
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): C
8.7 Å32(1) 3DKN|C
295NR_all_98134.1
New id, no parents
2LUP|A (2LUP)
  • RNA (32-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
32(1) 2LUP|A
296NR_all_00485.1
Exact match
1JO7|A (1JO7)
  • Influenza A virus promoter RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1JO7|A
297NR_all_05391.1
Exact match
1YNG|A (1YNG)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1YNG|A
298NR_all_08837.1
Exact match
2LDT|A (2LDT)
  • RNA (31-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 2LDT|A
299NR_all_15913.1
Exact match
1YLG|A (1YLG)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1YLG|A
300NR_all_24029.3
Exact match
1JBR|D (1JBR)
  • 31-mer SRD RNA analog, 29-MER SARCIN/RIC[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.2 Å31(2) 1JBR|D, 1JBT|C
301NR_all_30230.1
Exact match
1YNE|A (1YNE)
  • APOLIPOPROTEIN B mRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1YNE|A
302NR_all_32061.1
Exact match
Human immunodeficiency virus 1
1LVJ|A (1LVJ)
  • HIV-1 Trans Activating Region RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1LVJ|A
303NR_all_35011.1
Exact match
Escherichia coli
364D|C (357D)
  • RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.5 Å31(2) 357D|C, 364D|C
304NR_all_47677.1
Exact match
1YNC|A (1YNC)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1YNC|A
305NR_all_74015.1
Exact match
2B63|R (2B63)
  • 31-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.8 Å31(1) 2B63|R
306NR_all_92018.1
Exact match
1MFY|A (1MFY)
  • C4 promoter of influneza A virus
  • SOLUTION NMR
  • Chain(s): ; model(s): A
31(1) 1MFY|A
307NR_all_00060.1
Exact match
1LDZ|A (1LDZ)
  • LEAD-DEPENDENT RIBOZYME
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(2) 1LDZ|A, 2LDZ|A
308NR_all_00809.1
Exact match
Enterovirus B
1RFR|A (1RFR)
  • stemloop-D RNA of the 5'-cloverleaf of c[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1RFR|A
309NR_all_00934.1
Exact match
1HWQ|A (1HWQ)
  • VS RIBOZYME SUBSTRATE RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1HWQ|A
310NR_all_14325.1
Exact match
1NA2|A (1NA2)
  • telomerase RNA p2b hairpin
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1NA2|A
311NR_all_18182.1
Exact match
1KP7|A (1KP7)
  • Hepatitis C Virus Internal Ribosome Entr[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1KP7|A
312NR_all_25782.1
Exact match
3B5F|B (3B58)
  • 29-mer Loop A and Loop B Ribozyme strand[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.7 Å30(14) 3B58|B, 3B5A|B, 3B5F|B, 3B5S|B, 3B91|B, 3BBI|B, 3BBK|B, 3BBM|B, 3CQS|C, 3CR1|C, 3I2Q|C, 3I2R|C, 3I2S|C, 3I2U|C
313NR_all_30417.1
Exact match
1HVU|C (1HVU)
  • RNA (33 NUCLEOTIDE RNA PSEUDOKNOT)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
4.8 Å30(1) 1HVU|C
314NR_all_43451.1
Exact match
1EKZ|B (1EKZ)
  • STAUFEN DOUBLE-STRANDED RNA BINDING DOMA[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
30(1) 1EKZ|B
315NR_all_45599.1
Exact match
1AUD|B (1AUD)
  • RNA 3UTR
  • SOLUTION NMR
  • Chain(s): ; model(s): B
30(1) 1AUD|B
316NR_all_56520.1
Exact match
1XOK|A (1XOK)
  • alfalfa mosaic virus RNA 3' UTR
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å30(1) 1XOK|A
317NR_all_59855.1
Exact match
1AJU|A (1AJU)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1AJU|A
318NR_all_65289.1
Exact match
1EBR|A (1EBR)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1EBR|A
319NR_all_76410.1
Exact match
3SNP|C (3SNP)
  • ferritin H IRE RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å30(1) 3SNP|C
320NR_all_94141.1
Exact match
1AKX|A (1AKX)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
30(1) 1AKX|A
321NR_all_03865.1
Exact match
2KX5|A (2KX5)
  • HIV TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 2KX5|A
322NR_all_04514.1
Exact match
Human immunodeficiency virus 1
1UTS|B (1UTS)
  • RNA (5'-(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
29(1) 1UTS|B
323NR_all_06925.1
Exact match
2L8H|A (2L8H)
  • HIV TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 2L8H|A
324NR_all_09410.1
Exact match
1JBS|C (1JBS)
  • 29-mer sarcin/ricin domain RNA analog
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.0 Å29(1) 1JBS|C
325NR_all_14241.1
Exact match
Human immunodeficiency virus 1
1UUI|B (1UUI)
  • 5'-R(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
29(1) 1UUI|B
326NR_all_17365.1
Exact match
1JID|B (1JID)
  • HELIX 6 OF HUMAN SRP RNA, SRP19 binding [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.8 Å29(2) 1JID|B, 1L1W|A
327NR_all_19397.1
Exact match
1D4R|A (1D4R)
  • 29-MER OF MODIFIED SRP RNA HELIX 6
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å29(1) 1D4R|A
328NR_all_26689.1
Exact match
3B31|A (3B31)
  • RNA (29-MER), Domain 3 of the cricket pa[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.4 Å29(4) 3B31|A, 3MJ3|B, 3MJA|B, 3MJB|A
329NR_all_29867.1
Exact match
1EBS|A (1EBS)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1EBS|A
330NR_all_36025.1
Exact match
1ANR|A (1ANR)
  • RNA REGULATORY ELEMENT TAR
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1ANR|A
331NR_all_42336.1
Exact match
Rattus norvegicus
1SCL|A (1SCL)
  • RNA SARCIN-RICIN LOOP
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1SCL|A
332NR_all_44777.1
Exact match
2KDQ|B (2KDQ)
  • HIV-1 TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
29(1) 2KDQ|B
333NR_all_49121.1
Exact match
1ARJ|N (1ARJ)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): N
29(1) 1ARJ|N
334NR_all_50748.1
Exact match
1OOA|C (1OOA)
  • RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å29(1) 1OOA|C
335NR_all_53807.1
Exact match
1EBQ|A (1EBQ)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1EBQ|A
336NR_all_55995.1
Exact match
2GIP|A (2GIO)
  • 29-MER, 28-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(2) 2GIO|A, 2GIP|A
337NR_all_58182.1
Exact match
1FQZ|A (1F84)
  • HCV-1B IRES RNA DOMAIN IIID, HEPATITIS C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(2) 1F84|A, 1FQZ|A
338NR_all_63196.1
Exact match
1L1C|C (1L1C)
  • licT mRNA antiterminator hairpin
  • SOLUTION NMR
  • Chain(s): ; model(s): C
29(1) 1L1C|C
339NR_all_63395.1
Exact match
1NBR|A (1NBR)
  • RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1NBR|A
340NR_all_66244.1
Exact match
3SN2|B (3SN2)
  • transferrin receptor iron regulatory ele[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.0 Å29(1) 3SN2|B
341NR_all_76233.1
Exact match
1AQO|A (1AQO)
  • IRON RESPONSIVE ELEMENT RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1AQO|A
342NR_all_76597.1
Exact match
Human immunodeficiency virus 1
1QD3|A (1QD3)
  • HIV-1 TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 1QD3|A
343NR_all_81804.1
Exact match
2JWV|A (2JWV)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 2JWV|A
344NR_all_82094.1
Exact match
2K5Z|A (2K5Z)
  • Duck HBV apical loop
  • SOLUTION NMR
  • Chain(s): ; model(s): A
29(1) 2K5Z|A
345NR_all_86286.1
Exact match
Human immunodeficiency virus 1
1UUD|B (1UUD)
  • RNA (5'-(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
29(1) 1UUD|B
346NR_all_15898.1
Exact match
1MNB|B (1MNB)
  • BIV TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
28(1) 1MNB|B
347NR_all_28609.1
Exact match
2A9X|2 (2A9X)
  • BIV TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): 2
28(1) 2A9X|2
348NR_all_33759.2
Exact match
2EZ6|C (2EZ6)
  • 28-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.1 Å28(2) 2EZ6|C, 2NUF|C
349NR_all_38320.1
Exact match
1L2X|A (1L2X)
  • RNA pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.3 Å28(3) 1L2X|A, 1L3D|A, 437D|A
350NR_all_44633.1
Exact match
1ZBN|A (1ZBN)
  • BIV mRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 1ZBN|A
351NR_all_48862.1
Exact match
2AP5|A (2AP0)
  • C27A Sugarcane Yellow Leaf Virus RNA pse[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(2) 2AP0|A, 2AP5|A
352NR_all_50704.1
Exact match
Escherichia coli
28SR|A (28SP)
  • CONSERVED MOTIF IN SRP RNA, SRP DOMAIN I[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(2) 28SP|A, 28SR|A
353NR_all_56389.1
Exact match
1JWC|A (1JU7)
  • 5'-R(*GP*GP*CP*CP*AP*AP*AP*GP*GP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(2) 1JU7|A, 1JWC|A
354NR_all_58270.1
Exact match
1YG3|A (1YG3)
  • ScYLV RNA pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 1YG3|A
355NR_all_71759.1
Exact match
Human immunodeficiency virus 2
2KMJ|A (2KMJ)
  • RNA (28-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 2KMJ|A
356NR_all_73686.1
Exact match
Saccharomyces cerevisiae
2X7N|A (2X7N)
  • SARCIN-RICIN LOOP
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
11.8 Å28(1) 2X7N|A
357NR_all_93265.1
Exact match
1BIV|A (1BIV)
  • BOVINE IMMUNODEFICIENCY VIRUS TAR RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 1BIV|A
358NR_all_97438.1
Exact match
Homo sapiens
3SIU|C (3SIU)
  • U4atac snRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å28(1) 3SIU|C
359NR_all_98221.1
Exact match
1YG4|A (1YG4)
  • ScYLV RNA pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
28(1) 1YG4|A
360NR_all_07706.1
Exact match
1FYO|A (1FYO)
  • FRAGMENT OF 18S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 1FYO|A
361NR_all_09214.2
Exact match
3DVZ|A (1MSY)
  • SARCIN/RICIN DOMAIN FROM 23 S RRNA, Sarc[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å27(11) 1MSY|A, 1Q9A|A, 3DVZ|A, 3DW4|A, 3DW5|A, 3DW6|A, 3DW7|A, 3S7C|A, 3S8U|A, 480D|A, 483D|A
362NR_all_09576.1
Exact match
1F7H|A (1F7H)
  • RNASE P RNA RIBOZYME, P4 DOMAIN
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 1F7H|A
363NR_all_34227.1
Exact match
2RP0|A (2RP0)
  • PEMV-1 mRNA pseudoknot
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(2) 2RP0|A, 2RP1|A
364NR_all_35018.1
Exact match
1TOB|A (1TOB)
  • RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 1TOB|A
365NR_all_35317.1
Exact match
1Q96|A (1Q93)
  • Sarcin/Ricin 28S rRNA, SARCIN/RICIN LOOP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å27(3) 1Q93|A, 1Q96|A, 430D|A
366NR_all_36646.1
Exact match
1F6Z|A (1F6Z)
  • RNASE P RNA RIBOZYME, P4 DOMAIN MUTANT
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 1F6Z|A
367NR_all_38488.1
Exact match
2KXM|A (2KXM)
  • RNA (27-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 2KXM|A
368NR_all_51438.1
Exact match
484D|B (484D)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): ; model(s): B
27(1) 484D|B
369NR_all_57027.1
Exact match
1YSV|A (1YSV)
  • 27-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 1YSV|A
370NR_all_67540.1
Exact match
1XSG|A (1F79)
  • RNASE P RNA RIBOZYME, P4 DOMAIN MUTANT, [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(9) 1F79|A, 1F7G|A, 1F7I|A, 1XSG|A, 1XSH|A, 1XST|A, 1XSU|A, 2CD3|A, 2CD6|A
371NR_all_73376.1
Exact match
1F7F|A (1F6X)
  • RNASE P RNA RIBOZYME, P4 DOMAIN, 5'-R(*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(5) 1F6X|A, 1F78|A, 1F7F|A, 2CD1|A, 2CD5|A
372NR_all_75974.1
Exact match
2AHT|A (2AHT)
  • 27-MER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 2AHT|A
373NR_all_87721.1
Exact match
Human immunodeficiency virus 1
2LDL|A (2LDL)
  • RNA (27-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 2LDL|A
374NR_all_88020.1
Exact match
Hepatitis B virus
2IXY|A (2IXY)
  • 5'-R(*GP*GP*CP*CP*UP*CP*CP*AP*AP*GP *CP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 2IXY|A
375NR_all_93521.1
Exact match
1FYP|A (1FYP)
  • FRAGMENT OF 18S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(1) 1FYP|A
376NR_all_94494.2
Exact match
1BYJ|A (1BYJ)
  • RNA (16S RNA), 16S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
27(2) 1BYJ|A, 1PBR|A
377NR_all_01493.1
Exact match
3DD2|B (3DD2)
  • RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å26(1) 3DD2|B
378NR_all_09464.1
Exact match
387D|A (387D)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å26(1) 387D|A
379NR_all_33462.1
Exact match
3OL8|B (3OL8)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å26(1) 3OL8|B
380NR_all_56299.1
Exact match
2RFK|E (2RFK)
  • guide RNA 2
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å26(1) 2RFK|E
381NR_all_59102.2
Exact match
3OL9|B (3OL6)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.5 Å26(4) 3OL6|B, 3OL9|B, 3OLA|B, 3OLB|B
382NR_all_59185.1
Exact match
1QWB|A (1QWB)
  • sNRE26
  • SOLUTION NMR
  • Chain(s): ; model(s): A
26(1) 1QWB|A
383NR_all_70900.1
Exact match
2L5Z|A (2L5Z)
  • RNA (26-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
26(1) 2L5Z|A
384NR_all_87519.1
Exact match
2F8T|C (2F8T)
  • 26-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.1 Å26(1) 2F8T|C
385NR_all_92043.1
Exact match
3OL7|B (3OL7)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.7 Å26(1) 3OL7|B
386NR_all_93776.1
Exact match
2A43|A (2A43)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.3 Å26(1) 2A43|A
387NR_all_04001.1
Exact match
2QUX|C (2QUX)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å25(1) 2QUX|C
388NR_all_12693.1
Exact match
1RLG|C (1RLG)
  • 25-MER
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.7 Å25(1) 1RLG|C
389NR_all_14144.1
Exact match
1QC8|A (1QC8)
  • TAU EXON 10 SPLICING REGULATORY ELEMENT [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
25(1) 1QC8|A
390NR_all_16161.1
Exact match
2ANN|B (2ANN)
  • 5'-R(*CP*GP*CP*GP*CP*GP*GP*AP*UP*CP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å25(2) 2ANN|B, 2ANR|B
391NR_all_47414.1
Exact match
Pariacoto virus
1F8V|R (1F8V)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.0 Å25(1) 1F8V|R
392NR_all_66292.1
Exact match
488D|D (1MME)
  • RNA HAMMERHEAD RIBOZYME, 5'-R(*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.1 Å25(9) 1MME|B, 1NYI|B, 1Q29|B, 299D|B, 300D|B, 301D|B, 359D|B, 379D|B, 488D|D
393NR_all_84843.1
Exact match
2KGP|A (2KGP)
  • RNA (25-MER)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
25(1) 2KGP|A
394NR_all_92560.1
Exact match
3HJY|D (3HJY)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.7 Å25(1) 3HJY|D
395NR_all_93793.1
Exact match
1EI2|A (1EI2)
  • TAU EXON 10 SRE RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
25(1) 1EI2|A
396NR_all_95380.1
Exact match
1M82|A (1M82)
  • RNA (25-MER): THE COMPLEMENTARY RNA PROM[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
25(1) 1M82|A
397NR_all_02998.1
Exact match
2HEM|A (2HEM)
  • 5'-R(P*GP*GP*GP*AP*AP*GP*GP*CP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 2HEM|A
398NR_all_12875.1
Exact match
3A6P|D (3A6P)
  • pre-microRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.9 Å24(1) 3A6P|D
399NR_all_12932.1
Exact match
1MT4|A (1MT4)
  • 23S ribosomal Hairpin 35
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1MT4|A
400NR_all_13012.1
Exact match
1NZ1|A (1NZ1)
