Exact match 1825; Updated, 1 parent 7; New id, 1 parent 4; New id, no parents 2;

#Equivalence classRepresentativeResolutionNtsClass members
1NR_3.0_08591.1
Exact match
Drosophila melanogaster
6XU8|1|A5+6XU8|1|A8 (6XU8)
  • 28S ribosomal RNA, 5.8S ribosomal RNA, 2[...]
  • Electron microscopy
  • Release Date: 2021-07-28
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
3.0 Å3703(1) 6XU8|1|A5+6XU8|1|A8
2NR_3.0_65061.21
Exact match
Homo sapiens
8GLP|1|L5+8GLP|1|L8 (8GLP)
  • 28S rRNA (3773-MER), 5.8S rRNA (156-MER)[...]
  • Electron microscopy
  • Release Date: 2023-04-19
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
1.7 Å3696(48) 8GLP|1|L5+8GLP|1|L8, 8A3D|1|A+8A3D|1|C, 8G5Y|1|L5+8G5Y|1|L8, 7XNY|1|L1+7XNY|1|L3, 6ZMI|1|L5+6ZMI|1|L8, 7OW7|1|A+7OW7|1|C, 6ZM7|1|L5+6ZM7|1|L8, 8G60|1|L5+8G60|1|L8, 7XNX|1|L1+7XNX|1|L3, 8G5Z|1|L5+8G5Z|1|L8, 7F5S|1|L5+7F5S|1|L8, 8FL3|1|L3+8FL3|1|L1, 6Y6X|1|L5+6Y6X|1|L8, 6Z6N|1|L5+6Z6N|1|L8, 8FLE|1|L3+8FLE|1|L1, 8FLB|1|L3+8FLB|1|L1, 8FL7|1|L3+8FL7|1|L1, 8G6J|1|L5+8G6J|1|L8, 6QZP|1|L5+6QZP|1|L8, 6ZME|1|L5+6ZME|1|L8, 6Z6L|1|L5+6Z6L|1|L8, 7QVP|1|L5+7QVP|1|L8, 8FLD|1|L3+8FLD|1|L1, 8FL6|1|L3+8FL6|1|L1, 8FLA|1|L3+8FLA|1|L1, 8FL2|1|L3+8FL2|1|L1, 7QVP|1|L6+7QVP|1|L1, 8IDT|1|2+8IDT|1|8, 6XA1|1|L5+6XA1|1|L8, 8FLF|1|L3+8FLF|1|L1, 8G61|1|L5+8G61|1|L8, 8INF|1|2+8INF|1|8, 8IDY|1|2+8IDY|1|8, 8FL9|1|L3+8FL9|1|L1, 8FLC|1|L3+8FLC|1|L1, 6Y2L|1|L5+6Y2L|1|L8, 8FL4|1|L3+8FL4|1|L1, 8FKY|1|L3+8FKY|1|L1, 8FKW|1|L3+8FKW|1|L1, 8FKV|1|L3+8FKV|1|L1, 8FKX|1|L3+8FKX|1|L1, 8FKU|1|L3+8FKU|1|L1, 8FKT|1|L3+8FKT|1|L1, 8FKS|1|L3+8FKS|1|L1, 8FKR|1|L3+8FKR|1|L1, 8FKQ|1|L3+8FKQ|1|L1, 8FKP|1|L3+8FKP|1|L1, 8FL0|1|L3
3NR_3.0_96955.1
Exact match
Rattus norvegicus
7QGG|1|t+7QGG|1|D (7QGG)
  • RNA (4803-MER), RNA (157-MER)
  • Electron microscopy
  • Release Date: 2022-10-26
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.9 Å3679(1) 7QGG|1|t+7QGG|1|D
4NR_3.0_06650.33
Updated, 1 parent
Oryctolagus cuniculus
7O7Y|1|B5+7O7Y|1|B8 (7O7Y)
  • 28S ribosomal RNA, 5.8S ribosomal RNA, 2[...]
  • Electron microscopy
  • Release Date: 2021-06-02
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.2 Å3543(16) 7O7Y|1|B5+7O7Y|1|B8, 7O7Z|1|B5+7O7Z|1|B8, 7OYD|1|5+7OYD|1|8, 7ZJW|1|L5+7ZJW|1|L8, 8B6C|1|5+8B6C|1|8, 8BPO|1|A1+8BPO|1|C1, 7O80|1|B5+7O80|1|B8, 8P2K|1|B5+8P2K|1|B8, 7OBR|1|5+7OBR|1|8, 8B5L|1|5+8B5L|1|8, 6SGC|1|54+6SGC|1|84, 7QWQ|1|5+7QWQ|1|8, 7UCK|1|5+7UCK|1|8, 7TOR|1|A28S+7TOR|1|A58S, 7QWR|1|5+7QWR|1|8, 6R5Q|1|5+6R5Q|1|8
5NR_3.0_96091.1
Exact match
Mus musculus
7CPU|1|L5+7CPU|1|L8 (7CPU)
  • Mus musculus 28S ribosomal RNA, Mus musc[...]
  • Electron microscopy
  • Release Date: 2022-02-02
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.8 Å3539(1) 7CPU|1|L5+7CPU|1|L8
6NR_3.0_40894.1
Exact match
Danio rerio
7OYB|1|51+7OYB|1|81 (7OYB)
  • 28S rRNA, 5.8S rRNA
  • Electron microscopy
  • Release Date: 2022-07-13
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.4 Å3263(1) 7OYB|1|51+7OYB|1|81
7NR_3.0_99289.1
Exact match
Xenopus laevis
7OYC|1|51+7OYC|1|81 (7OYC)
  • 28S rRNA, 5.8S rRNA
  • Electron microscopy
  • Release Date: 2022-07-20
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.4 Å3245(1) 7OYC|1|51+7OYC|1|81
8NR_3.0_71228.1
Exact match
Candida albicans SC5314
7PZY|1|1+7PZY|1|4 (7PZY)
  • 25S ribosomal RNA, 5.8S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-05-18
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.3 Å3207(5) 7PZY|1|1+7PZY|1|4, 7Q08|1|1+7Q08|1|4, 7Q0F|1|1+7Q0F|1|4, 7Q0R|1|1+7Q0R|1|4, 7Q0P|1|1+7Q0P|1|4
9NR_3.0_93493.1
Exact match
Chaetomium thermophilum var. thermophilum DSM 1495
7R81|1|A1+7R81|1|C1 (7R81)
  • 26S rRNA, 5.8S rRNA, RNA (3341-MER), RNA[...]
  • Electron microscopy
  • Release Date: 2021-12-01
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.7 Å3190(7) 7R81|1|A1+7R81|1|C1, 7OLC|1|1+7OLC|1|4, 8IA0|1|C1+8IA0|1|C2, 7OLD|1|1+7OLD|1|4, 8I9Z|1|C1+8I9Z|1|C2, 8I9X|1|C1+8I9X|1|C2, 8I9P|1|C1+8I9P|1|C2
10NR_3.0_90506.62
Updated, 1 parent
Saccharomyces cerevisiae
5TBW|1|1+5TBW|1|4 (5TBW)
  • 25s rRNA, 5.8s rRNA, 25S ribosomal RNA, [...]
  • X-ray diffraction
  • Release Date: 2017-07-26
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
3.0 Å3149(51) 5TBW|1|1+5TBW|1|4, 5TBW|1|AR+5TBW|1|AT, 4V88|1|A5+4V88|1|A8, 4V88|1|A1+4V88|1|A4, 7OSA|1|25S+7OSA|1|58S, 7OSM|1|25S+7OSM|1|58S, 8EVT|1|A1+8EVT|1|A4, 7ZW0|1|LA+7ZW0|1|LD, 8AGX|1|f+8AGX|1|i, 7TOP|1|A25S+7TOP|1|A58S, 8EVP|1|A1+8EVP|1|A4, 8AAF|1|f+8AAF|1|i, 8EWC|1|A1+8EWC|1|A4, 7ZUX|1|5+7ZUX|1|3, 8EUB|1|A1+8EUB|1|A4, 8HFR|1|1e+8HFR|1|3n, 8AGZ|1|f+8AGZ|1|i, 8AGT|1|f+8AGT|1|i, 8AGV|1|f+8AGV|1|i, 8AGW|1|f+8AGW|1|i, 7UOO|1|1+7UOO|1|2, 7V08|1|1+7V08|1|2, 8EVS|1|A1+8EVS|1|A4, 8AGU|1|f+8AGU|1|i, 7UQB|1|1+7UQB|1|2, 6T4Q|1|C1+6T4Q|1|C3, 7UQZ|1|1+7UQZ|1|2, 7TOO|1|A25S+7TOO|1|A58S, 8EVQ|1|A1+8EVQ|1|A4, 7MPJ|1|A1+7MPJ|1|A4, 6WOO|1|5+6WOO|1|8, 6TB3|1|BQ+6TB3|1|BS, 6SNT|1|1+6SNT|1|3, 8EVR|1|A1+8EVR|1|A4, 8EWB|1|A1+8EWB|1|A4, 7AZY|1|E+7AZY|1|G, 4U4R|1|1+4U4R|1|4, 4U4R|1|5+4U4R|1|8, 7UG6|1|1+7UG6|1|2, 4U3U|1|5+4U3U|1|8, 4U3U|1|1+4U3U|1|4, 4U3M|1|1+4U3M|1|4, 6YLG|1|1+6YLG|1|2, 4U4Q|1|5+4U4Q|1|8, 4U3M|1|5+4U3M|1|8, 4U4U|1|1+4U4U|1|4, 4U4Q|1|1+4U4Q|1|4, 4U4U|1|5+4U4U|1|8, 4U52|1|5+4U52|1|8, 4U52|1|1+4U52|1|4, 7U0H|1|1+7U0H|1|2
11NR_3.0_76090.5
Exact match
Mycolicibacterium smegmatis MC2 155
8FR8|1|A (8FR8)
  • 23S rRNA (3119-MER)
  • Electron microscopy
  • Release Date: 2023-05-17
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.8 Å3119(1) 8FR8|1|A
12NR_3.0_35677.3
Exact match
Mycobacterium tuberculosis H37Rv
7SFR|1|A (7SFR)
  • 23S rRNA
  • Electron microscopy
  • Release Date: 2022-10-12
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.6 Å3112(7) 7SFR|1|A, 7KGB|1|A, 7MT7|1|A, 7MT2|1|A, 7MSM|1|A, 7MT3|1|A, 7MSC|1|A
13NR_3.0_27894.1
Exact match
Sulfolobus acidocaldarius DSM 639
8HKU|1|A23S (8HKU)
  • 23s rRNA (2996-MER)
  • Electron microscopy
  • Release Date: 2023-08-16
  • Standardized name: LSU rRNA
  • Source: Archaea
  • Rfam: RF02540
2.7 Å2995(1) 8HKU|1|A23S
14NR_3.0_28129.3
Exact match
Solanum lycopersicum
8AZW|1|A+8AZW|1|B (8AZW)
  • 25S rRNA, 5.8S rRNA
  • Electron microscopy
  • Release Date: 2023-06-07
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.1 Å2975(4) 8AZW|1|A+8AZW|1|B, 8B2L|1|A3+8B2L|1|B3, 7QIW|1|2+7QIW|1|8, 7QIZ|1|2+7QIZ|1|8
15NR_3.0_21988.1
Exact match
Listeria monocytogenes EGD-e
8A57|1|A (8A57)
  • 23S rRNA, 23S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-11-02
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.3 Å2908(3) 8A57|1|A, 8A5I|1|A, 7NHN|1|A
16NR_3.0_90633.21
Exact match
Staphylococcus aureus
6S0Z|1|A (6S0Z)
  • 23S Ribosomal RNA, 23S rRNA, 23S
  • Electron microscopy
  • Release Date: 2019-08-21
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.3 Å2905(11) 6S0Z|1|A, 7ASM|1|A, 6HMA|1|A, 6S0X|1|A, 5NGM|1|AA, 7ASP|1|Y, 7P48|1|A, 7ASN|1|A, 7TTW|1|1, 6WQN|1|1, 7TTU|1|1
17NR_3.0_83717.122
Exact match
Escherichia coli
5J7L|1|DA (5J7L)
  • 23S rRNA, 23S ribosomal RNA, LSU rRNA, s[...]