  • SP U6 Intramolecular Stem-Loop RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1NZ1|A
401NR_all_16247.1
Exact match
3AGV|S (3AGV)
  • 5'-R(*GP*GP*AP*GP*GP*(UFT)P*GP*(CFZ)P*(U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): S
2.2 Å24(1) 3AGV|S
402NR_all_26663.1
Exact match
2GBH|A (2GBH)
  • 5'-R(*(GMP)P*GP*GP*CP*UP*AP*AP*UP*GP*(PS[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 2GBH|A
403NR_all_28972.1
Exact match
1SYZ|A (1SYZ)
  • U6 INTRAMOLECULAR STEM-LOOP RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1SYZ|A
404NR_all_30789.1
Exact match
Saccharomyces cerevisiae
2LK3|A (2LK3)
  • RNA (5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 2LK3|A
405NR_all_40137.1
Exact match
3GTP|R (3GTP)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.9 Å24(1) 3GTP|R
406NR_all_40218.1
Exact match
1NC0|A (1NC0)
  • U80G U6 RNA Intramolecular Stem-Loop
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1NC0|A
407NR_all_43561.1
Exact match
2NOK|A (2NOK)
  • 5'-R(*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å24(1) 2NOK|A
408NR_all_45835.1
Exact match
2PN4|A (2PN3)
  • 5'-R(*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å24(2) 2PN3|A, 2PN4|A
409NR_all_45875.1
Exact match
2KEZ|A (2KEZ)
  • RNA (5'-R(*GP*GP*UP*UP*CP*CP*CP*CP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 2KEZ|A
410NR_all_45898.1
Exact match
Homo sapiens
1A9N|Q (1A9N)
  • RNA (5'-R(*CP*CP*UP*GP*GP*UP*AP*UP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Q
2.4 Å24(1) 1A9N|Q
411NR_all_47121.1
Exact match
2QH2|A (2QH2)
  • Human telomerase RNA CR7 terminal hairpi[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 2QH2|A
412NR_all_68783.1
Exact match
1RHT|A (1RHT)
  • RNA (5'-R(P*GP*GP*GP*AP*CP*UP*GP*AP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1RHT|A
413NR_all_69887.1
Exact match
1KKS|A (1KKS)
  • 5'-R(*GP*GP*AP*AP*GP*GP*CP*CP*CP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1KKS|A
414NR_all_71558.1
Exact match
1LC6|A (1LC6)
  • U6 Intramolecular Stem-loop RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1LC6|A
415NR_all_75625.1
Exact match
2F4X|A (2F4X)
  • 5'-R(P*GP*GP*UP*UP*GP*CP*UP*GP*AP*AP*GP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 2F4X|A
416NR_all_79551.1
Exact match
3TS2|U (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): U
2.0 Å24(1) 3TS2|U
417NR_all_87258.1
Exact match
1SY4|A (1SY4)
  • U6 Intramolecular Stem-Loop RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1SY4|A
418NR_all_96608.1
Exact match
1E4P|A (1E4P)
  • RNA (5'-R(*GP*UP*GP*CP*GP*AP*AP*GP*AP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1E4P|A
419NR_all_97091.1
Exact match
1NYB|B (1NYB)
  • BoxB RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
24(1) 1NYB|B
420NR_all_99925.1
Exact match
1TFN|A (1TFN)
  • RNA (5'-R(*GP*GP*GP*AP*CP*UP*GP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
24(1) 1TFN|A
421NR_all_00420.1
Exact match
3LOA|B (3LOA)
  • 5'-R(*GP*GP*GP*(5BU)P*GP*GP*UP*GP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å23(1) 3LOA|B
422NR_all_01945.2
Exact match
1XPE|A (1K9W)
  • HIV-1 DIS(Mal)UU RNA, 5'-R(*CP*UP*UP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å23(14) 1K9W|A, 1XP7|A, 1XPE|A, 1XPF|A, 1Y3O|A, 1Y3S|A, 1YXP|A, 1ZCI|A, 2B8R|A, 2B8S|A, 2FCX|A, 2FCY|A, 2FCZ|A, 2FD0|A
423NR_all_02951.1
Exact match
3TD0|A (3TD0)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å23(1) 3TD0|A
424NR_all_06987.1
Exact match
1BAU|A (1BAU)
  • SL1 RNA DIMER
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1BAU|A
425NR_all_08877.1
Exact match
2O3V|A (2O3V)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å23(1) 2O3V|A
426NR_all_10974.1
Exact match
1TLR|A (1TLR)
  • RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACU[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1TLR|A
427NR_all_17381.1
Exact match
1S2F|A (1S2F)
  • 5'-R(*GP*GP*GP*GP*AP*GP*UP*GP*GP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1S2F|A
428NR_all_18811.3
Exact match
2FQN|A (2FQN)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å23(4) 2FQN|A, 2G5K|A, 2O3W|A, 2O3Y|A
429NR_all_21164.1
Exact match
2PJP|B (2PJP)
  • SECIS RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å23(1) 2PJP|B
430NR_all_30817.1
Exact match
1K5I|A (1K5I)
  • 5'-R(P*GP*GP*AP*CP*CP*CP*GP*GP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1K5I|A
431NR_all_32732.1
Exact match
3MEI|A (3MEI)
  • RNA (5'-R(*CP*CP*GP*CP*CP*GP*CP*GP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å23(1) 3MEI|A
432NR_all_40259.1
Exact match
1OSW|A (1OSW)
  • 5'-R(*GP*GP*AP*GP*GP*CP*GP*CP*UP*AP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1OSW|A
433NR_all_40663.1
Exact match
1BGZ|A (1BGZ)
  • RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1BGZ|A
434NR_all_42580.1
Exact match
Human immunodeficiency virus 1
1BVJ|A (1BVJ)
  • RNA (5'-R(P*GP*GP*CP*GP*AP*CP*GP*GP*UP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1BVJ|A
435NR_all_43870.2
Exact match
1NLC|A (1NLC)
  • HIV-1 DIS(MAL) genomic RNA, 5'-R(*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å23(16) 1NLC|A, 1O3Z|A, 1WVD|A, 1Y6S|A, 1Y6T|A, 1Y73|A, 1Y90|A, 1Y95|A, 1Y99|A, 2OIJ|A, 2OIY|A, 2OJ0|A, 3C44|A, 3DVV|A, 3FAR|A, 462D|A
436NR_all_45404.1
Exact match
1OW9|A (1OW9)
  • A mimic of the VS Ribozyme Hairpin Subst[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1OW9|A
437NR_all_50120.1
Exact match
1HYS|E (1HYS)
  • 5'-R(*UP*CP*AP*GP*CP*CP*AP*CP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.0 Å23(1) 1HYS|E
438NR_all_55234.1
Exact match
2QH3|A (2QH3)
  • Human U64 H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 2QH3|A
439NR_all_58869.1
Exact match
1MFK|A (1MFK)
  • 5'-R(P*GP*GP*CP*GP*GP*UP*UP*GP*CP*AP*GP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1MFK|A
440NR_all_65107.1
Exact match
1JTJ|A (1JTJ)
  • HIV-1Lai SL1
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1JTJ|A
441NR_all_68199.1
Exact match
3BNQ|A (3BNQ)
  • A site of human mitochondrial ribosome, [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å23(3) 3BNQ|A, 3BNR|A, 3BNS|A
442NR_all_73214.1
Exact match
3PHP|A (3PHP)
  • RNA (5'-R(*GP*GP*UP*UP*CP*CP*GP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 3PHP|A
443NR_all_78853.1
Exact match
3TD1|A (3TD1)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å23(1) 3TD1|A
444NR_all_78874.1
Exact match
1S34|A (1S34)
  • 5'-R(*GP*GP*GP*GP*AP*GP*UP*GP*GP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1S34|A
445NR_all_83678.1
Exact match
1JU1|A (1JU1)
  • HIV-1Lai SL1
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1JU1|A
446NR_all_83896.1
Exact match
2QEK|A (2QEK)
  • HIV-1 subtype F DIS genomic RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å23(1) 2QEK|A
447NR_all_90066.1
Exact match
1NEM|A (1NEM)
  • 5'-R(*GP*GP*AP*CP*UP*GP*GP*GP*CP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 1NEM|A
448NR_all_95705.1
Exact match
2PLY|C (1WSU)
  • 5'-R(*GP*GP*CP*GP*UP*UP*GP*CP*CP*GP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.3 Å23(3) 1WSU|E, 2PLY|C, 2UWM|C
449NR_all_96127.1
Exact match
2RO2|A (2RO2)
  • RNA (5'-R(*GP*GP*GP*AP*GP*AP*CP*CP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
23(1) 2RO2|A
450NR_all_05603.1
Exact match
2JYM|A (2JYM)
  • RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2JYM|A
451NR_all_07236.1
Exact match
1K8W|B (1K8W)
  • 5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*UP*(FHU)P*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å22(4) 1K8W|B, 1ZE2|C, 1ZL3|B, 2AB4|B
452NR_all_12483.1
Exact match
1PJY|A (1PJY)
  • HIV-1 frameshift inducing stem-loop
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1PJY|A
453NR_all_13494.1
Exact match
2GRW|A (2GRW)
  • 5'-GGACCUCUCGAAAGAGAUGUCC-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2GRW|A
454NR_all_15361.1
Exact match
Escherichia coli
3J0E|A (3J0E)
  • ribosomal 23S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
9.9 Å22(1) 3J0E|A
455NR_all_15906.1
Exact match
2JSE|A (2JSE)
  • RNA (5'-R(*GP*GP*AP*GP*UP*GP*GP*CP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2JSE|A
456NR_all_16233.1
Exact match
1NTB|A (1NTA)
  • 5'-R(*GP*GP*AP*UP*CP*GP*CP*AP*UP*UP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å22(2) 1NTA|A, 1NTB|A
457NR_all_16991.1
Exact match
2KD8|A (2KD8)
  • 5'-R(*GP*GP*AP*UP*GP*GP*UP*UP*GP*GP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2KD8|A
458NR_all_17243.4
Exact match
1MWL|A (1J7T)
  • 5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å22(14) 1J7T|A, 1LC4|A, 1MWL|A, 1YRJ|A, 2BE0|A, 2BEE|A, 2ESI|A, 2ESJ|A, 2ET3|A, 2ET4|A, 2ET5|A, 2F4T|B, 2PWT|A, 3S4P|A
459NR_all_18764.1
Exact match
Escherichia coli
1O9M|A (1O9M)
  • EUBACTERIAL A-SITE, 5'-R(*CP*GP*CP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.4 Å22(3) 1O9M|A, 2ET8|A, 2F4U|A
460NR_all_20011.1
Exact match
2HNS|A (2HNS)
  • 5'-R(*GP*GP*CP*GP*UP*GP*AP*UP*CP*AP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2HNS|A
461NR_all_21700.1
Exact match
1K6H|A (1K6H)
  • RNA (5'-R(P*GP*GP*CP*GP*UP*GP*UP*UP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1K6H|A
462NR_all_21827.1
Exact match
2K66|A (2K66)
  • 5'-R(*GP*GP*AP*GP*UP*AP*UP*GP*UP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2K66|A
463NR_all_26271.1
Exact match
2GV4|A (1N66)
  • internal loop in the Y-domain of poliovi[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(2) 1N66|A, 2GV4|A
464NR_all_27743.1
Exact match
3HTX|B (3HTX)
  • 5'-R(*GP*AP*UP*UP*UP*CP*UP*CP*UP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.1 Å22(1) 3HTX|B
465NR_all_29171.1
Exact match
3BOY|D (3BOY)
  • 5'-R(*UP*UP*UP*AP*GP*UP*UP*UP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
1.7 Å22(1) 3BOY|D
466NR_all_32355.1
Exact match
3DH3|E (3DH3)
  • stem loop fragment of E. Coli 23S RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.0 Å22(1) 3DH3|E
467NR_all_42727.1
Exact match
2GV3|A (2GV3)
  • 5'-R(*GP*GP*CP*CP*AP*GP*AP*CP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2GV3|A
468NR_all_44365.1
Exact match
1F9L|A (1F9L)
  • 5'-R(*GP*GP*CP*GP*AP*AP*GP*UP*CP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1F9L|A
469NR_all_44670.1
Exact match
2G1W|A (2G1W)
  • 5'-R(*GP*GP*GP*GP*UP*GP*GP*CP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2G1W|A
470NR_all_45177.1
Exact match
1IE2|A (1IE2)
  • 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1IE2|A
471NR_all_46520.1
Exact match
1K2G|A (1K2G)
  • 5'-R(*CP*AP*GP*AP*CP*UP*UP*CP*GP*GP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1K2G|A
472NR_all_47976.1
Exact match
Haloarcula marismortui
4A4T|A (4A4R)
  • 5'-R(*GMP*GP*AP*CP*CP*CP*GP*GP*CP*UP*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(3) 4A4R|A, 4A4T|A, 4A4U|A
473NR_all_48161.1
Exact match
Equine infectious anemia virus
2W2H|R (2W2H)
  • 5'-R(*GP*CP*UP*CP*AP*GP*AP*UP*CP*UP *GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.3 Å22(1) 2W2H|R
474NR_all_59477.1
Exact match
Thermus thermophilus
4A4S|A (4A4S)
  • 5'-R(*GP*GP*AP*CP*CP*CP*GP*GP*CP*UP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 4A4S|A
475NR_all_59646.1
Exact match
1FJE|A (1FJE)
  • SNRE RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1FJE|A
476NR_all_60700.1
Exact match
3BNT|A (3BNT)
  • A site of human mitochondrial ribosome
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å22(1) 3BNT|A
477NR_all_61286.1
Exact match
1IE1|A (1IE1)
  • 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1IE1|A
478NR_all_62236.1
Exact match
Homo sapiens
1E7K|C (1E7K)
  • RNA (5'-R(*GP*CP*CP*AP*AP*UP*GP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å22(1) 1E7K|C
479NR_all_62781.1
Exact match
1JUR|A (1JUR)
  • 5'-R(*GP*GP*CP*CP*UP*GP*AP*GP*GP*AP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1JUR|A
480NR_all_65247.1
Exact match
1IKD|A (1IKD)
  • TRNA ALA ACCEPTOR STEM
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1IKD|A
481NR_all_66082.1
Exact match
Homo sapiens
1DZ5|C (1DZ5)
  • PIE, RNA (5'-R(*GP*AP*GP*AP*CP*AP*UP*UP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): C
22(1) 1DZ5|C
482NR_all_72372.1
Exact match
1TJZ|A (1TJZ)
  • VS Ribozyme
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1TJZ|A
483NR_all_72648.1
Exact match
Tetrahymena thermophila
4ERD|C (4ERD)
  • 5'-R(P*GP*GP*UP*CP*GP*AP*CP*AP*UP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å22(1) 4ERD|C
484NR_all_76888.1
Exact match
3FTF|C (3FTE)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å22(2) 3FTE|C, 3FTF|C
485NR_all_85954.1
Exact match
2RRC|A (2RRC)
  • 5'-R(P*GP*GP*AP*CP*CP*CP*(AP7)P*CP*CP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 2RRC|A
486NR_all_86268.1
Exact match
1K6G|A (1K6G)
  • RNA (5'-R(P*GP*GP*CP*GP*UP*CP*AP*UP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
22(1) 1K6G|A
487NR_all_89621.1
Exact match
3BNL|A (3BNL)
  • A site of bacterial ribosome
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å22(1) 3BNL|A
488NR_all_99185.1
Exact match
2F8S|C (2F8S)
  • 5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å22(1) 2F8S|C
489NR_all_00950.1
Exact match
1JOX|A (1JOX)
  • 5'-R(*GP*GP*CP*GP*GP*UP*GP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1JOX|A
490NR_all_05102.1
Exact match
17RA|A (17RA)
  • RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 17RA|A
491NR_all_05510.1
Exact match
1FEU|C (1FEU)
  • 21 NT FRAGMENT OF 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.3 Å21(1) 1FEU|C
492NR_all_09712.1
Exact match
1QWA|A (1QWA)
  • 18S ribosomal RNA, 5'ETS
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1QWA|A
493NR_all_12840.1
Exact match
1D0T|A (1D0T)
  • PHOSPHOROTHIOATE SUBSTITUTED PHAGE MS2 R[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1D0T|A
494NR_all_22579.1
Exact match
2I82|E (2I82)
  • 5'-R(*GP*AP*GP*GP*GP*GP*AP*UP*UP*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.1 Å21(1) 2I82|E
495NR_all_22892.1
Exact match
2ZKO|C (2ZKO)
  • RNA (5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.7 Å21(1) 2ZKO|C
496NR_all_25166.1
Exact match
2FY1|B (2FY1)
  • S1A stem-loop RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
21(1) 2FY1|B
497NR_all_30115.1
Exact match
1RPU|C (1RPU)
  • 5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*UP*CP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å21(1) 1RPU|C
498NR_all_38901.1
Exact match
1D0U|A (1D0U)
  • PHAGE MS2 RNA BINDING SITE
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1D0U|A
499NR_all_39400.1
Exact match
Escherichia coli
1A51|A (1A4D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*UP*GP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(2) 1A4D|A, 1A51|A
500NR_all_49861.1
Exact match
1URN|P (1URN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