  • X-ray diffraction
  • Release Date: 2016-07-27
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
3.0 Å2897(166) 5J7L|1|DA, 4YBB|1|DA, 4WOI|1|BA, 4WOI|1|CA, 6I7V|1|DA, 5J91|1|DA, 4V9P|1|EA, 4V9P|1|CA, 4V9P|1|GA, 4V9P|1|AA, 4V9D|1|CA, 4V9O|1|AA, 4V9O|1|EA, 4V9O|1|CA, 5J7L|1|CA, 4U27|1|BA, 4U24|1|BA, 4U25|1|BA, 4V9D|1|DA, 4U26|1|BA, 4V9O|1|GA, 4U1U|1|BA, 4YBB|1|CA, 4U1V|1|BA, 4U20|1|BA, 6I7V|1|CA, 4U27|1|DA, 4U25|1|DA, 4U1U|1|DA, 4U1V|1|DA, 4U24|1|DA, 4U26|1|DA, 4U20|1|DA, 5J91|1|CA, 5J5B|1|DA, 5J5B|1|CA, 6HRM|1|1, 8B0X|1|a, 8CGK|1|a, 8CGV|1|a, 8CEU|1|a, 8FTO|1|a, 8E30|1|I, 8CAM|1|a, 8AYE|1|a, 8E3O|1|I, 7K00|1|a, 8CGD|1|a, 8E49|1|I, 8G6W|1|a, 7QQ3|1|I, 8BIM|1|0, 8E43|1|I, 7ZP8|1|b, 8BIL|1|0, 8G6Y|1|a, 8E41|1|I, 8EMM|1|a, 6XZ7|1|A, 8ANA|1|a, 8BGE|1|0, 7LVK|1|I, 7Z20|1|b, 6PJ6|1|I, 8E35|1|I, 8E48|1|I, 7N1P|1|23, 8E33|1|I, 8BHL|1|0, 7PJS|1|A, 8E3M|1|I, 7S1H|1|I, 8E47|1|I, 8E45|1|I, 8EIU|1|a, 8E42|1|I, 8E46|1|I, 8E32|1|I, 8E3L|1|I, 7S1K|1|I, 7O1A|1|BA, 8AKN|1|a, 8BF7|1|0, 8G6X|1|a, 7S1J|1|I, 7S1I|1|I, 7S1G|1|I, 8E36|1|I, 8BHP|1|0, 7BL4|1|A, 7YLA|1|I, 7N2U|1|23, 7N2V|1|23, 7ZOD|1|b, 7SA4|1|1, 6YS3|1|b, 7UG7|1|23, 6YSS|1|A, 6PCR|1|I, 6PC6|1|I, 6PC7|1|I, 8E44|1|I, 7NWT|1|1, 7N30|1|23, 6XZB|1|A2, 7ZQ5|1|b, 7N31|1|23, 7O1C|1|BA, 7ZTA|1|23S1, 6TBV|1|23S1, 6TC3|1|23S1, 8BH4|1|0, 7ZQ6|1|b, 6PCQ|1|I, 7N2C|1|23, 8EKC|1|A, 6XZA|1|A2, 7M5D|1|1, 6QDW|1|b, 6PC5|1|I, 7NSO|1|A, 7ST2|1|1, 7OT5|1|1, 7OTC|1|A, 5AFI|1|A, 7B5K|1|A, 8BHJ|1|0, 6WYV|1|I, 8AM9|1|a, 6PCT|1|I, 6U48|1|CA, 6Y69|1|A, 8SYL|1|A, 6PCS|1|I, 7O19|1|BA, 7ST6|1|1, 7TOS|1|23S, 8BGH|1|0, 5NWY|1|N, 6WD0|1|1, 7OII|1|1, 7OIF|1|1, 6WDE|1|1, 8B7Y|1|I, 8BHN|1|0, 7OIZ|1|a, 7P3K|1|a, 6ORE|1|1, 7Q4K|1|BA, 6PC8|1|I, 5MDV|1|1, 6H4N|1|A, 6ZU1|1|BA, 6ZTO|1|BA, 6ZTP|1|BA, 6PCH|1|I, 8AP4|1|a, 6QUL|1|A, 5WFS|1|A, 5WDT|1|A, 5IQR|1|1, 7ODE|1|I, 8CGJ|1|a, 8CGU|1|a, 8CEP|1|a, 8CGR|1|a
18NR_3.0_94178.1
Exact match
Cutibacterium acnes
8CVM|1|a (8CVM)
  • 23S ribosomal RNA
  • Electron microscopy
  • Release Date: 2023-03-15
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.7 Å2891(2) 8CVM|1|a, 8CRX|1|a
19NR_3.0_08417.1
Exact match
Pseudomonas aeruginosa
7UNW|1|A (7UNW)
  • 23S ribosomal RNA, Pseudomonas aeruginos[...]
  • Electron microscopy
  • Release Date: 2022-06-22
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.6 Å2885(6) 7UNW|1|A, 7UNV|1|A, 6SPB|1|A, 7UNU|1|A, 7UNR|1|A, 6SPF|1|A
20NR_3.0_96169.3
Exact match
Acinetobacter baumannii
7UVZ|1|A (7UVZ)
  • 23s ribosomal RNA
  • Electron microscopy
  • Release Date: 2023-04-19
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.2 Å2877(19) 7UVZ|1|A, 7UW1|1|A, 7UVX|1|A, 7UVW|1|A, 7UVY|1|A, 7RYG|1|A, 7RYH|1|A, 7M4Y|1|A, 7UVV|1|A, 7M4W|1|A, 6YSI|1|1, 7M4V|1|A, 7M4X|1|A, 6V3A|1|AN1, 7RYF|1|A, 6YHS|1|1, 6V3B|1|AN1, 6V3D|1|AN1, 7M4Z|1|A
21NR_3.0_72592.1
Exact match
Neurospora crassa
6YWS|1|A (6YWS)
  • 23S rRNA, RNA (2820-MER)
  • Electron microscopy
  • Release Date: 2020-11-11
  • Standardized name: LSU rRNA
  • Source: Mitochondria
  • Rfam: RF02541
2.7 Å2837(2) 6YWS|1|A, 6YWE|1|A
22NR_3.0_41610.16
Exact match
Bacillus subtilis subsp. subtilis str. 168
8BUU|1|A (8BUU)
  • 23S ribosomal RNA, 23S rRNA, RNA (2434-M[...]
  • Electron microscopy
  • Release Date: 2023-04-05
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.9 Å2820(4) 8BUU|1|A, 7AQC|1|A, 7AS8|1|A, 7SAE|1|A
23NR_3.0_97519.67
Exact match
Thermus thermophilus
7RQB|1|1A (7RQB)
  • 23S Ribosomal RNA, Cytidine-Puromycin, 2[...]