1.9 Å21(1) 1URN|P
501NR_all_51882.1
Exact match
1R9F|B (1R9F)
  • 5'-R(*CP*GP*UP*AP*CP*GP*CP*GP*GP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å21(1) 1R9F|B
502NR_all_53346.1
Exact match
1RKJ|B (1RKJ)
  • 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
21(1) 1RKJ|B
503NR_all_57848.1
Exact match
2O3X|A (2F4S)
  • 5'-R(P*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å21(2) 2F4S|A, 2O3X|A
504NR_all_64601.1
Exact match
2BJ2|A (1BJ2)
  • RNA (5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*AP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(2) 1BJ2|A, 2BJ2|A
505NR_all_74988.1
Exact match
1JP0|A (1JP0)
  • 5'-R(*GP*GP*CP*GP*GP*UP*GP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1JP0|A
506NR_all_76419.1
Exact match
2ZI0|C (2ZI0)
  • RNA (5'-D(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å21(1) 2ZI0|C
507NR_all_81707.1
Exact match
1SZY|A (1SZY)
  • 5'-R(P*GP*GP*CP*AP*GP*GP*GP*CP*UP*CP*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
21(1) 1SZY|A
508NR_all_92391.1
Exact match
3BNP|A (3BNN)
  • A site of human ribosome, A site of huma[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å21(3) 3BNN|A, 3BNO|A, 3BNP|A
509NR_all_96029.1
Exact match
3TS0|U (3TRZ)
  • RNA (5'-R(*GP*GP*GP*CP*AP*GP*GP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): U
2.9 Å21(2) 3TRZ|U, 3TS0|U
510NR_all_02383.1
Exact match
1A1T|B (1A1T)
  • SL3 STEM-LOOP RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): B
20(1) 1A1T|B
511NR_all_04158.1
Exact match
2QKB|C (2QKB)
  • 5'-R(*GP*GP*AP*GP*UP*GP*CP*GP*AP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å20(1) 2QKB|C
512NR_all_08405.1
Exact match
Homo sapiens
4F3T|R (4F3T)
  • RNA (5'-R(P*UP*AP*AP*AP*GP*UP*GP*CP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.3 Å20(1) 4F3T|R
513NR_all_10241.1
Exact match
2B2D|R (2B2D)
  • 5'-R(*AP*UP*GP*CP*AP*UP*GP*UP*CP*UP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å20(1) 2B2D|R
514NR_all_14101.1
Exact match
2O33|A (2O33)
  • U2 snRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2O33|A
515NR_all_24018.1
Exact match
Pseudomonas aeruginosa
4AL5|B (4AL5)
  • 5'-R(*UP*UP*CP*AP*CP*UP*GP*CP*CP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.0 Å20(1) 4AL5|B
516NR_all_27670.1
Exact match
2TOB|A (2TOB)
  • RNA (5'-R(*AP*CP*UP*UP*GP*GP*UP*UP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2TOB|A
517NR_all_33217.1
Exact match
1Q2R|E (1Q2R)
  • RNA (5'-R(*AP*GP*CP*AP*CP*GP*GP*CP*UP*(N[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å20(2) 1Q2R|E, 1Q2S|E
518NR_all_37315.1
Exact match
3HXM|Y (3HXM)
  • RNA (5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Y
3.1 Å20(1) 3HXM|Y
519NR_all_41785.1
Exact match
3F73|H (3F73)
  • RNA (5'-R(*UP*AP*UP*AP*CP*AP*A*CP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): H
3.0 Å20(1) 3F73|H
520NR_all_41851.1
Exact match
1MFJ|A (1MFJ)
  • 5'-R(*GP*AP*CP*AP*GP*UP*CP*UP*CP*UP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 1MFJ|A
521NR_all_50849.1
Exact match
1EC6|C (1EC6)
  • 20-MER RNA HAIRPIN
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å20(1) 1EC6|C
522NR_all_54749.1
Exact match
Saccharomyces cerevisiae
2U2A|A (2U2A)
  • RNA (5'-R(P*GP*GP*UP*CP*AP*GP*UP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2U2A|A
523NR_all_55774.1
Exact match
361D|A (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å20(1) 361D|A
524NR_all_56627.2
Exact match
1ZSE|R (1ZSE)
  • RNA HAIRPIN, 5'-R(*AP*UP*GP*CP*AP*UP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.0 Å20(3) 1ZSE|R, 2BS0|R, 2BS1|R
525NR_all_66986.1
Exact match
1EGK|A (1EGK)
  • RNA (5'-R(*AP*GP*GP*AP*GP*AP*GP*AP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.1 Å20(1) 1EGK|A
526NR_all_67063.1
Exact match
1HLX|A (1HLX)
  • RNA (5'-R(*GP*GP*GP*AP*UP*AP*AP*CP*UP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 1HLX|A
527NR_all_69115.1
Exact match
2RPK|A (2RPK)
  • RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2RPK|A
528NR_all_69359.1
Exact match
1BN0|A (1BN0)
  • SL3 RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 1BN0|A
529NR_all_70371.1
Exact match
1ZBH|E (1ZBH)
  • 5'-R(*CP*CP*GP*GP*CP*UP*CP*UP*UP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.0 Å20(1) 1ZBH|E
530NR_all_72408.1
Exact match
Hepatitis C virus
3TZR|A (3TZR)
  • 5'-R(*CP*GP*AP*GP*GP*AP*AP*CP*UP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å20(1) 3TZR|A
531NR_all_72773.1
Exact match
Saccharomyces cerevisiae
1U2A|A (1U2A)
  • RNA (5'-R(P*GP*GP*UP*CP*AP*GP*UP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 1U2A|A
532NR_all_84878.1
Exact match
2JPP|C (2JPP)
  • RNA (5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): C
20(1) 2JPP|C
533NR_all_90642.1
Exact match
2Y8W|B (2Y8W)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.8 Å20(1) 2Y8W|B
534NR_all_92542.1
Exact match
2O32|A (2O32)
  • 5'-R(*(PSU)P*CP*UP*CP*(OMG)P*(OMG)P*CP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2O32|A
535NR_all_96568.1
Exact match
2RPT|A (2RPT)
  • RNA (5'-R(*GP*GP*CP*CP*CP*GP*CP*CP*GP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
20(1) 2RPT|A
536NR_all_00869.1
Exact match
Hepatitis delta virus
1ATO|A (1ATO)
  • RNA (5'-R(*GP*GP*CP*AP*CP*CP*UP*CP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 1ATO|A
537NR_all_11466.1
Exact match
2RLU|A (2RLU)
  • RNA (5'-R(*GP*GP*UP*UP*GP*CP*GP*GP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 2RLU|A
538NR_all_13113.1
Exact match
1F6U|B (1F6U)
  • HIV-1 STEM-LOOP SL2 FROM PSI-RNA PACKAGI[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
19(1) 1F6U|B
539NR_all_13529.1
Exact match
2Y8Y|B (2Y8Y)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.4 Å19(1) 2Y8Y|B
540NR_all_18199.1
Exact match
1UUU|A (1UUU)
  • RNA (5'-R(*GP*GP*CP*GP*UP*AP*CP*GP*UP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 1UUU|A
541NR_all_20253.1
Exact match
3BT7|C (3BT7)
  • RNA (5'-D(P*GP*CP*UP*GP*UP*GP*(5MU)P*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å19(1) 3BT7|C
542NR_all_25076.1
Exact match
1DFU|M (1DFU)
  • 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): M
1.8 Å19(1) 1DFU|M
543NR_all_32817.1
Exact match
3SZX|A (3SZX)
  • RNA (5'-R(P*UP*UP*GP*GP*GP*CP*CP*UP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å19(1) 3SZX|A
544NR_all_34199.1
Exact match
Enterobacteria phage MS2
2C50|R (2C50)
  • 5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP *AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.7 Å19(1) 2C50|R
545NR_all_34460.1
Exact match
2B7G|A (2B7G)
  • 5'-R(*GP*GP*AP*GP*GP*CP*UP*CP*UP*GP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 2B7G|A
546NR_all_36735.1
Exact match
1I3Y|A (1I3Y)
  • 5'-R(*GP*GP*CP*UP*GP*GP*CP*(OMU)P*GP*UP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 1I3Y|A
547NR_all_40255.1
Exact match
3SYW|A (3SYW)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å19(1) 3SYW|A
548NR_all_42239.1
Exact match
3HK2|D (3HK2)
  • 5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.8 Å19(1) 3HK2|D
549NR_all_44096.1
Exact match
2D2L|D (2D2L)
  • 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*(P1P)P*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.5 Å19(1) 2D2L|D
550NR_all_44879.1
Exact match
Enterobacteria phage MS2
2IZN|R (2IZN)
  • 5'-R(*AP*CP*AP*UP*CP*GP*CP*GP*AP*UP *UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.6 Å19(1) 2IZN|R
551NR_all_45063.1
Exact match
synthetic construct
4A36|R (4A36)
  • 5'-R(*GP*CP*AP*UP*GP*CP*GP*AP*CP*CP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.7 Å19(1) 4A36|R
552NR_all_47037.1
Exact match
1KFO|A (1KFO)
  • 5'-R(*GP*AP*AP*UP*GP*CP*CP*UP*GP*CP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å19(1) 1KFO|A
553NR_all_48013.1
Exact match
2GJW|E (2GJW)
  • 5'-R(*GP*CP*GP*AP*CP*CP*GP*AP*CP*CP*AP*([...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å19(1) 2GJW|E
554NR_all_49759.1
Exact match
2Y9H|B (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.5 Å19(1) 2Y9H|B
555NR_all_54172.4
Exact match
2P7D|D (1X9C)
  • 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.2 Å19(18) 1X9C|D, 1X9K|D, 1ZFT|D, 1ZFV|D, 1ZFX|D, 2BCY|D, 2BCZ|D, 2D2K|D, 2FGP|D, 2NPY|D, 2NPZ|D, 2OUE|D, 2P7D|D, 2P7E|D, 2P7F|D, 3GS1|D, 3GS5|C, 3GS8|D
556NR_all_55536.1
Exact match
Enterobacteria phage MS2
2C4Z|R (2BNY)
  • 5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP *UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.0 Å19(3) 2BNY|R, 2C4Z|R, 2C51|R
557NR_all_58775.1
Exact match
synthetic construct
2IZM|R (1ZDH)
  • RNA (5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.7 Å19(2) 1ZDH|R, 2IZM|R
558NR_all_61124.1
Exact match
1ESY|A (1ESY)
  • RNA (5'-R(P*GP*GP*CP*GP*AP*CP*UP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 1ESY|A
559NR_all_61534.1
Exact match
Caenorhabditis elegans
1SLO|A (1SLO)
  • RNA (5'-R(*UP*UP*AP*CP*CP*CP*AP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(2) 1SLO|A, 1SLP|A
560NR_all_62219.1
Exact match
Enterobacteria phage MS2
2IZ9|R (2IZ9)
  • 5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*U ONEP [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å19(1) 2IZ9|R
561NR_all_69701.1
Exact match
1F27|A (1F27)
  • RNA (5'-R(*AP*CP*CP*GP*UP*CP*AP*GP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.3 Å19(1) 1F27|A
562NR_all_73886.1
Exact match
2BU1|R (1AQ3)
  • RNA (5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.8 Å19(9) 1AQ3|R, 1AQ4|R, 1ZDI|R, 2B2E|R, 2B2G|R, 2BU1|R, 2C4Q|R, 2C4Y|R, 2IZ8|R
563NR_all_78712.1
Exact match
Homo sapiens
2XEB|A (2XEB)
  • 5'-R(P*GP*AP*UP*CP*GP*UP*AP*GP*CP*CP*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 2XEB|A
564NR_all_80327.1
Exact match
1QC0|C (1QC0)
  • 5'-R(*GP*CP*AP*CP*CP*GP*UP*UP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.6 Å19(1) 1QC0|C
565NR_all_80747.1
Exact match
2ES5|A (2B6G)
  • 5'-R(*GP*GP*AP*GP*GP*CP*UP*CP*UP*GP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(3) 2B6G|B, 2ES5|A, 2ESE|B
566NR_all_88420.1
Exact match
3CZ3|E (3CZ3)
  • RNA (5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.2 Å19(1) 3CZ3|E
567NR_all_88446.1
Exact match
2BQ5|R (1ZDK)
  • RNA (5'-R(P*AP*CP*AP*UP*GP*AP*GP*GP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å19(2) 1ZDK|R, 2BQ5|R
568NR_all_88839.1
Exact match
3HM9|Y (3HM9)
  • 5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Y
3.3 Å19(1) 3HM9|Y
569NR_all_90677.1
Exact match
1I3X|A (1I3X)
  • 5'-R(*GP*GP*CP*UP*GP*GP*CP*UP*GP*UP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
19(1) 1I3X|A
570NR_all_91784.1
Exact match
3SJ2|A (3SJ2)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å19(1) 3SJ2|A
571NR_all_02561.1
Exact match
2GVO|A (2GVO)
  • GUANOSINE-5'-MONOPHOSPHATE
  • SOLUTION NMR
  • Chain(s): ; model(s): A
18(1) 2GVO|A
572NR_all_19552.1
Exact match
5MSF|R (5MSF)
  • 5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*UP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.8 Å18(1) 5MSF|R
573NR_all_21621.1
Exact match
1F5U|A (1F5U)
  • RNA (5'-R(*GP*GP*UP*GP*GP*GP*AP*GP*AP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
18(1) 1F5U|A
574NR_all_24919.1
Exact match
3KS8|E (3KS8)
  • 5'-R(*AP*GP*AP*AP*GP*GP*AP*GP*GP*GP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.4 Å18(1) 3KS8|E
575NR_all_31000.1
Exact match
1ZEV|A (1ZEV)
  • 5'-R(*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å18(2) 1ZEV|A, 3GM7|G
576NR_all_49727.1
Exact match
1AJF|A (1AJF)
  • RNA (5'-R(*GP*AP*CP*AP*GP*GP*GP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
18(1) 1AJF|A
577NR_all_50724.1
Exact match
2QK9|B (2QK9)
  • 5'-R(*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.6 Å18(1) 2QK9|B
578NR_all_54786.1
Exact match
1T0E|A (1T0E)
  • 5'-R(*GP*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.7 Å18(1) 1T0E|A
579NR_all_58904.1
Exact match
Escherichia coli
2JLT|A (2JLT)
  • R06
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å18(1) 2JLT|A
580NR_all_72663.1
Exact match
2AZ2|C (2AZ0)
  • 5'-R(*GP*CP*AP*(5BU)P*GP*GP*AP*CP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å18(2) 2AZ0|C, 2AZ2|C
581NR_all_79168.1
Exact match
2R93|R (2R93)
  • RNA (5'-R(*UP*GP*AP*UP*UP*CP*UP*CP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
4.0 Å18(1) 2R93|R
582NR_all_79402.1
Exact match
1Z30|A (1Z30)
  • 5'-R(*GP*GP*CP*GP*UP*UP*CP*GP*UP*UP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
18(1) 1Z30|A
583NR_all_89486.1
Exact match
2QH4|A (2QH4)
  • Human U85 C/D-H/ACA scaRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
18(1) 2QH4|A
584NR_all_98177.1
Exact match
3AVY|T (3AVY)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*UP*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
2.6 Å18(1) 3AVY|T
585NR_all_98247.1
Exact match
3QRR|B (3QRR)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.1 Å18(1) 3QRR|B
586NR_all_00045.1
Exact match
Saccharomyces cerevisiae
1LU3|A (1LU3)
  • PHENYLALANINE TRANSFER RNA
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): A
16.8 Å17(1) 1LU3|A
587NR_all_04004.1
Exact match
2KRY|A (2KRY)
  • RNA (5'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*(RSQ[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KRY|A
588NR_all_06159.1
Exact match
2JR4|A (2JR4)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*UP*AP*CP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2JR4|A
589NR_all_07194.1
Exact match
1BZU|A (1BZU)
  • TRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1BZU|A
590NR_all_11083.1
Exact match
2LA9|A (2LA9)
  • RNA (5'-R(*GP*GP*GP*GP*AP*CP*UP*GP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2LA9|A
591NR_all_14070.1
Exact match
3HOU|3 (3HOU)
  • 5'-R(*UP*GP*CP*AP*UP*U*UP*CP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 3
3.2 Å17(3) 3HOU|3, 3HOW|3, 3HOZ|P
592NR_all_17743.1
Exact match
2KPC|A (2KPC)
  • RNA (5'-R(*UP*GP*AP*GP*CP*AP*CP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KPC|A
593NR_all_18486.1
Exact match
2LBR|A (2LBR)
  • RNA (5'-R(*GP*GP*GP*GP*AP*CP*UP*GP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2LBR|A
594NR_all_19687.1
Exact match
1BZT|A (1BZT)
  • TRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1BZT|A
595NR_all_19977.1
Exact match
2R92|T (2R92)
  • RNA (5'-R(*CP*UP*UP*GP*AP*CP*GP*CP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
3.8 Å17(1) 2R92|T
596NR_all_20313.1
Exact match
2OE5|B (2OE5)
  • RNA (5'-R(*GP*GP*UP*AP*CP*UP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.5 Å17(3) 2OE5|B, 2OE6|B, 2OE8|B
597NR_all_20533.1
Exact match
2KVN|A (2KVN)
  • RNA (5'-R(*GP*GP*UP*GP*AP*UP*UP*GP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KVN|A
598NR_all_20789.1
Exact match
Bacillus subtilis
2LBQ|A (2LBQ)
  • RNA (5'-R(*GP*GP*GP*GP*AP*CP*UP*GP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2LBQ|A