  • X-ray diffraction
  • Release Date: 2022-01-26
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.5 Å2819(182) 7RQB|1|1A, 8FC6|1|1A, 7RQB|1|2A, 8FC6|1|2A, 4Y4O|1|2A, 8FC5|1|1A, 8FC5|1|2A, 8FC2|1|1A, 4Y4O|1|1A, 8FC2|1|2A, 8FC3|1|1A, 5HCQ|1|2A, 4V9H|1|BA, 5FDU|1|1A, 5FDV|1|1A, 8FC3|1|2A, 8FC1|1|1A, 5HCQ|1|1A, 8FC1|1|2A, 4V8I|1|BA, 5FDV|1|2A, 5FDU|1|2A, 7U2J|1|1A, 7RQE|1|1A, 4WPO|1|AA, 5IBB|1|1H, 5IB7|1|1H, 8T8B|1|1A, 8EKB|1|1A, 5E81|1|1H, 6CAE|1|1A, 4V8I|1|DA, 7RQE|1|2A, 6CFL|1|1A, 6XHX|1|1A, 7U2H|1|1A, 6XHX|1|2A, 8T8B|1|2A, 5IBB|1|14, 7U2J|1|2A, 7RQ8|1|1A, 6CFL|1|2A, 8T8C|1|1A, 6CAE|1|2A, 8EKB|1|2A, 7U2H|1|2A, 5E81|1|14, 5IB7|1|14, 8EV7|1|1A, 8FC4|1|1A, 5HCR|1|2A, 7RQ8|1|2A, 6CFK|1|1A, 7RQC|1|1A, 8T8C|1|2A, 4WPO|1|CA, 6XHY|1|1A, 4Z8C|1|2A, 5NDK|1|1H, 4WSD|1|1H, 7RQC|1|2A, 6CFJ|1|1A, 5W4K|1|1A, 6CFK|1|2A, 5HCR|1|1A, 4WQU|1|AA, 5J4B|1|2A, 8FC4|1|2A, 4V8D|1|BA, 1VY4|1|DA, 6OF1|1|1A, 5J4B|1|1A, 6XHY|1|2A, 8EV7|1|2A, 4WSD|1|14, 5NDK|1|14, 5J8B|1|A, 4V9R|1|BA, 5HD1|1|2A, 5WIS|1|1A, 1VY4|1|BA, 5J4C|1|2A, 4LNT|1|YA, 4Z8C|1|1A, 4WQF|1|AA, 8CVK|1|1A, 5J4C|1|1A, 6XHW|1|1A, 4V9R|1|DA, 4W2G|1|DA, 5HCP|1|2A, 4W2H|1|DA, 7MD7|1|1A, 4V8D|1|DA, 7U2I|1|1A, 5HD1|1|1A, 7RQD|1|1A, 5HCP|1|1A, 4W2G|1|BA, 4V8G|1|BA, 8EV6|1|1A, 4V8B|1|BA, 5W4K|1|2A, 6OF1|1|2A, 4V8G|1|DA, 6XHV|1|1A, 6CFJ|1|2A, 4Z3S|1|1A, 4W2H|1|BA, 4Z3S|1|2A, 4W2I|1|BA, 6ND5|1|1A, 7RQD|1|2A, 4W2I|1|DA, 7MD7|1|2A, 7U2I|1|2A, 5HAU|1|1A, 6XHW|1|2A, 5HAU|1|2A, 8CVJ|1|1A, 4LNT|1|RA, 5WIS|1|2A, 8CVK|1|2A, 6XHV|1|2A, 8EV6|1|2A, 6XQD|1|1A, 7RQA|1|1A, 4W2F|1|DA, 6ND5|1|2A, 4WQU|1|CA, 4W2F|1|BA, 4WQF|1|CA, 4V8B|1|DA, 6O97|1|1A, 1VY7|1|BA, 7RQA|1|2A, 4Y4P|1|1A, 4WQY|1|AA, 4Y4P|1|2A, 8CVL|1|1A, 1VY5|1|DA, 5WIT|1|1A, 1VY7|1|DA, 1VY5|1|BA, 7RQ9|1|1A, 6XQD|1|2A, 5DOY|1|2A, 8CVJ|1|2A, 5DOY|1|1A, 6O97|1|2A, 8CVL|1|2A, 7RQ9|1|2A, 5WIT|1|2A, 1VY6|1|DA, 6ND6|1|1A, 1VY6|1|BA, 7JQL|1|1A, 4WQY|1|CA, 4V90|1|BA, 6ND6|1|2A, 7JQL|1|2A, 4V51|1|BA, 6UO1|1|1A, 4V51|1|DA, 5F8K|1|1A, 6UO1|1|2A, 4W2E|1|A, 6XQE|1|1A, 4V7Y|1|BA, 4V7Y|1|DA, 5F8K|1|2A, 6XQE|1|2A, 4V7L|1|BA, 4V7X|1|BA, 4V7X|1|DA, 4V67|1|BA, 4V7L|1|DA, 4V7W|1|BA, 4V7W|1|DA, 4V67|1|DA, 6GSJ|1|1H, 6GSJ|1|14
24NR_3.0_55002.1
Exact match
Thermococcus kodakarensis
6TH6|1|BA (6TH6)
  • 23S rRNA, 23S ribosomal RNA
  • Electron microscopy
  • Release Date: 2020-07-29
  • Standardized name: LSU rRNA
  • Source: Archaea
  • Rfam: RF02540
2.6 Å2778(3) 6TH6|1|BA, 6SKG|1|BA, 6SKF|1|BA
25NR_3.0_03110.1
Exact match
Flavobacterium johnsoniae
7JIL|1|1 (7JIL)
  • RNA (2862-MER)
  • Electron microscopy
  • Release Date: 2020-12-02
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.8 Å2742(1) 7JIL|1|1
26NR_3.0_98632.6
Exact match
Enterococcus faecalis
7P7Q|1|A (7P7Q)
  • 23S rRNA
  • Electron microscopy
  • Release Date: 2022-02-23
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.4 Å2739(7) 7P7Q|1|A, 7NHK|1|A, 7P7R|1|A, 7P7T|1|A, 7P7S|1|A, 6W6P|1|A, 6WU9|1|A
27NR_3.0_26150.2
Exact match
Haloarcula marismortui
4V9F|1|0 (4V9F)
  • 23S RRNA, 23S RIBOSOMAL RNA, 5'-R(CCGGCG[...]