599NR_all_21107.1
Exact match
1KOS|A (1KOS)
  • 5'-R(*CP*UP*GP*UP*GP*(5MU)P*UP*CP*GP*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1KOS|A
600NR_all_22087.1
Exact match
1U1Y|R (1U1Y)
  • 5'-R(*CP*CP*GP*GP*(2PR)P*GP*GP*AP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å17(1) 1U1Y|R
601NR_all_24134.1
Exact match
2D19|A (2D19)
  • 5'-R(*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2D19|A
602NR_all_28034.1
Exact match
2KPD|A (2KPD)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*CP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KPD|A
603NR_all_28340.2
Exact match
1LUU|A (1LUU)
  • 5'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG)P*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(2) 1LUU|A, 1LUX|A
604NR_all_29046.1
Exact match
Bacillus subtilis
2LAC|A (2LAC)
  • RNA (5'-R(*GP*GP*GP*GP*AP*CP*UP*GP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2LAC|A
605NR_all_29431.1
Exact match
2KRZ|A (2KRZ)
  • RNA (5'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KRZ|A
606NR_all_30138.1
Exact match
2JRQ|A (2JRQ)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0)P*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2JRQ|A
607NR_all_39300.1
Exact match
2JSG|A (2JSG)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*UP*AP*CP*(6MZ[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2JSG|A
608NR_all_40572.1
Exact match
2G1G|A (2G1G)
  • 5'-R(*AP*CP*GP*GP*GP*CP*UP*CP*AP*UP*(T6A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2G1G|A
609NR_all_42899.1
Exact match
2JRG|A (2JRG)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0)P*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2JRG|A
610NR_all_44304.1
Exact match
1FL8|A (1FL8)
  • ANTICODON DOMAIN OF TRNA(LYS)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1FL8|A
611NR_all_45868.1
Exact match
1YN2|A (1TBK)
  • VS ribozyme stem-loop V
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(3) 1TBK|A, 1YN1|A, 1YN2|A
612NR_all_51044.1
Exact match
2KRP|A (2KRP)
  • RNA (5'-R(*CP*UP*CP*GP*GP*CP*UP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KRP|A
613NR_all_52314.1
Exact match
1BZ3|A (1BZ3)
  • TRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1BZ3|A
614NR_all_52592.1
Exact match
1WKS|A (1WKS)
  • 5'-R(*GP*GP*CP*UP*UP*UP*GP*GP*AP*UP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1WKS|A
615NR_all_55115.1
Exact match
2KRW|A (2KRW)
  • RNA (5'-R(*CP*UP*CP*GP*GP*(N)P*UP*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KRW|A
616NR_all_58221.1
Exact match
2AWQ|A (2AWQ)
  • 5'-R(*GP*GP*GP*GP*AP*(PSU)P*UP*GP*AP*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2AWQ|A
617NR_all_60197.1
Exact match
2KRV|A (2KRV)
  • RNA (5'-R(*CP*UP*CP*GP*GP*(RSP)P*UP*IP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KRV|A
618NR_all_61274.1
Exact match
406D|A (406D)
  • RNA (5'-R(*CP*AP*CP*CP*GP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å17(1) 406D|A
619NR_all_61734.1
Exact match
2LBL|A (2LBL)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*UP*CP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2LBL|A
620NR_all_62073.1
Exact match
1T0D|A (1T0D)
  • 5'-R(*GP*GP*UP*GP*GP*UP*GP*(MTU)P*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å17(1) 1T0D|A
621NR_all_62475.1
Exact match
1KKA|A (1KKA)
  • anticodon stem-loop of tRNA(PHE)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1KKA|A
622NR_all_67828.1
Exact match
2LBJ|A (2LBJ)
  • RNA (5'-R(*GP*GP*GP*CP*CP*UP*UP*GP*CP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2LBJ|A
623NR_all_71012.1
Exact match
2D18|A (2D18)
  • 5'-R(*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2D18|A
624NR_all_78567.1
Exact match
2LBK|A (2LBK)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*UP*CP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2LBK|A
625NR_all_80365.1
Exact match
1J4Y|A (1J4Y)
  • anticodon stem-loop of tRNA(Phe)
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1J4Y|A
626NR_all_83350.1
Exact match
2KRQ|A (2KRQ)
  • RNA (5'-R(*CP*UP*CP*GP*GP*CP*UP*IP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2KRQ|A
627NR_all_83387.1
Exact match
2L9E|A (2L9E)
  • RNA (5'-R(*GP*CP*AP*GP*AP*CP*UP*(70U)P*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 2L9E|A
628NR_all_84417.1
Exact match
1BZ2|A (1BZ2)
  • TRNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1BZ2|A
629NR_all_92212.1
Exact match
1ATV|A (1ATV)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*AP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1ATV|A
630NR_all_98584.1
Exact match
1R3E|C (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*(FHU)P*CP*GP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.1 Å17(1) 1R3E|C
631NR_all_99669.1
Exact match
1FEQ|A (1FEQ)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*UP*UP*(T6A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
17(1) 1FEQ|A
632NR_all_03737.1
Exact match
420D|A (420D)
  • RNA (5'-R(*GP*CP*AP*GP*AP*GP*UP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å16(1) 420D|A
633NR_all_04523.1
Exact match
3CZW|X (3CZW)
  • RNA (5'-R(*G*UP*GP*GP*UP*CP*UP*GP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
1.4 Å16(2) 3CZW|X, 3D0M|X
634NR_all_08864.1
Exact match
1YZD|A (1YY0)
  • 5'-R(*GP*CP*AP*GP*AP*(A5M)P*UP*UP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.2 Å16(4) 1YY0|A, 1YZD|A, 1Z79|A, 2H1M|A
635NR_all_20513.1
Exact match
1XWU|A (1XWU)
  • 5'-R(*CP*GP*AP*AP*AP*CP*AP*UP*AP*GP*AP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 1XWU|A
636NR_all_33570.1
Exact match
2L6I|A (2L6I)
  • RNA (5'-R(*GP*AP*UP*CP*UP*CP*UP*UP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 2L6I|A
637NR_all_39285.1
Exact match
3H3V|P (3H3V)
  • 5'-D(*CP*AP*GP*CP*TP*AP*CP*TP*TP*GP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
4.0 Å16(1) 3H3V|P
638NR_all_43438.1
Exact match
Pseudomonas aeruginosa
4AL7|B (2XLJ)
  • 5'-R(*CP*UP*GP*CP*CP*GP*UP*AP*UP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.6 Å16(4) 2XLJ|B, 2XLK|C, 4AL6|B, 4AL7|B
639NR_all_44062.1
Exact match
1Z7F|A (1Z7F)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å16(1) 1Z7F|A
640NR_all_50779.1
Exact match
1JTW|A (1JTW)
  • 5'-R(*GP*GP*GP*UP*GP*CP*GP*AP*GP*AP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 1JTW|A
641NR_all_51033.1
Exact match
2RN1|A (2RN1)
  • RNA (5'-R(P*GP*AP*GP*CP*CP*CP*UP*GP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 2RN1|A
642NR_all_61402.1
Exact match
2B3J|E (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.0 Å16(1) 2B3J|E
643NR_all_63636.1
Exact match
1N53|A (1N53)
  • RNA (5'-R(*GP*AP*GP*GP*GP*UP*GP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 1N53|A
644NR_all_70166.1
Exact match
2LP9|A (2LP9)
  • RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 2LP9|A
645NR_all_73213.1
Exact match
405D|A (405D)
  • RNA (5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å16(1) 405D|A
646NR_all_74175.1
Exact match
2D17|A (2D17)
  • 5'-R(*CP*GP*GP*CP*AP*AP*GP*AP*GP*GP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 2D17|A
647NR_all_76300.1
Exact match
Pseudomonas aeruginosa
2XLI|B (2XLI)
  • 5'-R(*CP*UP*GP*CP*CP*GP*UP*AP*UP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å16(1) 2XLI|B
648NR_all_84368.1
Exact match
1T0K|D (1T0K)
  • 5'-R(*G*GP*AP*CP*GP*CP*AP*GP*AP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.2 Å16(1) 1T0K|D
649NR_all_85996.1
Exact match
2F8K|B (2F8K)
  • 5'-R(*UP*AP*AP*UP*CP*UP*UP*UP*GP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.0 Å16(1) 2F8K|B
650NR_all_86529.1
Exact match
2KYD|A (2KYD)
  • RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 2KYD|A
651NR_all_87359.1
Exact match
2O5I|H (2O5I)
  • 5'-R(P*GP*AP*GP*UP*CP*UP*GP*CP*GP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): H
2.5 Å16(3) 2O5I|H, 2O5J|H, 2PPB|H
652NR_all_88098.1
Exact match
1KIS|A (1KIS)
  • RNA (5'-R(*GP*AP*GP*CP*CP*CP*UP*GP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(1) 1KIS|A
653NR_all_89647.1
Exact match
2PN9|A (2OOM)
  • RNA 16-mer, 5'-R(*GP*GP*AP*GP*CP*CP*UP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
16(2) 2OOM|A, 2PN9|A
654NR_all_92019.1
Exact match
3ND3|A (3ND3)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å16(2) 3ND3|A, 3ND4|A
655NR_all_09331.1
Exact match
2I91|D (2I91)
  • 5'-R(*C*GP*GP*UP*AP*GP*GP*CP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.7 Å15(1) 2I91|D
656NR_all_10824.1
Exact match
397D|A (397D)
  • RNA (5'-R(*GP*GP*CP*CP*AP*GP*AP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.3 Å15(1) 397D|A
657NR_all_12271.1
Exact match
1XWP|A (1XWP)
  • 5'-R(*GP*GP*AP*GP*AP*UP*CP*GP*CP*AP*CP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 1XWP|A
658NR_all_13314.1
Exact match
1ATW|A (1ATW)
  • RNA (5'-R(*GP*CP*UP*CP*CP*AP*GP*AP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 1ATW|A
659NR_all_21910.1
Exact match
Enterobacteria phage lambda
1QFQ|A (1HJI)
  • RNA (5-R(P*GP*CP*CP*CP*UP*GP*AP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(2) 1HJI|A, 1QFQ|A
660NR_all_28910.1
Exact match
3P59|A (3P59)
  • RNA (5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å15(1) 3P59|A
661NR_all_29680.1
Exact match
2KYE|A (2KYE)
  • RNA (5'-R(*GP*AP*GP*AP*GP*(PSU)P*(PSU)P*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 2KYE|A
662NR_all_31415.1
Exact match
1ZX7|A (1ZX7)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å15(3) 1ZX7|A, 1ZZ5|A, 2A04|A
663NR_all_31872.1
Exact match
3HJF|Y (3HJF)
  • 5'-R(*CP*AP*AP*CP*CP*UP*AP*CP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Y
3.1 Å15(1) 3HJF|Y
664NR_all_36084.1
Exact match
2LPA|A (2LPA)
  • RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 2LPA|A
665NR_all_42141.1
Exact match
1CSL|B (1CSL)
  • 5'-R(*UP*CP*UP*GP*AP*CP*GP*GP*UP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.6 Å15(1) 1CSL|B
666NR_all_59994.1
Exact match
2BX2|R (2BX2)
  • RNA (5'-R(*UP*UP*UP*AP*CP*AP*GP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å15(1) 2BX2|R
667NR_all_76541.1
Exact match
1Q75|A (1Q75)
  • DKC mutant P2b telomerase RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 1Q75|A
668NR_all_79089.1
Exact match
synthetic construct
2XB2|E (2XB2)
  • RNA POLY-U-RIBONUCLEOTIDE
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.4 Å15(1) 2XB2|E
669NR_all_79971.1
Exact match
3PO2|P (3PO2)
  • RNA product strand
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
3.3 Å15(1) 3PO2|P
670NR_all_80067.1
Exact match
1OQ0|A (1OQ0)
  • P6.1 RNA hairpin from hTR
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 1OQ0|A
671NR_all_92787.1
Exact match
1A4T|A (1A4T)
  • BOXB RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
15(1) 1A4T|A
672NR_all_94200.1
Exact match
1SDS|D (1SDS)
  • box H/ACA sRNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
1.8 Å15(1) 1SDS|D
673NR_all_97581.1
Exact match
1QBP|A (1QBP)
  • 5'-R(*UP*GP*(CBV)P*(CBV)P*AP*GP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å15(1) 1QBP|A
674NR_all_01112.1
Exact match
3O7V|A (3O3I)
  • RNA (5'-R(*GP*CP*GP*AP*AP*UP*AP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å14(3) 3O3I|A, 3O6E|A, 3O7V|A
675NR_all_03338.1
Exact match
1ROQ|A (1ROQ)
  • 5'-R(*GP*GP*UP*AP*UP*CP*AP*CP*GP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1ROQ|A
676NR_all_03700.1
Exact match
6MSF|R (6MSF)
  • RNA (5'-R(*CP*CP*AP*CP*AP*GP*UP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.8 Å14(1) 6MSF|R
677NR_all_05357.1
Exact match
1FHK|A (1FHK)
  • RNA (5'-R(*GP*GP*CP*GP*GP*UP*GP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1FHK|A
678NR_all_06631.1
Exact match
2QKK|C (2QKK)
  • 5'-R(*CP*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.2 Å14(1) 2QKK|C
679NR_all_14240.1
Exact match
1IK1|A (1IK1)
  • 5'-R(*GP*GP*UP*AP*CP*UP*AP*UP*GP*UP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1IK1|A
680NR_all_18776.1
Exact match
1KOD|B (1KOC)
  • RNA (5'-R(P*AP*CP*AP*GP*GP*UP*AP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
14(2) 1KOC|B, 1KOD|B
681NR_all_20238.1
Exact match
3OIN|C (3OIJ)
  • 5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*AP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å14(2) 3OIJ|C, 3OIN|C
682NR_all_21176.1
Exact match
synthetic construct
4A2X|L (4A2X)
  • 5'-R(*GP*GP*GP*AP*GP*AP*AP*CP*AP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): L
4.0 Å14(1) 4A2X|L
683NR_all_23982.1
Exact match
1TFY|H (1TFY)
  • 5'-R(*GP*CP*GP*GP*AP*UP*AP*UP*CP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): H
3.2 Å14(1) 1TFY|H
684NR_all_28461.1
Exact match
1MHK|L (1MHK)
  • RNA 14-mer BCh12
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): L
2.5 Å14(1) 1MHK|L
685NR_all_28613.1
Exact match
2KOC|A (2KOC)
  • RNA (5'-R(P*GP*GP*CP*AP*CP*UP*UP*CP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 2KOC|A
686NR_all_29374.1
Exact match
Homo sapiens
2Y95|A (2Y95)
  • 5'-R(*GP*GP*CP*GP*CP*AP*UP*CP*GP*GP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 2Y95|A
687NR_all_30109.1
Exact match
3TMI|B (3TMI)
  • 5'-R(*CP*GP*AP*CP*GP*CP*UP*AP*GP*CP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
14(1) 3TMI|B
688NR_all_35085.1
Exact match
1F85|A (1F85)
  • HCV-1B IRES RNA DOMAIN IIIE
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1F85|A
689NR_all_39291.1
Exact match
1RNA|A (1RNA)
  • RNA (5'-R(*UP*UP*AP*UP*AP*UP*AP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å14(1) 1RNA|A
690NR_all_40992.1
Exact match
1FUF|A (1FUF)
  • (5'-R(*GP*GP*UP*AP*UP*UP*UP*CP*GP*GP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.7 Å14(2) 1FUF|A, 1IK5|A
691NR_all_46416.1
Exact match
1MY9|A (1MY9)
  • 5'-R(*GP*GP*AP*GP*GP*UP*UP*UP*UP*GP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1MY9|A
692NR_all_49778.1
Exact match
2EVY|A (2EVY)
  • Poliovirus 5'NTR cloverleaf stem loop D [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 2EVY|A
693NR_all_51092.1
Exact match
3OG8|C (3OG8)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å14(1) 3OG8|C
694NR_all_52724.1
Exact match
1WTT|A (1WTT)
  • RNA (5'-R(*GP*GP*AP*CP*CP*2MGP*GP*MA6P*M[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1WTT|A
695NR_all_56935.1
Exact match
1DUQ|B (1DUQ)
  • THE REV BINDING ELEMENT
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.1 Å14(1) 1DUQ|B
696NR_all_59382.1
Exact match
Tetrahymena thermophila
1C0O|A (1C0O)
  • RNA (5'-R(*GP*GP*GP*UP*CP*UP*UP*CP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1C0O|A
697NR_all_62336.1
Exact match
1K4B|A (1K4B)
  • 5'-R(*GP*GP*UP*UP*CP*AP*GP*UP*UP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1K4B|A
698NR_all_64332.1
Exact match
1A3M|A (1A3M)
  • 16S RRNA (5'-R(*GP*GP*CP*GP*UP*CP*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1A3M|A