  • X-ray diffraction
  • Release Date: 2014-07-09
  • Standardized name: LSU rRNA
  • Source: Archaea
  • Rfam: RF02540
2.4 Å2706(55) 4V9F|1|0, 1S72|1|0, 1JJ2|1|0, 1YI2|1|0, 3CCU|1|0, 3CCL|1|0, 1YHQ|1|0, 1YIJ|1|0, 3CMA|1|0, 3CCV|1|0, 3G6E|1|0, 3G71|1|0, 3CD6|1|0, 2QEX|1|0, 3CCM|1|0, 3I56|1|0, 2OTL|1|0, 3CCS|1|0, 1YJN|1|0, 1YJ9|1|0, 3CC4|1|0, 3CCQ|1|0, 1YIT|1|0, 3CC2|1|0, 2OTJ|1|0, 3CCR|1|0, 3CC7|1|0, 2QA4|1|0, 3CCE|1|0, 3OW2|1|0, 1VQO|1|0, 1VQ8|1|0, 1VQP|1|0, 1VQK|1|0, 1VQN|1|0, 1VQ9|1|0, 1VQ7|1|0, 1VQ4|1|0, 1VQ6|1|0, 3CPW|1|0, 3CME|1|0, 1M90|1|A, 3CXC|1|0, 1QVG|1|0, 1NJI|1|A, 1VQ5|1|0, 1Q81|1|A, 1Q82|1|A, 1K9M|1|A, 1KD1|1|A, 1K8A|1|A, 1Q86|1|A, 1FFK|1|0, 1FG0|1|A, 1N8R|1|A
28NR_3.0_20305.5
Exact match
Spinacia oleracea
6ERI|1|AA (6ERI)
  • 23S ribosomal RNA
  • Electron microscopy
  • Release Date: 2018-04-18
  • Standardized name: LSU rRNA
  • Source: Chloroplast
  • Rfam: RF02541
3.0 Å2696(1) 6ERI|1|AA
29NR_3.0_88987.9
Exact match
Deinococcus radiodurans
5DM6|1|X (5DM6)
  • ribosomal 23S RNA, 23S ribosomal RNA
  • X-ray diffraction
  • Release Date: 2015-11-11
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.9 Å2686(3) 5DM6|1|X, 5DM7|1|X, 2ZJR|1|X
30NR_3.0_39468.1
New id, 1 parent
Spraguea lophii 42_110
7QCA|1|L50 (7QCA)
  • RNA 23S
  • Electron microscopy
  • Release Date: 2022-11-30
  • Standardized name: LSU rRNA
  • Source: Eukarya
  • Rfam: RF02543
2.8 Å2499(1) 7QCA|1|L50
31NR_3.0_56778.1
Exact match
Paranosema locustae
6ZU5|1|L50 (6ZU5)
  • 25S rRNA
  • Electron microscopy
  • Release Date: 2020-11-04
  • Standardized name: LSU rRNA
  • Source: Eukarya
  • Rfam: RF02543
2.9 Å2455(1) 6ZU5|1|L50
32NR_3.0_00138.1
Exact match
Giardia lamblia ATCC 50803
7PWG|1|1+7PWG|1|4 (7PWG)
  • rRNA 28S, rRNA 5.8S, P-site tRNA
  • Electron microscopy
  • Release Date: 2022-04-20
  • Standardized name: LSU rRNA
  • Source: Eukarya
  • Rfam: RF02543
2.8 Å2426(2) 7PWG|1|1+7PWG|1|4, 7PWO|1|1+7PWO|1|42
33NR_3.0_67642.1
Exact match
Encephalitozoon cuniculi GB-M1
7QEP|1|1 (7QEP)
  • 5.8S-23S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-02-09
  • Standardized name: LSU rRNA
  • Source: Eukarya
  • Rfam: RF02543
2.7 Å2319(1) 7QEP|1|1
34NR_3.0_78541.1
Exact match
Schizosaccharomyces pombe
8EUG|1|1+8EUG|1|2 (8EUG)
  • RNA (2231-MER), RNA (150-MER), RNA (2863[...]
  • Electron microscopy
  • Release Date: 2022-11-30
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.8 Å2230(4) 8EUG|1|1+8EUG|1|2, 8ESQ|1|1+8ESQ|1|2, 8EV3|1|1+8EV3|1|2, 8EUY|1|1+8EUY|1|2
35NR_3.0_51645.1
Exact match
Drosophila melanogaster
6XU8|1|B2 (6XU8)
  • 18S ribosomal RNA
  • Electron microscopy
  • Release Date: 2021-07-28
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
3.0 Å1936(1) 6XU8|1|B2
36NR_3.0_48690.1
Exact match
Chaetomium thermophilum var. thermophilum DSM 1495
7R81|1|A2 (7R81)
  • 18S rRNA
  • Electron microscopy
  • Release Date: 2021-12-01
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
2.7 Å1764(3) 7R81|1|A2, 7OLC|1|2, 7OLD|1|2
37NR_3.0_03510.53
Updated, 1 parent
Saccharomyces cerevisiae
4V88|1|A6 (4V88)
  • 18S rRNA, 18S ribosomal RNA, Saccharomyc[...]
  • X-ray diffraction
  • Release Date: 2014-07-09
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
3.0 Å1750(44) 4V88|1|A6, 5TBW|1|sR, 4V88|1|A2, 5TBW|1|A, 7OSA|1|18S, 7OSM|1|18S, 8EVP|1|B5, 7ZW0|1|2, 8EWC|1|B5, 7PZY|1|A, 7ZUX|1|2, 8EUB|1|B5, 6T4Q|1|C2, 7Q08|1|A, 8EVQ|1|B5, 7MPJ|1|B5, 7Q0F|1|A, 7Q0R|1|A, 4U4R|1|6, 6WOO|1|2, 8EWB|1|B5, 6TB3|1|2, 6SNT|1|2, 7Q0P|1|A, 4U3U|1|6, 4U4R|1|2, 7A1G|1|2, 6ZVI|1|h, 8CAH|1|2, 4U3U|1|2, 4U3M|1|6, 4U4Q|1|6, 4U4U|1|6, 4U52|1|6, 4U3M|1|2, 4U52|1|2, 4U4U|1|2, 4U4Q|1|2, 8C01|1|2, 8EVT|1|B5, 8C00|1|2, 8EVS|1|B5, 8EVR|1|B5, 8C83|1|2
38NR_3.0_46995.30
Exact match
Homo sapiens
8GLP|1|S2 (8GLP)
  • 18S rRNA (1740-MER), 18S rRNA, 18S ribos[...]
  • Electron microscopy
  • Release Date: 2023-04-19
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
1.7 Å1707(35) 8GLP|1|S2, 7R4X|1|2, 8G5Y|1|S2, 6ZMI|1|S2, 7XNY|1|S2, 6ZM7|1|S2, 6ZLW|1|2, 7XNX|1|S2, 6ZVH|1|2, 6Z6N|1|S2, 8G5Z|1|S2, 8G60|1|S2, 6ZOJ|1|2, 6ZP4|1|2, 6ZXG|1|2, 6ZME|1|S2, 6Z6L|1|S2, 6QZP|1|S2, 6ZV6|1|2, 6ZON|1|2, 6ZXH|1|2, 7QVP|1|S2, 7K5I|1|2, 8G6J|1|S2, 7QVP|1|S3, 7MQA|1|L1, 6ZXE|1|2, 6Y2L|1|S2, 8G61|1|S2, 6XA1|1|S2, 7WTZ|1|2, 7WTU|1|2, 6ZMT|1|2, 6ZOK|1|2, 6ZOL|1|2
39NR_3.0_21280.29
Updated, 1 parent
Oryctolagus cuniculus
7O7Y|1|A2 (7O7Y)
  • 18S ribosomal RNA, rRNA, 18S rRNA
  • Electron microscopy
  • Release Date: 2021-06-02
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
2.2 Å1698(12) 7O7Y|1|A2, 7OYD|1|9, 7O7Z|1|A2, 7JQB|1|A, 7ZJW|1|S2, 7UCK|1|9, 6SGC|1|A1, 7TOR|1|A18S, 7O80|1|A2, 8P2K|1|A2, 6YAL|1|2, 6R5Q|1|K
40NR_3.0_38178.1
Exact match
Rattus norvegicus
7QGG|1|S2 (7QGG)
  • RNA (1872-MER)
  • Electron microscopy
  • Release Date: 2022-10-26
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
2.9 Å1681(1) 7QGG|1|S2
41NR_3.0_51105.1
Exact match
Mus musculus
7CPU|1|S2 (7CPU)
  • Mus musculus 18S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-02-02
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
2.8 Å1656(1) 7CPU|1|S2
42NR_3.0_50188.1
Exact match
Sus scrofa
6YDP|1|BA (6YDP)
  • 12S rRNA
  • Electron microscopy
  • Release Date: 2020-07-15
  • Standardized name: tRNA
  • Source: Mitochondria
  • Rfam: RF00005
3.0 Å1544(1) 6YDP|1|BA
43NR_3.0_74023.9
Exact match
Staphylococcus aureus
6S0X|1|a (6S0X)
  • 16S ribosomal RNA, 16S rRNA
  • Electron microscopy
  • Release Date: 2019-08-21
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.4 Å1539(4) 6S0X|1|a, 5NGM|1|Aa, 7P48|1|a, 7ASP|1|X
44NR_3.0_36683.2
Exact match
Leishmania donovani
6AZ3|1|1+6AZ3|1|7 (6AZ3)
  • 26S alpha ribosomal RNA, 5.8S ribosomal [...]
  • Electron microscopy
  • Release Date: 2017-12-06
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.5 Å1538(3) 6AZ3|1|1+6AZ3|1|7, 5T2A|1|A+5T2A|1|C, 3JCS|1|1+3JCS|1|7
45NR_3.0_56726.107
Updated, 1 parent
Escherichia coli
5J7L|1|AA (5J7L)
  • 16S rRNA, messenger RNA, 16S ribosomal R[...]
  • X-ray diffraction
  • Release Date: 2016-07-27
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
3.0 Å1538(135) 5J7L|1|AA, 4YBB|1|AA, 4WOI|1|DA, 4WOI|1|AA, 4V9P|1|FA, 4V9O|1|BA, 5J7L|1|BA, 4V9P|1|HA, 4V9P|1|DA, 4V9P|1|BA, 4V9O|1|FA, 5J91|1|AA, 6I7V|1|AA, 4V9O|1|DA, 4U27|1|AA, 4YBB|1|BA, 4U1U|1|AA, 4U26|1|AA, 4V9D|1|AA, 6I7V|1|BA, 4U24|1|AA, 4U25|1|AA, 4V9D|1|BA, 4U27|1|CA, 4V9O|1|HA, 4U20|1|AA, 4U1U|1|CA, 4U1V|1|AA, 4U25|1|CA, 4U26|1|CA, 5J91|1|BA, 4U24|1|CA, 4U1V|1|CA, 4U20|1|CA, 5J5B|1|AA, 5J5B|1|BA, 8B0X|1|A, 8FTO|1|A, 8AYE|1|A, 7K00|1|A, 8G6W|1|A, 8BIM|1|2, 8BIL|1|2, 8EMM|1|A, 8BGE|1|2, 8EIU|1|A, 8BF7|1|2, 7S1H|1|C, 7N1P|1|16, 8BHL|1|2, 8AKN|1|B, 7S1K|1|C, 7S1J|1|C, 7S1I|1|C, 7S1G|1|C, 7O1A|1|AA, 8BHP|1|2, 7N2U|1|16, 7N2V|1|16, 7SA4|1|2, 6YSS|1|a, 8BH4|1|2, 7UG7|1|16, 6XZB|1|A1, 7NWT|1|2, 7N30|1|16, 7N31|1|16, 7ZTA|1|16S1, 6TC3|1|16S1, 6TBV|1|16S1, 8EKC|1|a, 7N2C|1|16, 6XZA|1|A1, 8BHJ|1|2, 8CGJ|1|A, 7M5D|1|2, 6Y69|1|a, 7O1C|1|AA, 8AM9|1|B, 8BGH|1|2, 7NSO|1|a, 7ST2|1|3, 5AFI|1|a, 7BOH|1|A, 7OT5|1|2, 7OTC|1|a, 7B5K|1|a, 8SYL|1|a, 5NWY|1|0, 7OIZ|1|A, 7P3K|1|A, 7ST6|1|3, 6WD0|1|3, 7TOS|1|16S, 6H4N|1|a, 6WDE|1|3, 6ORE|1|2, 8GHU|1|a, 5WDT|1|a, 5WFS|1|a, 7O19|1|AA, 7OIF|1|2, 7OII|1|2, 8B7Y|1|C, 7BOE|1|A, 8BHN|1|2, 5MDV|1|2, 7Q4K|1|AA, 7NAX|1|A, 6ZTP|1|AA, 6ZU1|1|AA, 6ZTO|1|AA, 8CGU|1|A, 8CAI|1|A, 7NAR|1|A, 7OE0|1|A, 8CEP|1|A, 8EYT|1|A, 8CGR|1|A, 5IQR|1|2, 7BOG|1|A, 7BOD|1|A, 7BOF|1|A, 7BOI|1|A, 8CF1|1|A, 7PJS|1|a, 8CGI|1|A, 8CA7|1|A, 8CAZ|1|A, 7OI0|1|A, 8CF8|1|A, 7AF8|1|1, 7AF3|1|1, 7AF5|1|1, 7AFA|1|1
46NR_3.0_94066.6
Exact match
Bacillus subtilis subsp. subtilis str. 168
8BUU|1|a (8BUU)
  • 16S rRNA, mRNA
  • Electron microscopy
  • Release Date: 2023-04-05
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.9 Å1538(1) 8BUU|1|a
47NR_3.0_12763.27
Exact match
Homo sapiens
7QI4|1|A (7QI4)
  • 16s rRNA, 16S mitochondrial rRNA, 16S mi[...]
  • Electron microscopy
  • Release Date: 2022-07-13
  • Standardized name: LSU rRNA
  • Source: Mitochondria
  • Rfam: RF02541
2.2 Å1527(20) 7QI4|1|A, 7OF0|1|A, 6ZM6|1|A, 7QI5|1|A, 7O9M|1|A, 7OF6|1|A, 8ANY|1|A, 8OIT|1|B8, 7OF4|1|A, 6ZM5|1|A, 7OF7|1|A, 7QI6|1|A, 6VMI|1|A, 6VLZ|1|A, 7OF2|1|A, 7OF3|1|A, 7ODR|1|A, 7OF5|1|A, 7PO4|1|A, 7QH7|1|A
48NR_3.0_66687.6
Exact match
Enterococcus faecalis
7P7Q|1|a (7P7Q)
  • 16S rRNA, RNA (5'-R(P*GP*GP*AP*GP*GP*UP*[...]