699NR_all_71196.1
Exact match
433D|A (433D)
  • 5'-R(*GP*GP*UP*AP*UP*UP*GP*CP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å14(1) 433D|A
700NR_all_72657.1
Exact match
3LRN|C (3LRN)
  • RNA (5'-R(*(GTP)P*GP*CP*GP*CP*GP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å14(1) 3LRN|C
701NR_all_73406.1
Exact match
7MSF|R (7MSF)
  • 5'-R(*UP*CP*GP*CP*CP*AP*AP*CP*AP*GP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.8 Å14(1) 7MSF|R
702NR_all_83749.1
Exact match
1WTS|A (1WTS)
  • RNA (5'-R(*GP*GP*AP*CP*CP*2MGP*GP*MA6P*M[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1WTS|A
703NR_all_97409.1
Exact match
1K4A|A (1K4A)
  • 5'-R(*GP*GP*UP*UP*CP*AP*GP*AP*AP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
14(1) 1K4A|A
704NR_all_05744.1
Exact match
Caenorhabditis elegans
3V71|B (3V71)
  • RNA (5'-R(*CP*UP*CP*UP*GP*UP*AP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.9 Å13(1) 3V71|B
705NR_all_08008.1
Exact match
1VOP|A (1VOP)
  • 23S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1VOP|A
706NR_all_10053.1
Exact match
Homo sapiens
3NNC|B (3NNC)
  • RNA (5'-R(*UP*GP*UP*GP*UP*GP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.2 Å13(1) 3NNC|B
707NR_all_10161.1
Exact match
Caenorhabditis elegans
3V6Y|B (3V6Y)
  • RNA (5'-R(*UP*AP*CP*UP*GP*UP*GP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.5 Å13(1) 3V6Y|B
708NR_all_11148.1
Exact match
3M3Y|R (3GTM)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.8 Å13(3) 3GTM|M, 3GTQ|R, 3M3Y|R
709NR_all_11604.1
Exact match
429D|A (429D)
  • RNA (5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.7 Å13(1) 429D|A
710NR_all_18885.1
Exact match
3AVV|T (3AVV)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
3.1 Å13(1) 3AVV|T
711NR_all_22379.2
Exact match
1NUV|A (1NUJ)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å13(2) 1NUJ|A, 1NUV|A
712NR_all_23602.1
Exact match
1HS2|A (1HS1)
  • 5'-R(*GP*CP*GP*UP*UP*AP*AP*CP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(5) 1HS1|A, 1HS2|A, 1HS3|A, 1HS4|A, 1HS8|A
713NR_all_23706.1
Exact match
1BR3|A (1BR3)
  • RNA (5'-R(*GP*GP*AP*CP*AP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
3.0 Å13(1) 1BR3|A
714NR_all_39524.1
Exact match
3CJZ|A (3CJZ)
  • RNA (5'-R(*GP*GP*AP*CP*GP*(M2G)P*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å13(1) 3CJZ|A
715NR_all_39581.1
Exact match
3CGR|B (3CGR)
  • RNA (5'-R(*CP*GP*CP*AP*CP*UP*AP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.1 Å13(1) 3CGR|B
716NR_all_40838.1
Exact match
1JZC|A (1JZC)
  • 5'-R(*GP*GP*UP*GP*CP*AP*UP*GP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1JZC|A
717NR_all_40855.1
Exact match
2KM8|A (2KM8)
  • 5'-R(P*UP*AP*UP*AP*UP*AP*UP*AP*AP*UP*AP*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 2KM8|A
718NR_all_41477.1
Exact match
3CGP|B (3CGP)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.6 Å13(2) 3CGP|B, 3CGQ|B
719NR_all_48275.1
Exact match
1I4C|A (1I4C)
  • RNA (5'-R(*GP*GP*UP*GP*CP*UP*UP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1I4C|A
720NR_all_49395.1
Exact match
1ESH|A (1ESH)
  • RNA (5'-R(*GP*GP*UP*GP*CP*AP*UP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1ESH|A
721NR_all_52842.1
Exact match
3AVX|T (3AVX)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
2.4 Å13(1) 3AVX|T
722NR_all_61311.1
Exact match
3MQK|D (3MQK)
  • RNA (5'-R(P*GP*UP*UP*CP*GP*AP*UP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.8 Å13(1) 3MQK|D
723NR_all_62338.1
Exact match
1TFW|G (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
2.2 Å13(1) 1TFW|G
724NR_all_63685.1
Exact match
Caenorhabditis elegans
3V74|B (3V74)
  • RNA (5'-R(*UP*CP*AP*UP*GP*UP*GP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å13(1) 3V74|B
725NR_all_63997.1
Exact match
1EFS|A (1EFS)
  • DNA (5'-D(*GP*AP*GP*AP*GP*GP*AP*AP*GP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1EFS|A
726NR_all_64909.1
Exact match
2R22|A (2R22)
  • RNA (5'-R(*GP*CP*GP*UP*UP*UP*GP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å13(1) 2R22|A
727NR_all_65238.1
Exact match
1I46|A (1I46)
  • 5'-R(*GP*GP*UP*GP*CP*GP*UP*AP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1I46|A
728NR_all_65667.1
Exact match
synthetic construct
2C0B|R (2C0B)
  • 5'-R(*UP*UP*UP*AP*CP*AP*GP*UP*AP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.2 Å13(1) 2C0B|R
729NR_all_67156.1
Exact match
1I9X|A (1I9X)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*GP*UP*AP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å13(1) 1I9X|A
730NR_all_69475.1
Exact match
1K8S|A (1K8S)
  • 5'-R(*GP*GP*CP*AP*GP*AP*GP*UP*GP*CP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1K8S|A
731NR_all_69559.1
Exact match
2IX1|B (2IX1)
  • 5'-D(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP *AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.7 Å13(1) 2IX1|B
732NR_all_73105.2
Exact match
2R20|A (2R1S)
  • RNA (5'-R(*GP*CP*GP*UP*UP*(5BU)P*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å13(3) 2R1S|A, 2R20|A, 2R21|A
733NR_all_85918.1
Exact match
413D|A (413D)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*UP*CP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å13(1) 413D|A
734NR_all_86208.1
Exact match
3CGS|B (3CGS)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.7 Å13(1) 3CGS|B
735NR_all_89836.1
Exact match
2JLW|C (2JLW)
  • 5'-R(*UP*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å13(1) 2JLW|C
736NR_all_96474.1
Exact match
1I4B|A (1I4B)
  • 5'-R(*GP*GP*UP*GP*CP*UP*UP*AP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
13(1) 1I4B|A
737NR_all_96846.1
Exact match
Escherichia coli
1ELH|B (1ELH)
  • RNA (5'-R(*AP*AP*CP*UP*GP*CP*CP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
13(1) 1ELH|B
738NR_all_00889.1
Exact match
353D|A (353D)
  • RNA (5'-R(*AP*UP*CP*CP*CP*CP*CP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.4 Å12(1) 353D|A
739NR_all_02895.1
Exact match
3IEV|D (3IEV)
  • 5'-R(P*AP*UP*CP*AP*CP*CP*UP*CP*CP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
1.9 Å12(1) 3IEV|D
740NR_all_03173.1
Exact match
2K7E|A (2K7E)
  • RNA (5'-R(*GP*CP*GP*GP*UP*GP*UP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 2K7E|A
741NR_all_03590.1
Exact match
422D|A (422D)
  • 5'-R(*GP*AP*UP*CP*AP*CP*UP*UP*CP*GP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å12(1) 422D|A
742NR_all_04204.1
Exact match
Homo sapiens
3NMR|B (3NMR)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å12(1) 3NMR|B
743NR_all_04600.1
Exact match
Aquifex aeolicus
3R2D|R (3R2D)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.2 Å12(1) 3R2D|R
744NR_all_05010.1
Exact match
157D|A (157D)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å12(6) 157D|A, 1AC3|A, 1AL5|A, 1CX5|A, 1YYK|C, 1YYO|C
745NR_all_05548.1
Exact match
1SDR|A (1SDR)
  • RNA (5'-R(*UP*AP*AP*GP*GP*AP*GP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å12(1) 1SDR|A
746NR_all_05726.1
Exact match
Homo sapiens
3MIJ|A (3MIJ)
  • RNA (5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å12(1) 3MIJ|A
747NR_all_06062.1
Exact match
280D|A (205D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*UP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.6 Å12(2) 205D|A, 280D|A
748NR_all_10471.1
Exact match
Aquifex aeolicus
3R2C|R (3R2C)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
1.9 Å12(1) 3R2C|R
749NR_all_11363.1
Exact match
Escherichia virus T7
1H38|F (1H38)
  • 5'-R(*AP*AP*CP*UP*GP*CP*GP*GP*CP*GP *AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): F
2.9 Å12(2) 1H38|F, 1S0V|F
750NR_all_14160.1
Exact match
3QJJ|Q (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Q
2.8 Å12(1) 3QJJ|Q
751NR_all_14802.1
Exact match
synthetic construct
4EYA|a (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): a
3.2 Å12(1) 4EYA|a
752NR_all_14942.1
Exact match
255D|A (255D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*CP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å12(1) 255D|A
753NR_all_17858.1
Exact match
3QJL|R (3QJL)
  • RNA (5'-R(*GP*UP*UP*AP*CP*AP*AP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.7 Å12(1) 3QJL|R
754NR_all_18257.1
Exact match
2JLZ|C (2JLZ)
  • 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å12(1) 2JLZ|C
755NR_all_20650.1
Exact match
2JLX|C (2JLX)
  • 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å12(2) 2JLX|C, 2JLY|C
756NR_all_23189.1
Exact match
Tetrahymena thermophila
1AJL|A (1AJL)
  • RNA (5'-R(*GP*GP*UP*AP*AP*UP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 1AJL|A
757NR_all_23968.1
Exact match
3GTL|R (3GTG)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.8 Å12(4) 3GTG|R, 3GTJ|R, 3GTL|R, 3GTO|R
758NR_all_28432.1
Exact match
1ZBI|C (1ZBI)
  • 5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.9 Å12(1) 1ZBI|C
759NR_all_30956.1
Exact match
1ZBL|C (1ZBL)
  • 5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å12(1) 1ZBL|C
760NR_all_31857.1
Exact match
1B7F|P (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
2.6 Å12(1) 1B7F|P
761NR_all_39746.1
Exact match
2Q1O|A (2G92)
  • 5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å12(2) 2G92|A, 2Q1O|A
762NR_all_41533.1
Exact match
283D|A (283D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å12(1) 283D|A
763NR_all_41632.1
Exact match
3SSF|A (3SSF)
  • 5'-R(*UP*AP*AP*AP*AP*GP*AP*AP*AP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å12(1) 3SSF|A
764NR_all_42781.1
Exact match
2KBP|A (2KBP)
  • 5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 2KBP|A
765NR_all_43702.1
Exact match
2ATW|B (2ATW)
  • ribosomal RNA (5'- AGAACUCAAUAG -3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å12(1) 2ATW|B
766NR_all_45265.1
Exact match
3AVW|T (3AVW)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
2.6 Å12(1) 3AVW|T
767NR_all_47255.1
Exact match
2PY9|E (2PY9)
  • 12-mer C-rich strand of human telomeric [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.6 Å12(1) 2PY9|E
768NR_all_48048.1
Exact match
3FTM|B (3FTM)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.7 Å12(1) 3FTM|B
769NR_all_48308.1
Exact match
3LRR|C (3LRR)
  • RNA (5'-R(*(ATP)P*UP*AP*UP*AP*UP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å12(1) 3LRR|C
770NR_all_51338.1
Exact match
1AJT|A (1AJT)
  • RNA (5'-R(*GP*GP*UP*AP*AP*UP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 1AJT|A
771NR_all_57397.1
Exact match
2F87|A (2F87)
  • SRP RNA
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 2F87|A
772NR_all_60030.1
Exact match
3AVU|T (3AVU)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
2.9 Å12(1) 3AVU|T
773NR_all_62193.1
Exact match
1AFX|A (1AFX)
  • RNA (5'-R(*GP*GP*UP*GP*UP*GP*AP*AP*CP*AP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 1AFX|A
774NR_all_63018.3
Exact match
1ZIG|A (1ZIF)
  • RNA (5'-R(*GP*GP*GP*CP*GP*AP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(3) 1ZIF|A, 1ZIG|A, 1ZIH|A
775NR_all_63195.1
Exact match
Saccharomyces cerevisiae
4A93|P (4A93)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
3.4 Å12(1) 4A93|P
776NR_all_63815.1
Exact match
Homo sapiens
3NNA|B (3NNA)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å12(1) 3NNA|B
777NR_all_67273.1
Exact match
1YYW|E (1YYW)
  • 5'-R(*AP*AP*AP*UP*AP*UP*AP*UP*AP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.8 Å12(1) 1YYW|E
778NR_all_69481.1
Exact match
Saccharomyces cerevisiae
2XNR|C (2XNR)
  • 5'-R(*UP*UP*CP*UP*UP*AP*UP*UP*CP*UP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.6 Å12(1) 2XNR|C
779NR_all_73356.1
Exact match
1RNG|A (1RNG)
  • RNA (5'-R(*GP*GP*CP*GP*CP*UP*UP*GP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 1RNG|A
780NR_all_75810.1
Exact match
1LNT|A (1LNT)
  • 5'-R(*GP*CP*GP*UP*CP*AP*GP*GP*UP*CP*(CBV[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.7 Å12(1) 1LNT|A
781NR_all_78825.1
Exact match
3ICE|G (3ICE)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
2.8 Å12(1) 3ICE|G
782NR_all_78898.1
Exact match
2JLU|C (2JLU)
  • 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.0 Å12(2) 2JLU|C, 2JLV|C
783NR_all_79463.1
Exact match
3BSU|D (3BSU)
  • RNA (5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.1 Å12(1) 3BSU|D
784NR_all_84637.1
Exact match
3HO1|Y (3HO1)
  • 5'-R(P*CP*CP*UP*AP*CP*UP*AP*CP*CP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Y
2.6 Å12(2) 3HO1|Y, 3HVR|D
785NR_all_84887.1
Exact match
2RQJ|A (2RQJ)
  • RNA (5'-R(*GP*GP*AP*GP*GP*AP*GP*GP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 2RQJ|A
786NR_all_88134.1
Exact match
2Q1R|A (2Q1R)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.1 Å12(1) 2Q1R|A
787NR_all_91342.1
Exact match
3IBK|A (3IBK)
  • RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.2 Å12(1) 3IBK|A
788NR_all_92732.1
Exact match
Escherichia coli
354D|A (354D)
  • RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.5 Å12(1) 354D|A
789NR_all_95095.1
Exact match
Homo sapiens
3NNH|E (3NNH)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.8 Å12(1) 3NNH|E
790NR_all_99895.1
Exact match
1ME1|A (1ME1)
  • 5'-R(*GP*GP*AP*CP*(U25)P*(U25)P*(C25)P*([...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
12(1) 1ME1|A
791NR_all_08326.1
Exact match
1QCU|A (1QCU)
  • 5'-R(P*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*G)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å11(1) 1QCU|A
792NR_all_13712.1
Exact match
3NCU|C (2KXZ)
  • 5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): C
11(4) 2KXZ|A, 2KY0|A, 2KY1|A, 3NCU|C
793NR_all_24262.1
Exact match
3R1D|A (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.5 Å11(1) 3R1D|A
794NR_all_30077.1
Exact match
3FS0|B (3FS0)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å11(1) 3FS0|B
795NR_all_32716.1
Exact match
2NUG|C (2NUG)
  • 5'-R(P*AP*AP*GP*GP*UP*CP*AP*UP*UP*CP*G)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.7 Å11(1) 2NUG|C
796NR_all_37056.1
Exact match
1TUT|A (1TUT)
  • 5'-R(*GP*AP*GP*GP*AP*AP*GP*GP*CP*GP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
11(1) 1TUT|A
797NR_all_47977.1
Exact match
2JXS|A (2JXS)
  • 5'-R(*GP*CP*AP*GP*AP*AP*GP*AP*GP*CP*G)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
11(1) 2JXS|A
798NR_all_49652.1
Exact match
1CVJ|M (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): M
2.6 Å11(1) 1CVJ|M
799NR_all_63743.1
Exact match
1K1G|B (1K1G)
  • 5'-R(*UP*AP*UP*AP*CP*UP*AP*AP*CP*AP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
11(1) 1K1G|B
800NR_all_69593.1
Exact match
1KD5|A (1KD3)
  • 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å11(3) 1KD3|A, 1KD4|A, 1KD5|A
801NR_all_80531.1
Exact match
3BSX|C (3BSX)
  • 5'-R(*UP*UP*GP*UP*AP*AP*UP*AP*UP*UP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.3 Å11(1) 3BSX|C
802NR_all_87340.1
Exact match