  • Electron microscopy
  • Release Date: 2022-02-23
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.4 Å1523(6) 7P7Q|1|a, 6W6P|1|a, 7P7R|1|a, 7P7T|1|a, 7NHK|1|a, 7P7S|1|a
49NR_3.0_43481.4
Exact match
Acinetobacter baumannii
7UW1|1|a (7UW1)
  • 16s Ribosomal RNA
  • Electron microscopy
  • Release Date: 2023-04-19
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.2 Å1519(22) 7UW1|1|a, 7UVZ|1|a, 7UVX|1|a, 7UVW|1|a, 7RYG|1|a, 7UVY|1|a, 7RYH|1|a, 7UVV|1|a, 7M4Y|1|a, 7M4W|1|a, 7RYF|1|a, 7M4X|1|a, 7M4U|1|a, 6V3A|1|sN1, 6V3B|1|sN1, 7M4Z|1|a, 6YT9|1|2, 6YPU|1|2, 6YS5|1|3, 6YTF|1|3, 6YT9|1|4, 6YPU|1|4
50NR_3.0_65669.1
Exact match
Pseudomonas aeruginosa
7UNW|1|a (7UNW)
  • 16S rRNA, 16S Ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-06-22
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.6 Å1519(6) 7UNW|1|a, 7UNV|1|a, 7UNU|1|a, 7UNR|1|a, 6SPC|1|a, 6SPF|1|a
51NR_3.0_69503.1
Exact match
Listeria monocytogenes EGD-e
7NHN|1|a (7NHN)
  • 16S rRNA, RNA (5'-R(P*GP*AP*GP*GP*UP*NP*[...]
  • Electron microscopy
  • Release Date: 2021-05-05
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.9 Å1513(1) 7NHN|1|a
52NR_3.0_74958.1
Exact match
Mycobacterium tuberculosis
7SFR|1|a (7SFR)
  • 16S rRNA
  • Electron microscopy
  • Release Date: 2022-10-12
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.6 Å1511(1) 7SFR|1|a
53NR_3.0_97539.2
Exact match
Mycobacterium tuberculosis H37Rv
7KGB|1|a (7KGB)
  • 16S rRNA, 16S rRNA (1511-MER)
  • Electron microscopy
  • Release Date: 2022-01-19
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.7 Å1511(7) 7KGB|1|a, 7MT7|1|a, 7MT2|1|a, 8FR8|1|a, 7MSM|1|a, 7MT3|1|a, 7MSC|1|a
54NR_3.0_65795.74
Exact match
Thermus thermophilus
4Y4O|1|1a (4Y4O)
  • 16S RIBOSOMAL RNA, 16S rRNA, mRNA
  • X-ray diffraction
  • Release Date: 2015-03-18
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.3 Å1507(190) 4Y4O|1|1a, 7RQB|1|1a, 8FC5|1|1a, 8FC6|1|1a, 4Y4O|1|2a, 8FC2|1|1a, 8FC5|1|2a, 4V9H|1|AA, 8FC6|1|2a, 5FDV|1|2a, 8FC2|1|2a, 7RQB|1|2a, 5FDV|1|1a, 8FC1|1|1a, 5FDU|1|2a, 5FDU|1|1a, 8T8B|1|1a, 5HCQ|1|1a, 6CAE|1|1a, 5IBB|1|1G, 8FC3|1|1a, 5IBB|1|13, 6CFL|1|1a, 5HCQ|1|2a, 7RQE|1|1a, 6XHX|1|1a, 7U2H|1|1a, 7U2J|1|1a, 5IB7|1|13, 8T8B|1|2a, 8FC3|1|2a, 5J4B|1|1a, 8FC1|1|2a, 5E81|1|13, 7RQ8|1|1a, 6CFK|1|1a, 5E81|1|1G, 6CFL|1|2a, 8EKB|1|1a, 6XHX|1|2a, 6XHY|1|1a, 8EV7|1|1a, 6CAE|1|2a, 7U2J|1|2a, 7RQE|1|2a, 8EKB|1|2a, 5IB7|1|1G, 6CFJ|1|1a, 6OF1|1|1a, 6CFK|1|2a, 5J4C|1|1a, 5W4K|1|1a, 8T8C|1|1a, 7RQC|1|1a, 5J4B|1|2a, 5J8B|1|a, 4Z8C|1|1a, 5HCR|1|1a, 6XHY|1|2a, 7U2H|1|2a, 4WSD|1|13, 5NDK|1|1G, 4Z8C|1|2a, 5WIS|1|1a, 4V8I|1|AA, 8EV7|1|2a, 2UXC|1|A, 5NDK|1|13, 4WPO|1|BA, 6OF1|1|2a, 1VY4|1|AA, 6XHW|1|1a, 5HCR|1|2a, 7U2I|1|1a, 6ND5|1|1a, 8T8C|1|2a, 4Z3S|1|1a, 8FC4|1|1a, 6CFJ|1|2a, 8EV6|1|1a, 7RQC|1|2a, 6XHV|1|1a, 4LNT|1|XA, 4V8D|1|AA, 5J4C|1|2a, 4W2I|1|AA, 7MD7|1|1a, 5HD1|1|1a, 4LNT|1|QA, 7RQ8|1|2a, 5HCP|1|1a, 4W2I|1|CA, 5W4K|1|2a, 4W2G|1|AA, 4WPO|1|DA, 4V8D|1|CA, 8CVK|1|1a, 7RQD|1|1a, 6O97|1|1a, 8FC4|1|2a, 4Z3S|1|2a, 6XHV|1|2a, 4WSD|1|1G, 5HCP|1|2a, 5HAU|1|1a, 4W2G|1|CA, 6XHW|1|2a, 5HAU|1|2a, 5HD1|1|2a, 4W2H|1|AA, 6ND5|1|2a, 8EV6|1|2a, 4V8I|1|CA, 4W2H|1|CA, 7U2I|1|2a, 5WIS|1|2a, 7RQD|1|2a, 4V8B|1|AA, 4Y4P|1|1a, 5WIT|1|1a, 4W2F|1|AA, 1FJG|1|A, 5DOY|1|1a, 8CVK|1|2a, 1VY4|1|CA, 7MD7|1|2a, 8CVJ|1|1a, 5DOY|1|2a, 4W2E|1|a, 6O97|1|2a, 4V8B|1|CA, 7RQ9|1|1a, 7RQA|1|1a, 1VY5|1|AA, 6XQD|1|2a, 7RQA|1|2a, 6XQD|1|1a, 4WQU|1|BA, 4V9R|1|CA, 5WIT|1|2a, 4V9R|1|AA, 8CVL|1|1a, 6ND6|1|1a, 4W2F|1|CA, 6UO1|1|1a, 7RQ9|1|2a, 4Y4P|1|2a, 8CVJ|1|2a, 1VY7|1|AA, 6UO1|1|2a, 4WQF|1|BA, 1VY6|1|AA, 8CVL|1|2a, 6ND6|1|2a, 1XMQ|1|A, 1VY5|1|CA, 4V51|1|AA, 1VY6|1|CA, 4WQF|1|DA, 7JQL|1|1a, 4WQU|1|DA, 4V51|1|CA, 1VY7|1|CA, 7JQL|1|2a, 4WQY|1|BA, 1N32|1|A, 3T1Y|1|A, 5F8K|1|1a, 4V90|1|AA, 6XQE|1|1a, 4WQY|1|DA, 4V7L|1|AA, 5F8K|1|2a, 4V8G|1|CA, 6XQE|1|2a, 4V7L|1|CA, 4V67|1|AA, 4V67|1|CA, 4V7Y|1|CA, 4V7Y|1|AA, 4V8G|1|AA, 4V7W|1|CA, 4V7X|1|CA, 4V7X|1|AA, 4V7W|1|AA, 4B3M|1|A, 4B3T|1|A, 4B3R|1|A, 6GSJ|1|1G, 6GSJ|1|13