3AEV|C (3AEV)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*CP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å11(1) 3AEV|C
803NR_all_89095.1
Exact match
2L8F|A (2L8F)
  • RNA (5'-R(*GP*UP*GP*AP*AP*GP*CP*CP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
11(1) 2L8F|A
804NR_all_92057.1
Exact match
2ASB|B (2ASB)
  • ribosomal RNA (5'- GAACUCAAUAG -3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.5 Å11(1) 2ASB|B
805NR_all_95573.1
Exact match
1BMV|M (1BMV)
  • RNA (5'-R(*GP*GP*UP*CP*AP*AP*AP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): M
3.0 Å11(1) 1BMV|M
806NR_all_98972.1
Exact match
1YZ9|C (1YZ9)
  • 5'-R(*CP*GP*AP*AP*CP*UP*UP*CP*GP*CP*G)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.1 Å11(1) 1YZ9|C
807NR_all_02201.2
Exact match
1DI2|C (1DI2)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.9 Å10(5) 1DI2|C, 1FIX|A, 1RC7|B, 2YKG|C, 3ADL|B
808NR_all_03430.1
Exact match
1R4H|A (1R4H)
  • 5'-R(*GP*GP*GP*CP*AP*AP*GP*CP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(1) 1R4H|A
809NR_all_11772.1
Exact match
3NJ7|A (3NJ7)
  • 5'-R(*GP*GP*CP*AP*GP*CP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å10(1) 3NJ7|A
810NR_all_12195.1
Exact match
2BBV|N (2BBV)
  • RNA (5'-R(*UP*CP*UP*UP*AP*UP*AP*UP*CP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): N
2.8 Å10(1) 2BBV|N
811NR_all_13365.1
Exact match
2AO5|A (2AO5)
  • 5'-R(*GP*GP*CP*GP*(5BU)P*GP*CP*GP*CP*U)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å10(1) 2AO5|A
812NR_all_15805.1
Exact match
2JXQ|A (2JXQ)
  • RNA (5'-R(*GP*CP*AP*GP*AP*GP*AP*GP*CP*G)[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(1) 2JXQ|A
813NR_all_18129.1
Exact match
3K49|B (3K49)
  • RNA (5'-R(*CP*CP*UP*GP*UP*AP*AP*AP*UP*A)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.5 Å10(2) 3K49|B, 3K4E|B
814NR_all_19969.1
Exact match
3ADI|D (3ADI)
  • RNA (5'-R(P*CP*UP*CP*GP*AP*UP*AP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.2 Å10(1) 3ADI|D
815NR_all_29898.1
Exact match
3I5X|B (3I5X)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å10(3) 3I5X|B, 3I61|B, 3I62|B
816NR_all_30550.1
Exact match
1MSW|R (1MSW)
  • RNA message
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.1 Å10(1) 1MSW|R
817NR_all_31273.1
Exact match
Saccharomyces cerevisiae
1LPW|B (1LPW)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*AP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
10(1) 1LPW|B
818NR_all_32136.1
Exact match
3FHT|C (3FHT)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å10(2) 3FHT|C, 3G0H|E
819NR_all_36009.1
Exact match
3OK4|2 (219D)
  • DNA (5'-D(*GP*CP*TP*AP*TP*AP*AP*TP*GP*G)[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): 2
10(6) 219D|A, 2BJ6|A, 2KP3|A, 2KP4|A, 3OK2|B, 3OK4|2
820NR_all_37357.1
Exact match
1G2E|B (1G2E)
  • 5'-R(P*UP*AP*UP*UP*UP*AP*UP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å10(1) 1G2E|B
821NR_all_44124.1
Exact match
Saccharomyces cerevisiae
1LMV|B (1LMV)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*AP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
10(1) 1LMV|B
822NR_all_44269.1
Exact match
2PO1|C (2PO1)
  • 10-mer poly(A)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.9 Å10(1) 2PO1|C
823NR_all_46698.1
Exact match
2DB3|E (2DB3)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.2 Å10(1) 2DB3|E
824NR_all_53425.2
Exact match
1N35|C (1N35)
  • 5'-R(*AP*UP*UP*AP*GP*CP*CP*CP*CP*C)-3', [...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å10(2) 1N35|C, 1UON|C
825NR_all_56938.1
Exact match
Escherichia coli
2C4R|R (2C4R)
  • SSRNA MOLECULE: 5'-R(*AP*CP*AP*GP*UP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.6 Å10(1) 2C4R|R
826NR_all_63639.1
Exact match
3SQW|B (3SQW)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å10(2) 3SQW|B, 3SQX|B
827NR_all_64737.1
Exact match
3NJ6|A (3NJ6)
  • 5'-R(*GP*GP*CP*AP*GP*CP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.0 Å10(1) 3NJ6|A
828NR_all_72619.1
Exact match
3PKM|G (3PKM)
  • 5'-R(*AP*UP*UP*AP*CP*AP*AP*UP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
3.1 Å10(1) 3PKM|G
829NR_all_72992.1
Exact match
1DQH|B (1DQF)
  • RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.2 Å10(2) 1DQF|B, 1DQH|B
830NR_all_74930.1
Exact match
1XV0|A (1XV0)
  • 5'-R(*GP*GP*UP*GP*GP*AP*GP*GP*CP*U)-3', [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(4) 1XV0|A, 2DD1|A, 2DD2|A, 2DD3|A
831NR_all_76767.1
Exact match
1M8Y|C (1M8Y)
  • 5'-R(P*AP*UP*UP*GP*UP*AP*CP*AP*UP*A)-3',[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å10(2) 1M8Y|C, 2YJY|C
832NR_all_80032.1
Exact match
3I5Y|B (3I5Y)
  • 5'-R(*UP*UP*UP*(5BU)P*UP*UP*UP*UP*UP*U)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.5 Å10(1) 3I5Y|B
833NR_all_82728.1
Exact match
Saccharomyces cerevisiae
2VNU|B (2VNU)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å10(1) 2VNU|B
834NR_all_87848.1
Exact match
1DRR|A (1DRR)
  • DNA (5'-D(*GP*AP*AP*GP*AP*GP*AP*AP*GP*C)[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(1) 1DRR|A
835NR_all_91301.1
Exact match
1RRR|A (1A34)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å10(34) 1A34|B, 1EFO|B, 1G4Q|A, 1JB8|A, 1OO7|A, 1PJG|A, 1PJO|A, 1R9S|R, 1R9T|R, 1RRD|A, 1RRR|A, 1SFO|R, 1Y1W|P, 1Y77|P, 2E2H|R, 2E2I|R, 2JA5|P, 2JA6|P, 2JA7|3, 2JA8|P, 2NVQ|R, 2NVT|R, 2NVX|R, 2NVZ|R, 2R7Z|P, 2VUM|P, 2YU9|R, 3HOV|P, 3HOX|P, 3HOY|P, 3I4M|P, 3I4N|P, 3M4O|R, 404D|A
836NR_all_91589.1
Exact match
1YVP|C (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å10(1) 1YVP|C
837NR_all_94926.1
Exact match
1FNX|R (1FNX)
  • AU-RICH RNA ELEMENT
  • SOLUTION NMR
  • Chain(s): ; model(s): R
10(1) 1FNX|R
838NR_all_95402.1
Exact match
1IDV|A (1IDV)
  • HEPATITIS C IRES RNA DOMAIN IIIC
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(1) 1IDV|A
839NR_all_97919.1
Exact match
1F5G|A (1F5G)
  • 5'-R(*GP*CP*AP*GP*GP*CP*GP*UP*GP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
10(2) 1F5G|A, 1F5H|A
840NR_all_00102.1
Exact match
2E9R|A (2E9R)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å9(1) 2E9R|A
841NR_all_00212.1
Exact match
438D|A (438D)
  • RNA (5'-R(*GP*GP*GP*CP*GP*CP*UP*CP*C)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å9(1) 438D|A
842NR_all_02216.1
Exact match
1MV2|A (1MV2)
  • 5'-R(*GP*GP*CP*AP*(P5P)P*GP*CP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1MV2|A
843NR_all_04480.1
Exact match
3K5Z|B (3K5Z)
  • 5'-R(*UP*GP*UP*AP*CP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.4 Å9(1) 3K5Z|B
844NR_all_04668.1
Exact match
2IRO|A (2IRO)
  • 5'-R(P*GP*CP*GP*GP*AP*UP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2IRO|A
845NR_all_05052.1
Exact match
1FXL|B (1FXL)
  • 5'-R(P*UP*UP*UP*UP*AP*UP*UP*UP*U)-3', 5'[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.8 Å9(2) 1FXL|B, 4ED5|C
846NR_all_07639.1
Exact match
3BSB|C (3BSB)
  • 5'-R(*UP*UP*UP*AP*AP*UP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å9(1) 3BSB|C
847NR_all_13460.1
Exact match
3GIB|H (3GIB)
  • 5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): H
2.4 Å9(1) 3GIB|H
848NR_all_13884.1
Exact match
1OKF|A (1H0Q)
  • 5-D(*(LKC)P*(TLN)P*(LCG)P*(LCA)P*(TLN)P*[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(5) 1H0Q|A, 1HG9|A, 1HHW|A, 1HHX|A, 1OKF|A
849NR_all_14599.1
Exact match
3MJ0|B (3MJ0)
  • RNA (5'-R(*CP*GP*UP*UP*AP*CP*GP*CP*(OMU)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å9(1) 3MJ0|B
850NR_all_14849.1
Exact match
3K5Q|B (3K5Q)
  • 5'-R(P*UP*GP*UP*AP*CP*UP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.2 Å9(1) 3K5Q|B
851NR_all_14965.1
Exact match
1C4L|A (1C4L)
  • RNA (5'-R(*CP*GP*AP*CP*UP*CP*AP*GP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1C4L|A
852NR_all_19161.1
Exact match
2L8U|A (2L8U)
  • RNA (5'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2L8U|A
853NR_all_20362.1
Exact match
3K64|B (3K64)
  • 5'-R(*UP*GP*UP*GP*UP*CP*AP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.0 Å9(1) 3K64|B
854NR_all_21928.1
Exact match
1MV1|A (1MV1)
  • 5'-R(*GP*GP*CP*(P5P)P*AP*GP*CP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1MV1|A
855NR_all_22889.1
Exact match
479D|A (2DQO)
  • DNA (5'-D(*DCP*(OMU)P*DCP*DTP*(OMU)P*DCP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å9(4) 2DQO|A, 2DQP|A, 2DQQ|A, 479D|A
856NR_all_25516.1
Exact match
1NAO|A (1NAO)
  • RNA (5'-R(*GP*GP*AP*GP*AP*UP*GP*AP*C)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1NAO|A
857NR_all_30108.1
Exact match
1S77|R (1S76)
  • RNA (5'-R(P*AP*CP*AP*CP*GP*GP*CP*GP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å9(2) 1S76|R, 1S77|R
858NR_all_31302.1
Exact match
2K41|A (2K41)
  • RNA_(5'-R(*GP*UP*CP*GP*UP*GP*CP*UP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2K41|A
859NR_all_32748.1
Exact match
3BX2|C (3BX2)
  • HO endonuclease 3' UTR binding sequence
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å9(1) 3BX2|C
860NR_all_35244.1
Exact match
2O83|A (2O83)
  • 5'-R(*GP*GP*(IC)P*GP*AP*(IG)P*CP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2O83|A
861NR_all_35902.1
Exact match
1MV6|A (1MV6)
  • 5'-R(*GP*GP*CP*(P5P)P*(P5P)P*GP*CP*CP*U)[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1MV6|A
862NR_all_37243.1
Exact match
2K3Z|A (2K3Z)
  • RNA_(5'-R(*GP*UP*CP*GP*AP*GP*CP*UP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2K3Z|A
863NR_all_46336.1
Exact match
3BSN|T (3BSN)
  • RNA (5'-R(*UP*GP*CP*CP*CP*GP*GP*GP*(N5M)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
1.8 Å9(1) 3BSN|T
864NR_all_47528.1
Exact match
3QRP|B (3QRP)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*(PGP)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.4 Å9(1) 3QRP|B
865NR_all_48586.1
Exact match
2G91|A (2G91)
  • 5'-R(*GP*GP*UP*GP*CP*GP*CP*(CBR)P*C-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.5 Å9(1) 2G91|A
866NR_all_51641.1
Exact match
1NTT|A (1NTQ)
  • 5'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(3) 1NTQ|A, 1NTS|A, 1NTT|A
867NR_all_55421.1
Exact match
4DZS|C (4DZS)
  • 5'-R(*UP*GP*UP*AP*UP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.1 Å9(1) 4DZS|C
868NR_all_55497.1
Exact match
1J9H|A (1J9H)
  • 5'-R(*GP*UP*GP*UP*CP*GP*(CBR)P*AP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å9(1) 1J9H|A
869NR_all_60970.1
Exact match
165D|A (165D)
  • DNA/RNA (5'-R(*GP*CP*UP*UP*CP*GP*GP*CP*)[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å9(1) 165D|A
870NR_all_61207.1
Exact match
2L8W|A (2L8C)
  • RNA (5'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(2) 2L8C|A, 2L8W|A
871NR_all_61549.2
Exact match
1C2Q|A (1C2Q)
  • 5'-D(ATGG-3'-3'-(T3P)-5'-5'-GCTC)-3', DN[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(3) 1C2Q|A, 2LAR|A, 2LB4|A
872NR_all_62131.1
Exact match
1ZH5|C (1YTY)
  • 5'-R(*UP*GP*CP*UP*GP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.3 Å9(2) 1YTY|C, 1ZH5|C
873NR_all_62306.1
Exact match
1SI3|B (1SI3)
  • 5'-R(*CP*GP*UP*GP*AP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.6 Å9(1) 1SI3|B
874NR_all_63215.1
Exact match
3K62|B (3K62)
  • 5'-R(*UP*GP*UP*GP*UP*UP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.9 Å9(1) 3K62|B
875NR_all_72368.1
Exact match
3K5Y|B (3K5Y)
  • 5'-R(*UP*GP*UP*GP*CP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å9(2) 3K5Y|B, 3QGB|B
876NR_all_73389.1
Exact match
1I6H|R (1I6H)
  • 5'-R(P*GP*AP*CP*CP*AP*GP*GP*CP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.3 Å9(1) 1I6H|R
877NR_all_74719.1
Exact match
Vanderwaltozyma polyspora
4F1N|E (4F1N)
  • RNA 5'-R(P*UP*AP*AP*AP*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.2 Å9(1) 4F1N|E
878NR_all_75988.1
Exact match
2KY2|A (2KY2)
  • 5'-R(*GP*GP*UP*AP*GP*GP*CP*CP*A)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2KY2|A
879NR_all_79050.1
Exact match
3BSO|T (3BSO)
  • RNA (5'-R(P*UP*GP*CP*CP*CP*GP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
1.7 Å9(3) 3BSO|T, 3H5X|T, 3H5Y|T
880NR_all_79529.1
Exact match
2IRN|A (2IRN)
  • 5'-R(P*GP*CP*UP*GP*AP*GP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2IRN|A
881NR_all_79635.1
Exact match
1MUV|A (1MUV)
  • 5'-R(*GP*GP*CP*AP*AP*GP*CP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 1MUV|A
882NR_all_82621.1
Exact match
2O81|A (2O81)
  • 5'-R(*GP*CP*(IG)P*GP*AP*(IC)P*GP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2O81|A
883NR_all_83157.1
Exact match
3S17|R (2E2J)
  • 5'-R(P*AP*UP*CP*GP*AP*GP*AP*GP*G)-3', RN[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.5 Å9(2) 2E2J|R, 3S17|R
884NR_all_84385.1
Exact match
2E9Z|B (2E9Z)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.0 Å9(1) 2E9Z|B
885NR_all_86511.1
Exact match
Escherichia coli
4AM3|D (4AM3)
  • RNA, 5'-R(*UP*AP*AP*CP*UP*UP*UP*GP*GP)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.0 Å9(1) 4AM3|D
886NR_all_87620.1
Exact match
1RGO|D (1RGO)
  • RNA (5'-R(*UP*UP*AP*UP*UP*UP*AP*UP*U)-3'[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): D
9(1) 1RGO|D
887NR_all_87802.1
Exact match
3K61|B (3K61)
  • 5'-R(*UP*GP*UP*AP*AP*AP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.2 Å9(1) 3K61|B
888NR_all_88132.1
Exact match
3QGC|B (3QG9)
  • 5'-R(*UP*GP*UP*GP*CP*CP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.3 Å9(2) 3QG9|B, 3QGC|B
889NR_all_92816.1
Exact match
421D|A (2GUN)
  • 5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3', DNA[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.8 Å9(2) 2GUN|B, 421D|A
890NR_all_95158.1
Exact match
1JZV|B (1JZV)
  • 5'-R(*CP*AP*GP*UP*AP*CP*GP*(5IC)P*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.7 Å9(1) 1JZV|B
891NR_all_96906.1
Exact match
2H49|A (2H49)
  • 5'-R(*GP*GP*CP*UP*AP*AP*GP*AP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
9(1) 2H49|A
892NR_all_97728.1
Exact match
Homo sapiens
2YH1|B (2YH1)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
9(1) 2YH1|B
893NR_all_02403.1
Exact match
Mus musculus
2XS2|B (2XS2)
  • 5'-R(*UP*UP*GP*UP*UP*CP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.4 Å8(1) 2XS2|B
894NR_all_02633.1
Exact match
3R1E|A (3R1E)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.0 Å8(1) 3R1E|A
895NR_all_02748.1
Exact match
3Q0R|B (3Q0M)
  • 5'-R(UP*GP*UP*AP*GP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.7 Å8(2) 3Q0M|C, 3Q0R|B
896NR_all_03257.1
Exact match
1M8W|C (1M8W)
  • 5'-R(P*UP*UP*GP*UP*AP*UP*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å8(2) 1M8W|C, 1M8X|C
897NR_all_04507.1
Exact match
8DRH|A (8DRH)
  • DNA (5'-D(*GP*CP*GP*TP*CP*AP*GP*G)-3'), [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(2) 8DRH|A, 8PSH|A
898NR_all_08316.1
Exact match
2EC0|B (2EC0)
  • 5'-R(P*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å8(1) 2EC0|B
899NR_all_08686.1
Exact match
3RER|K (3RER)
  • 5'-R(*AP*UP*UP*UP*UP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): K
1.7 Å8(1) 3RER|K
900NR_all_09098.1
Exact match
1QES|A (1QES)
  • RNA (5'-R(*GP*GP*AP*GP*UP*UP*CP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1QES|A
901NR_all_10280.1
Exact match
2OJ7|A (2OJ7)
  • 5'-R(P*GP*CP*UP*GP*UP*UP*GP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 2OJ7|A
902NR_all_10806.1
Exact match
1XPO|G (1XPO)
  • 5'-R(*CP*UP*CP*UP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
3.2 Å8(1) 1XPO|G
903NR_all_15154.1
Exact match
1XPR|G (1XPR)
  • 5'-R(*CP*UP*CP*UP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
3.2 Å8(1) 1XPR|G
904NR_all_19448.1
Exact match
2OJ8|A (2OJ8)
  • 5'-R(P*GP*CP*UP*GP*UP*UP*GP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 2OJ8|A
905NR_all_21601.1
Exact match
1NXR|A (1NXR)
  • DNA (5'-D(*CP*AP*GP*TP*CP*CP*TP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1NXR|A
906NR_all_21775.1
Exact match
3L26|C (3L26)
  • RNA (5'-R(*CP*GP*CP*AP*UP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.4 Å8(1) 3L26|C
907NR_all_23344.1
Exact match
402D|A (402D)
  • RNA(5'-R(*CP*GP*CP*CP*AP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å8(1) 402D|A
908NR_all_24689.1
Exact match
2BGG|P (2BGG)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
2.2 Å8(1) 2BGG|P
909NR_all_28965.1
Exact match
Spodoptera frugiperda
3LOB|R (3LOB)
  • RNA (5'-R(*UP*UP*U*AP*UP*CP*UP*(P))-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.6 Å8(1) 3LOB|R
910NR_all_31563.1
Exact match
1G2J|A (1G2J)
  • 5'-R(*CP*CP*CP*(PYY)P*GP*GP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å8(1) 1G2J|A
911NR_all_31885.1
Exact match
1R3X|A (1R3X)
  • DNA (5'-D(*AP*GP*AP*GP*AP*GP*AP*A)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1R3X|A
912NR_all_32282.1
Exact match
2KD4|A (2KD4)
  • 5'-R(*GP*CP*CP*GP*CP*GP*GP*C)-2'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 2KD4|A
913NR_all_33185.1
Exact match
Hepatitis B virus
2IXZ|A (2IXZ)
  • 5'-R(*GP*CP*UP*GP*UP*GP*CP*CP)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 2IXZ|A
914NR_all_34548.1
Exact match
3Q0S|B (3Q0N)
  • 5'-R(UP*GP*UP*AP*CP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.4 Å8(2) 3Q0N|C, 3Q0S|B
915NR_all_36048.1
Exact match
3BX3|C (3BX3)
  • COX17 RNA target sequence
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å8(1) 3BX3|C
916NR_all_39230.1
Exact match
1MIS|A (1MIS)
  • RNA (5'-R(*GP*CP*GP*GP*AP*CP*GP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1MIS|A
917NR_all_40707.1
Exact match
1XPU|G (1XPU)
  • 5'-R(*CP*UP*CP*UP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
3.1 Å8(1) 1XPU|G
918NR_all_41157.1
Exact match
Escherichia coli
3T5Q|C (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
3.0 Å8(1) 3T5Q|C
919NR_all_41515.1
Exact match
1YFV|A (1SA9)
  • 5'-R(*GP*GP*CP*GP*AP*GP*CP*C)-3', RNA (5[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å8(2) 1SA9|A, 1YFV|A
920NR_all_42416.1
Exact match
1EKD|A (1EKD)
  • RNA (5'-R(*GP*GP*CP*GP*UP*GP*CP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1EKD|A
921NR_all_43909.1
Exact match
2E9T|B (2E9T)
  • 5'-R(P*UP*AP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.6 Å8(1) 2E9T|B
922NR_all_44995.1
Exact match
1MWG|A (1MWG)
  • RNA (5'-R(*GP*GP*CP*AP*GP*GP*CP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1MWG|A
923NR_all_45827.1
Exact match
2G3S|A (2G3S)
  • 5'-R(*GP*GP*CP*GP*UP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.5 Å8(1) 2G3S|A
924NR_all_47489.1
Exact match
472D|A (472D)
  • RNA (5'-R(*GP*UP*GP*UP*UP*UP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å8(1) 472D|A
925NR_all_48227.1
Exact match
398D|A (398D)
  • RNA (5'-R(*GP*CP*AP*GP*UP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å8(1) 398D|A
926NR_all_49403.1
Exact match
3L25|C (3L25)
  • RNA (5'-R(*CP*GP*CP*AP*UP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.0 Å8(1) 3L25|C
927NR_all_51422.1
Exact match
2A0P|A (2A0P)
  • 5'-R(*CP*CP*(S4C)P*CP*GP*GP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å8(1) 2A0P|A
928NR_all_51786.1
Exact match
1RXA|A (1RXA)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.9 Å8(1) 1RXA|A
929NR_all_53000.1
Exact match
439D|A (439D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å8(1) 439D|A
930NR_all_54704.1
Exact match
1EKA|A (1EKA)
  • RNA (5'-R(*GP*AP*GP*UP*GP*CP*UP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1EKA|A
931NR_all_58405.1
Exact match
3P4B|A (3P4B)
  • 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.5 Å8(1) 3P4B|A
932NR_all_58583.1
Exact match
3R1C|A (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å8(1) 3R1C|A
933NR_all_66578.1
Exact match
3P4D|A (3P4D)
  • 5'-R(*(CFZ)P*CP*(CFZ)P*CP*(GF2)P*GP*(GF2[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.9 Å8(1) 3P4D|A
934NR_all_67753.1
Exact match
3S16|R (3S16)
  • RNA (5'-R(*UP*CP*GP*AP*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.2 Å8(1) 3S16|R
935NR_all_69388.1
Exact match
2R7T|X (2R7T)
  • RNA (5'-R(*UP*GP*UP*GP*AP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
3.0 Å8(1) 2R7T|X
936NR_all_70110.1
Exact match
1BYX|A (1BYX)
  • RNA (5'-R(*GP*CP*AP*GP*UP*GP*GP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1BYX|A
937NR_all_71378.1
Exact match
3Q0P|C (3Q0P)
  • 5'-R(UP*GP*UP*AP*UP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å8(1) 3Q0P|C
938NR_all_71494.1
Exact match
333D|A (333D)
  • RNA (5'-R(*CP*GP*CP*AP*IP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å8(1) 333D|A
939NR_all_72472.1
Exact match
3P4C|A (3P4C)
  • 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å8(1) 3P4C|A
940NR_all_72646.1
Exact match
259D|A (1RXB)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å8(2) 1RXB|A, 259D|A
941NR_all_72863.1
Exact match
3GLP|A (3GLP)
  • 5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å8(1) 3GLP|A
942NR_all_73144.1
Exact match
1QET|A (1QET)
  • RNA (5'-R(*GP*GP*AP*UP*GP*UP*CP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1QET|A
943NR_all_74194.1
Exact match
Saccharomyces cerevisiae
2CJK|B (2CJK)
  • 5'-R(*UP*AP*UP*AP*UP*AP*UP*AP)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
8(1) 2CJK|B
944NR_all_76080.1
Exact match
409D|A (409D)
  • RNA (5'-R(*CP*CP*CP*IP*UP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.5 Å8(1) 409D|A
945NR_all_76504.1
Exact match
3Q0Q|B (3Q0L)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.5 Å8(2) 3Q0L|C, 3Q0Q|B
946NR_all_77586.1
Exact match
124D|A (124D)
  • DNA (5'-D(*GP*TP*CP*AP*CP*AP*TP*G)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 124D|A
947NR_all_79884.1
Exact match
3QJP|R (3QJP)
  • RNA (5'-R(P*UP*AP*GP*UP*UP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.3 Å8(1) 3QJP|R
948NR_all_84410.1
Exact match
Thermus thermophilus
2GQ6|K (2G32)
  • RNA (5'-R(*(0C)P*(0U)P*(0G)P*(0G)P*(0G)P[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): K
1.3 Å8(6) 2G32|K, 2GPM|K, 2GQ4|K, 2GQ5|K, 2GQ6|K, 2GQ7|K
949NR_all_86061.1
Exact match
3EQT|C (3EQT)
  • 5'-R(*GP*CP*GP*CP*GP*CP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.0 Å8(1) 3EQT|C
950NR_all_87684.1
Exact match
synthetic construct
2XFM|B (2XFM)
  • 5'-R(*AP*CP*CP*GP*AP*CP*UP*(OMU)P)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
8(1) 2XFM|B
951NR_all_89315.1
Exact match
1SAQ|A (1SAQ)
  • 5'-R(*GP*IP*CP*GP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.7 Å8(1) 1SAQ|A
952NR_all_90669.1
Exact match
1GUC|A (1GUC)
  • RNA (5'-R(*GP*AP*GP*GP*UP*CP*UP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
8(1) 1GUC|A
953NR_all_92968.1
Exact match
synthetic construct
3E3J|R (3E3J)
  • RNA (5'-R(*GP*GP*GP*AP*GP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
6.7 Å8(1) 3E3J|R
954NR_all_93028.1
Exact match
3Q0O|C (3Q0O)
  • 5'-R(UP*GP*UP*AP*CP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å8(1) 3Q0O|C
955NR_all_93963.1
Exact match
3S49|A (3S49)
  • RNA (5'-R(*GP*UP*AP*UP*AP*(RUS)P*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.3 Å8(1) 3S49|A
956NR_all_94043.1
Exact match
3KNC|B (1EJZ)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3'), [...]
  • SOLUTION NMR
  • Chain(s): ; model(s): B
8(2) 1EJZ|A, 3KNC|B
957NR_all_95624.1
Exact match
1ZDJ|R (1ZDJ)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å8(1) 1ZDJ|R
958NR_all_96001.1
Exact match
1WNE|B (1WNE)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.0 Å8(1) 1WNE|B
959NR_all_01654.1
Exact match
1KQ2|R (1KQ2)
  • 5'-R(*AP*UP*UP*UP*UP*UP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.7 Å7(1) 1KQ2|R
960NR_all_02798.1
Exact match
synthetic construct
1UVJ|D (1UVJ)
  • 5'-R(*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
1.9 Å7(1) 1UVJ|D
961NR_all_12128.1
Exact match
466D|A (434D)
  • RNA (5'-R(*UP*AP*GP*CP*UP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å7(3) 434D|A, 464D|A, 466D|A
962NR_all_17142.1
Exact match
Homo sapiens
2V7R|A (2V7R)
  • HUMAN TRNAGLY MICROHELIX
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å7(1) 2V7R|A
963NR_all_20027.1
Exact match
Homo sapiens
2VUQ|A (2VUQ)
  • 5'-R(*GP*CP*AP*UP*UP*GP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å7(1) 2VUQ|A
964NR_all_21849.1
Exact match
Saccharomyces cerevisiae
4A3L|P (4A3L)
  • 5'-R(*AP*CP*CP*AP*GP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
3.5 Å7(1) 4A3L|P
965NR_all_23337.1
Exact match
synthetic construct
3E2E|R (3E2E)
  • RNA (5'-R(*GP*GP*GP*AP*GP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.0 Å7(1) 3E2E|R
966NR_all_25589.1
Exact match
Escherichia coli
2VAL|A (2VAL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å7(1) 2VAL|A
967NR_all_25775.1
Exact match
3KMS|B (3KLV)
  • RNA (5'-R(*AP*UP*GP*GP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.6 Å7(3) 3KLV|B, 3KMS|B, 3KNA|B
968NR_all_29921.1
Exact match
Thermus thermophilus
2XSL|A (2XSL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.6 Å7(1) 2XSL|A
969NR_all_33206.1
Exact match
1WPU|C (1WPU)
  • 5'-R(*UP*UP*GP*AP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.5 Å7(1) 1WPU|C
970NR_all_34301.1
Exact match
435D|A (435D)
  • RNA (5'-R(*UP*AP*GP*CP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å7(1) 435D|A
971NR_all_34684.1
Exact match
3NL0|B (3NL0)
  • 5'-R(P*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.6 Å7(1) 3NL0|B
972NR_all_36492.1
Exact match
1WWE|B (1WWE)
  • 5'-R(P*UP*UP*UP*UP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
7(1) 1WWE|B
973NR_all_38362.1
Exact match
2K65|A (2K65)
  • 5'-R(*GP*GP*CP*AP*CP*UP*G)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
7(1) 2K65|A
974NR_all_40481.1
Exact match
Escherichia coli
2V6W|A (2V6W)
  • 5'-R(*GP*GP*AP*GP*AP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å7(1) 2V6W|A
975NR_all_41836.1
Exact match
1WWF|B (1WWF)
  • 5'-R(P*CP*CP*UP*CP*CP*GP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
7(1) 1WWF|B
976NR_all_44942.1
Exact match
3AVT|T (3AVT)
  • RNA (5'-R(*AP*UP*CP*GP*CP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): T
2.6 Å7(1) 3AVT|T
977NR_all_46673.1
Exact match
Homo sapiens
2VOO|C (2VOO)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.8 Å7(1) 2VOO|C
978NR_all_49342.1
Exact match
3GVN|A (3GVN)
  • 5'-R(*GP*GP*UP*GP*AP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.2 Å7(1) 3GVN|A
979NR_all_52586.1
Exact match
synthetic construct
4A3K|P (4A3K)
  • 5'-R(*AP*CP*CP*AP*GP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
3.5 Å7(1) 4A3K|P
980NR_all_57866.1
Exact match
3PF4|R (3PF4)
  • hexaribonucleotide (rGUCUUUA)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
1.4 Å7(1) 3PF4|R
981NR_all_64692.1
Exact match
2R7U|X (2R7U)
  • RNA (5'-R(*AP*A*AP*AP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
3.1 Å7(1) 2R7U|X
982NR_all_66256.1
Exact match
1M8V|O (1M8V)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): O
2.6 Å7(1) 1M8V|O
983NR_all_66285.1
Exact match
Homo sapiens
2VOD|C (2VOD)
  • 5'-R(*AP*UP*AP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.1 Å7(1) 2VOD|C
984NR_all_66396.1
Exact match
synthetic construct
2XZO|D (2XZO)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.4 Å7(1) 2XZO|D
985NR_all_67637.1
Exact match
3S15|R (3S15)
  • RNA (5'-R(*CP*GP*AP*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.3 Å7(1) 3S15|R
986NR_all_68190.1
Exact match
1WMQ|C (1WMQ)
  • 5'-R(P*UP*UP*UP*AP*GP*UP*U)-3', 5'-R(*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.6 Å7(2) 1WMQ|C, 1WRQ|C
987NR_all_72153.1
Exact match
1L3Z|A (1L3Z)
  • 5'-R(*GP*UP*AP*UP*AP*CP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å7(1) 1L3Z|A
988NR_all_79894.1
Exact match
1DDL|D (1DDL)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.7 Å7(1) 1DDL|D
989NR_all_80892.1
Exact match
Homo sapiens
2VON|C (2VON)
  • 5'-R(*AP*UP*AP*AP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.1 Å7(1) 2VON|C
990NR_all_81632.1
Exact match
2R7W|X (2R7R)
  • RNA (5'-R(*UP*GP*UP*GP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.6 Å7(3) 2R7R|X, 2R7W|X, 2R7X|X
991NR_all_83028.1
Exact match
2ERR|B (2ERR)
  • UGCAUGU
  • SOLUTION NMR
  • Chain(s): ; model(s): B
7(1) 2ERR|B
992NR_all_84083.1
Exact match
2LI8|B (2LI8)
  • RNA (5'-R(*AP*GP*GP*AP*GP*AP*U)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): B
7(1) 2LI8|B
993NR_all_87124.1
Exact match
3HSB|X (3HSB)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.2 Å7(1) 3HSB|X
994NR_all_88041.1
Exact match
Escherichia coli
2W89|A (2W89)
  • 5'-R(*GP*CP*AP*UP*CP*CP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å7(1) 2W89|A
995NR_all_90077.1
Exact match
2G4B|B (2G4B)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.5 Å7(1) 2G4B|B
996NR_all_93841.1
Exact match
Escherichia coli
2WJ8|a (2WJ8)
  • RNA (5'-R(*CP*CP*CP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): a
3.3 Å7(1) 2WJ8|a
997NR_all_00344.1
Exact match
2ADB|B (2ADB)
  • 5'-R(*CP*UP*CP*UP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2ADB|B
998NR_all_00969.1
Exact match
2KFY|B (2KFY)
  • 5'-R(*AP*GP*GP*GP*AP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2KFY|B
999NR_all_01092.1
Exact match
3O8C|C (3O8C)
  • RNA (5'-R(P*UP*(5BU)P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.0 Å6(1) 3O8C|C
1000NR_all_01174.1
Exact match
1MDG|A (1MDG)
  • 5'-R(*UP*(BGM)GP*AP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.5 Å6(1) 1MDG|A
1001NR_all_01854.1
Exact match
1G3A|A (1G3A)
  • 5'-R(*CP*(IG)P*CP*GP*(IC)P*G)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
6(1) 1G3A|A
1002NR_all_04933.1
Exact match
2R7S|X (2R7S)
  • RNA (5'-R(*UP*GP*UP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
3.2 Å6(1) 2R7S|X
1003NR_all_05051.1
Exact match
1PGL|3 (1PGL)
  • 5'-R(*AP*GP*UP*CP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 3
2.8 Å6(1) 1PGL|3
1004NR_all_05369.1
Exact match
2GXB|E (1T4X)
  • RNA (5'-R(*CP*GP*CP*GP*CP*G)-3'), 5'-R(P[...]
  • SOLUTION NMR
  • Chain(s): ; model(s): E
6(2) 1T4X|A, 2GXB|E
1005NR_all_06260.1
Exact match
2RQC|B (2RQC)
  • 5'-R(*UP*GP*UP*GP*UP*G)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2RQC|B
1006NR_all_07097.1
Exact match
synthetic construct
1UVN|B (1UVN)
  • 5'-R(*UP*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
3.0 Å6(1) 1UVN|B
1007NR_all_08949.1
Exact match
3D2S|E (3D2S)
  • 5'-R(*CP*GP*CP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
1.7 Å6(1) 3D2S|E
1008NR_all_11807.1
Exact match
2LEB|B (2LEB)
  • RNA (5'-R(*UP*CP*CP*AP*GP*U)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2LEB|B
1009NR_all_14861.1
Exact match
3JXR|A (3JXQ)
  • r[CGCG(5-fluoro)CG]2
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.5 Å6(2) 3JXQ|A, 3JXR|A
1010NR_all_17818.1
Exact match
2KH9|B (2KH9)
  • 5'-R(*AP*GP*AP*GP*AP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2KH9|B
1011NR_all_23219.1
Exact match
3MDI|C (3MDI)
  • RNA (5'-R(*UP*GP*UP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.1 Å6(1) 3MDI|C
1012NR_all_24220.1
Exact match
3S14|R (3S14)
  • RNA (5'-R(*GP*AP*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.9 Å6(1) 3S14|R
1013NR_all_25139.1
Exact match
3G9Y|C (3G9Y)
  • RNA (5'-R(*AP*GP*GP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.4 Å6(1) 3G9Y|C
1014NR_all_26795.1
Exact match
Escherichia coli
3T5N|C (3T5N)
  • RNA (5'-R(P*UP*AP*UP*CP*UP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.8 Å6(1) 3T5N|C
1015NR_all_26991.1
Exact match
2GRB|A (2GRB)
  • 5'-R(*(U33)P*GP*IP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å6(1) 2GRB|A
1016NR_all_27937.1
Exact match
3KOA|B (3KOA)
  • RNA (5'-R(P*AP*UP*GP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.4 Å6(1) 3KOA|B
1017NR_all_27964.1
Exact match
2J0S|E (2HYI)
  • 5'-R(*UP*UP*UP*UP*UP*U)-3', 5'-R(*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.3 Å6(4) 2HYI|F, 2J0Q|E, 2J0S|E, 3EX7|F
1018NR_all_32709.1
Exact match
2KG0|B (2KG0)
  • 5'-R(*AP*GP*GP*GP*AP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2KG0|B
1019NR_all_33539.1
Exact match
1YTU|C (1YTU)
  • 5'-R(P*AP*GP*AP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.5 Å6(1) 1YTU|C
1020NR_all_39956.1
Exact match
3HGA|X (3HGA)
  • 5'-R(*UP*(US5)P*CP*GP*CP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
1.3 Å6(1) 3HGA|X
1021NR_all_44650.1
Exact match
Mus musculus
2XS7|B (2XS7)
  • 5'-R(*UP*UP*GP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.5 Å6(1) 2XS7|B
1022NR_all_46796.1
Exact match
1J6S|A (1J6S)
  • 5'-R(*(BRUP*GP*AP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å6(1) 1J6S|A
1023NR_all_47379.1
Exact match
3MDG|C (3MDG)
  • RNA (5'-R(*UP*UP*GP*UP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.2 Å6(1) 3MDG|C
1024NR_all_49742.1
Exact match
1J8G|A (1J8G)
  • 5'-R(*UP*GP*GP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
0.6 Å6(1) 1J8G|A
1025NR_all_52336.1
Exact match
2AD9|B (2AD9)
  • 5'-R(*CP*UP*CP*UP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2AD9|B
1026NR_all_52544.1
Exact match
1PBM|A (1PBM)
  • RNA (5'-R(*CP*GP*CP*GP*CP*G)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
6(1) 1PBM|A
1027NR_all_53993.1
Exact match
2KXN|A (2KXN)
  • 5'-R(*AP*AP*GP*AP*AP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
6(1) 2KXN|A
1028NR_all_54826.1
Exact match
1RAU|A (1RAU)
  • RNA (5'-R(*UP*GP*GP*GP*GP*U)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
6(1) 1RAU|A
1029NR_all_55357.1
Exact match
1UTD|0 (1UTD)
  • 5'-R(*GP*UP*UP*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 0
2.1 Å6(1) 1UTD|0
1030NR_all_57356.1
Exact match
2G8F|B (2G8F)
  • 5'-R(*UP*CP*GP*AP*CP*A)-3', 5'-R(P*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.7 Å6(8) 2G8F|B, 2G8H|B, 2G8I|B, 2G8K|B, 2G8U|B, 2G8V|B, 2G8W|B, 2R7Y|B
1031NR_all_61866.1
Exact match
2RRA|B (2RRA)
  • 5'-R(*GP*AP*AP*GP*AP*A)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2RRA|B
1032NR_all_63468.1
Exact match
2R7V|X (2R7V)
  • RNA (5'-R(*G*GP*CP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.8 Å6(1) 2R7V|X
1033NR_all_67157.1
Exact match
1I9K|A (1I9K)
  • 5'-R(*UP*CP*CP*CP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): A
6(1) 1I9K|A
1034NR_all_68237.1
Exact match
3O8R|C (3O8R)
  • RNA (5'-R(P*UP*(5BU)P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.3 Å6(1) 3O8R|C
1035NR_all_74832.1
Exact match
2ADC|B (2ADC)
  • 5'-R(*CP*UP*CP*UP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2ADC|B
1036NR_all_77304.1
Exact match
1N38|C (1N38)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.8 Å6(1) 1N38|C
1037NR_all_78270.1
Exact match
Saccharomyces cerevisiae
4A3D|P (4A3D)
  • TRANSCRIPT RNA 5'-R(*CP*CP*AP*GP*GP*AP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
3.4 Å6(2) 4A3D|P, 4A3F|P
1038NR_all_82144.1
Exact match
4E78|P (4E78)
  • 5'-R(*U*AP*CP*CP*GP*(GDO))-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
2.9 Å6(1) 4E78|P
1039NR_all_82765.1
Exact match
3PF5|R (3PF5)
  • hexaribouracil (rU6)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
1.7 Å6(1) 3PF5|R
1040NR_all_83414.1
Exact match
2AWE|A (2AWE)
  • 5'-R(*UP*(BGM)P*GP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.1 Å6(1) 2AWE|A
1041NR_all_85202.1
Exact match
377D|A (377D)
  • RNA-DNA (5'-R(*CP*GP*UP*AP*CP*DG)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.8 Å6(1) 377D|A
1042NR_all_85835.1
Exact match
1OSU|A (1OSU)
  • RNA (5'-R(*UP*UP*CP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.4 Å6(1) 1OSU|A
1043NR_all_86287.1
Exact match
3RC8|E (3RC8)
  • RNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å6(1) 3RC8|E
1044NR_all_88390.1
Exact match
3M7N|X (3M7N)
  • 5'-R(*C*UP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.4 Å6(1) 3M7N|X
1045NR_all_88986.1
Exact match
1N1H|B (1N1H)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å6(1) 1N1H|B
1046NR_all_89229.1
Exact match
176D|A (176D)
  • DNA (5'-D(*GPN*APN*APN*CPN*TPN*CPN)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): A
6(1) 176D|A
1047NR_all_89805.1
Exact match
3PEY|B (3PEW)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.5 Å6(2) 3PEW|B, 3PEY|B
1048NR_all_90661.1
Exact match
2A8V|E (2A8V)
  • 5'-R(P*CP*CP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.4 Å6(1) 2A8V|E
1049NR_all_91582.1
Exact match
1AV6|B (1AV6)
  • RNA (5'-R(*GP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å6(1) 1AV6|B
1050NR_all_92238.1
Exact match
2LEC|B (2LEC)
  • RNA (5'-R(*UP*GP*GP*AP*GP*U)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 2LEC|B
1051NR_all_92374.1
Exact match
1P79|A (1P79)
  • 5'-R(*UP*GP*UP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
1.1 Å6(1) 1P79|A
1052NR_all_93078.1
Exact match
3AHU|X (3AHU)
  • 5'-R(*AP*GP*AP*GP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
2.2 Å6(1) 3AHU|X
1053NR_all_93084.1
Exact match
3M85|X (3M85)
  • 5'-R(*CP*UP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
3.0 Å6(1) 3M85|X
1054NR_all_97458.1
Exact match
synthetic construct
1UVI|D (1UVI)
  • 5'-R(*UP*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.2 Å6(1) 1UVI|D
1055NR_all_99120.1
Exact match
1WWG|B (1WWG)
  • 5'-R(P*UP*AP*UP*CP*UP*G)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 1WWG|B
1056NR_all_99440.1
Exact match
1WWD|B (1WWD)
  • 5'-R(P*AP*AP*CP*AP*GP*U)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
6(1) 1WWD|B
1057NR_all_07343.1
Exact match
Homo sapiens
2L5D|B (2L5D)
  • 5'-R(*UP*GP*AP*CP*A)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
5(1) 2L5D|B
1058NR_all_10579.1
Exact match
2X1A|B (2X1A)
  • 5'-R(*GP*UP*UP*GP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.1 Å5(1) 2X1A|B
1059NR_all_11008.1
Exact match
2Q66|X (2Q66)
  • 5'-R(P*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): X
1.8 Å5(1) 2Q66|X
1060NR_all_11588.1
Exact match
1T2R|B (1T2R)
  • 5'-R(*CP*UP*CP*AP*C)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): B
5(1) 1T2R|B
1061NR_all_14651.1
Exact match
synthetic construct
1UVL|B (1UVL)
  • 5'-R(*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.0 Å5(1) 1UVL|B
1062NR_all_16720.1
Exact match
2X1F|B (2X1F)
  • 5'-R(*GP*UP*UP*GP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
1.6 Å5(1) 2X1F|B
1063NR_all_23587.1
Exact match
1KNZ|W (1KNZ)
  • 5'-R(*UP*GP*AP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): W
2.5 Å5(1) 1KNZ|W
1064NR_all_26013.1
Exact match
3S2D|R (3S2D)
  • RNA (5'-R(*AP*GP*GP*(5BU)P*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.2 Å5(1) 3S2D|R
1065NR_all_32915.1
Exact match
Homo sapiens
2VOP|B (2VOP)
  • 5'-R(*AP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.8 Å5(1) 2VOP|B
1066NR_all_33863.1
Exact match
3S1N|R (3S1N)
  • RNA (5'-R(*AP*GP*AP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.1 Å5(1) 3S1N|R
1067NR_all_36486.1
Exact match
1UTF|0 (1UTF)
  • 5'-R(*UP*AP*GP*AP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): 0
5(2) 1UTF|0, 1UTV|0
1068NR_all_43625.1
Exact match
3T3O|B (3T3O)
  • O2'methyl-RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.5 Å5(1) 3T3O|B
1069NR_all_45461.1
Exact match
3KMQ|B (3KMQ)
  • RNA (5'-R(P*GP*GP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.1 Å5(1) 3KMQ|B
1070NR_all_50668.1
Exact match
2XGJ|C (2XGJ)
  • RNA (5'-(*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.9 Å5(1) 2XGJ|C
1071NR_all_65029.1
Exact match
2C06|C (2C06)
  • 5'-R(*AP*UP*AP*CP*AP)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): C
5(1) 2C06|C
1072NR_all_66552.1
Exact match
3ERC|E (3ERC)
  • RNA/DNA chimera (5'-D(CP*)R(UP*UP*)D(CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.2 Å5(1) 3ERC|E
1073NR_all_72890.1
Exact match
3PO3|P (3PO3)
  • RNA product strand
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
3.3 Å5(1) 3PO3|P
1074NR_all_76121.1
Exact match
Mus musculus
2XS5|C (2XS5)
  • 5'-R(*UP*GP*UP*UP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
1.6 Å5(1) 2XS5|C
1075NR_all_80790.1
Exact match
synthetic construct
1UVM|D (1UVM)
  • 5'-R(*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.0 Å5(1) 1UVM|D
1076NR_all_81282.1
Exact match
3S1M|R (3S1M)
  • RNA (5'-R(*AP*GP*AP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.1 Å5(1) 3S1M|R
1077NR_all_84062.1
Exact match
2RS2|B (2RS2)
  • RNA (5'-R(*GP*UP*AP*GP*U)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): B
5(1) 2RS2|B
1078NR_all_95179.1
Exact match
3Q2T|E (3Q2T)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
3.1 Å5(1) 3Q2T|E
1079NR_all_95647.1
Exact match
2HT1|M (2HT1)
  • 5'-R(*UP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): M
3.5 Å5(1) 2HT1|M
1080NR_all_97016.1
Exact match
3P6Y|Q (3P6Y)
  • 5'-R(*UP*GP*UP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): Q
2.9 Å5(1) 3P6Y|Q
1081NR_all_99460.2
Exact match
3S1R|R (3RZD)
  • RNA (5'-R(*AP*GP*AP*GP*G)-3'), RNA (5'-R[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.3 Å5(4) 3RZD|R, 3S1Q|R, 3S1R|R, 3S2H|R
1082NR_all_16816.1
Exact match
2QQP|R (2QQP)
  • RNA (5'-R(*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.8 Å4(1) 2QQP|R
1083NR_all_21072.1
Exact match
3IE1|E (3IE1)
  • RNA (5'-R(P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å4(1) 3IE1|E
1084NR_all_25169.1
Exact match
Saccharomyces cerevisiae
4A3E|P (4A3B)
  • TRANSCRIPT RNA 5'-R(*AP*GP*GP*A)-3', TRA[...]
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
3.5 Å4(4) 4A3B|P, 4A3C|P, 4A3E|P, 4A3M|P
1085NR_all_27854.1
Exact match
1NB7|E (1NB7)
  • 5'-R(*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.9 Å4(1) 1NB7|E
1086NR_all_52397.1
Exact match
Thermus thermophilus
3B0U|A (3B0U)
  • RNA (5'-R(*GP*GP*(H2U)P*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): A
2.0 Å4(1) 3B0U|A
1087NR_all_64222.1
Exact match
2L41|B (2L41)
  • RNA (5'-R(P*UP*CP*UP*U)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): B
4(1) 2L41|B
1088NR_all_65677.1
Exact match
2I2Y|B (2I2Y)
  • (5'-R(*CP*AP*UP*C)-3')
  • SOLUTION NMR
  • Chain(s): ; model(s): B
4(1) 2I2Y|B
1089NR_all_69666.1
Exact match
3S4G|C (3S4G)
  • RNA (5'-R(P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
6.0 Å4(1) 3S4G|C
1090NR_all_86396.1
Exact match
2XC7|P (2XC7)
  • 5'-(AP*UP*CP*GP)-3'
  • SOLUTION NMR
  • Chain(s): ; model(s): P
4(1) 2XC7|P
1091NR_all_89546.1
Exact match
1CWP|D (1CWP)
  • RNA (5'-R(*AP*UP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.2 Å4(1) 1CWP|D
1092NR_all_95178.1
Exact match
3RZO|R (3RZO)
  • RNA (5'-R(*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.0 Å4(1) 3RZO|R
1093NR_all_14983.1
Exact match
1QLN|R (1QLN)
  • RNA (5- R(PPP*GP*GP*G)-3)
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
2.4 Å3(1) 1QLN|R
1094NR_all_20144.1
Exact match
3GPQ|E (3GPQ)
  • RNA (5'-R(*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): E
2.0 Å3(1) 3GPQ|E
1095NR_all_24236.1
Exact match
4DWA|D (4DWA)
  • RNA (5'-R(*CP*UP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.0 Å3(1) 4DWA|D
1096NR_all_36988.1
Exact match
2FZ2|D (2FZ2)
  • 5'-R(*CP*CP*C)-3', 5'-R(CP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.9 Å3(2) 2FZ2|D, 2XPJ|D
1097NR_all_44118.1
Exact match
Ribgrass mosaic virus
1RMV|B (1RMV)
  • RIBGRASS MOSAIC VIRUS RNA
  • FIBER DIFFRACTION
  • Chain(s): ; model(s): B
2.9 Å3(1) 1RMV|B
1098NR_all_45774.1
Exact match
1LAJ|R (1LAJ)
  • 5'-R(*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
3.4 Å3(1) 1LAJ|R
1099NR_all_46374.1
Exact match
Tobacco mosaic virus
3J06|R (3J06)
  • 5'-R(P*AP*UP*G)-3'
  • ELECTRON MICROSCOPY
  • Chain(s): ; model(s): R
3.3 Å3(1) 3J06|R
1100NR_all_54546.1
Exact match
2TMV|R (1CGM)
  • RNA (5'-R(P*GP*AP*A)-3'), Tobacco Mosaic[...]
  • FIBER DIFFRACTION
  • Chain(s): ; model(s): R
3.4 Å3(4) 1CGM|I, 2OM3|R, 2TMV|R, 2XEA|R
1101NR_all_57256.1
Exact match
3NMA|B (3NMA)
  • 5'-R(*GP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.6 Å3(1) 3NMA|B
1102NR_all_57387.1
Exact match
Escherichia coli
1H2C|R (1H2C)
  • 5'-R(*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): R
1.6 Å3(2) 1H2C|R, 1H2D|R
1103NR_all_62128.1
Exact match
Escherichia coli
2VRT|G (2VRT)
  • 5'-R(*UP*UP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
3.5 Å3(1) 2VRT|G
1104NR_all_65908.1
Exact match
Tobacco mild green mosaic virus
1VTM|R (1VTM)
  • RNA (5'-R(P*GP*AP*A)-3')
  • FIBER DIFFRACTION
  • Chain(s): ; model(s): R
3.5 Å3(1) 1VTM|R
1105NR_all_74352.1
Exact match
2A1R|C (2A1R)
  • 5'-R(*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.6 Å3(1) 2A1R|C
1106NR_all_81293.1
Exact match
3PDM|R (3PDM)
  • RNA (5'-R(P*GP*AP*A)-3')
  • FIBER DIFFRACTION
  • Chain(s): ; model(s): R
3.5 Å3(1) 3PDM|R
1107NR_all_88198.1
Exact match
1I5L|U (1I5L)
  • 5'-R(*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): U
2.8 Å3(1) 1I5L|U
1108NR_all_04174.1
Exact match
synthetic construct
4A3J|P (4A3J)
  • 5'-R(*CP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
3.7 Å2(1) 4A3J|P
1109NR_all_16114.1
Exact match
1PVO|G (1PVO)
  • 5'-R(P*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): G
3.0 Å2(1) 1PVO|G
1110NR_all_30740.1
Exact match
1B2M|C (1B2M)
  • 5'-R(*GP*(U34))-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.0 Å2(1) 1B2M|C
1111NR_all_37181.1
Exact match
1UVK|B (1UVK)
  • 5'-D(*GP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): B
2.5 Å2(1) 1UVK|B
1112NR_all_44376.1
Exact match
Saccharomyces cerevisiae
4A3G|P (4A3G)
  • TRANSCRIPT RNA 5'-R(*CP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): P
3.5 Å2(1) 4A3G|P
1113NR_all_64452.1
Exact match
3RTJ|D (3RTJ)
  • RNA (5'-R(*AP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
3.0 Å2(1) 3RTJ|D
1114NR_all_85161.1
Exact match
3U2E|C (3U2E)
  • RNA (5'-R(P*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): C
2.3 Å2(1) 3U2E|C
1115NR_all_92169.1
Exact match
3ER9|D (3ER9)
  • 5'-R(UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): ; model(s): D
2.1 Å2(1) 3ER9|D