55NR_3.0_67193.3
Exact match
Saccharomyces cerevisiae
8D8L|1|a (8D8L)
  • 15S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-12-14
  • Standardized name: SSU rRNA
  • Source: Mitochondria
  • Rfam: RF00177
2.6 Å1506(1) 8D8L|1|a
56NR_3.0_11741.1
Exact match
Danio rerio
7OYB|1|22 (7OYB)
  • 18S rRNA
  • Electron microscopy
  • Release Date: 2022-07-13
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
2.4 Å1502(1) 7OYB|1|22
57NR_3.0_63356.1
Exact match
Xenopus laevis
7OYC|1|22 (7OYC)
  • 18S rRNA
  • Electron microscopy
  • Release Date: 2022-07-20
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
2.4 Å1495(1) 7OYC|1|22
58NR_3.0_35798.1
Exact match
Cutibacterium acnes
8CRX|1|A (8CRX)
  • RNA (1537-MER), 16S ribosomal RNA
  • Electron microscopy
  • Release Date: 2023-03-22
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.8 Å1493(2) 8CRX|1|A, 8CWO|1|A
59NR_3.0_96354.4
Exact match
Spinacia oleracea
6ERI|1|BA (6ERI)
  • 16S ribosomal RNA
  • Electron microscopy
  • Release Date: 2018-04-18
  • Standardized name: SSU rRNA
  • Source: Chloroplast
  • Rfam: RF00177
3.0 Å1481(1) 6ERI|1|BA
60NR_3.0_23083.1
Exact match
Flavobacterium johnsoniae
7JIL|1|2 (7JIL)
  • RNA (1519-MER)
  • Electron microscopy
  • Release Date: 2020-12-02
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
2.8 Å1475(1) 7JIL|1|2
61NR_3.0_45705.1
Exact match
Neurospora crassa OR74A
6YW5|1|aa (6YW5)
  • 16S rRNA
  • Electron microscopy
  • Release Date: 2020-11-11
  • Standardized name: SSU rRNA
  • Source: Mitochondria
  • Rfam: RF00177
2.9 Å1435(2) 6YW5|1|aa, 6YWE|1|aa
62NR_3.0_40313.4
Exact match
Thermococcus kodakarensis
7ZHG|1|2 (7ZHG)
  • 16S rRNA, 16S ribosomal RNA, rRNA, mRNA,[...]
  • Electron microscopy
  • Release Date: 2022-06-29
  • Standardized name: SSU rRNA
  • Source: Archaea
  • Rfam: RF01959
2.3 Å1385(8) 7ZHG|1|2, 6TH6|1|Aa, 7ZAI|1|2, 7ZAH|1|2, 6SKG|1|Aa, 6TMF|1|A, 7ZAG|1|2, 6SKF|1|Aa
63NR_3.0_62666.1
New id, 1 parent
Spraguea lophii 42_110
7QCA|1|S60 (7QCA)
  • RNA SSU
  • Electron microscopy
  • Release Date: 2022-11-30
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF02542
2.8 Å1354(1) 7QCA|1|S60
64NR_3.0_60443.1
Exact match
Giardia lamblia ATCC 50803
7PWO|1|2 (7PWO)
  • rRNA 18S
  • Electron microscopy
  • Release Date: 2022-04-20
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
2.8 Å1340(2) 7PWO|1|2, 7PWF|1|2
65NR_3.0_82907.1
Exact match
Paranosema locustae
6ZU5|1|S60 (6ZU5)
  • 18S rRNA
  • Electron microscopy
  • Release Date: 2020-11-04
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF02542
2.9 Å1336(1) 6ZU5|1|S60
66NR_3.0_41328.1
Exact match
Encephalitozoon cuniculi GB-M1
7QEP|1|3 (7QEP)
  • 18S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-02-09
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF02542
2.7 Å1295(1) 7QEP|1|3
67NR_3.0_25467.1
Exact match
Trypanosoma cruzi
5T5H|1|A+5T5H|1|C (5T5H)
  • RNA LARGE SUBUNIT ALPHA, 5.8S rRNA
  • Electron microscopy
  • Release Date: 2016-10-12
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
2.5 Å1246(1) 5T5H|1|A+5T5H|1|C
68NR_3.0_60178.1
Exact match
Leishmania donovani
6AZ3|1|2 (6AZ3)
  • 26S delta ribosomal RNA, rRNA beta
  • Electron microscopy
  • Release Date: 2017-12-06
  • Standardized name: LSU rRNA
  • Source: Eukarya
  • Rfam: RF02543
2.5 Å1093(2) 6AZ3|1|2, 3JCS|1|2
69NR_3.0_29429.1
Exact match
Leishmania donovani
5T2A|1|B (5T2A)
  • LSU-beta
  • Electron microscopy
  • Release Date: 2017-01-25
  • Standardized name: LSU rRNA
  • Source: Eukarya
  • Rfam: RF02543
2.9 Å1064(1) 5T2A|1|B
70NR_3.0_87525.4
Exact match
Solanum lycopersicum
8B2L|1|h1 (8B2L)
  • 18S rRNA body, 18S, 18S rRNA
  • Electron microscopy
  • Release Date: 2023-08-23
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
2.2 Å1060(4) 8B2L|1|h1, 8AUV|1|h, 7QIZ|1|S2, 7QIX|1|2
71NR_3.0_52597.1
Exact match
Sus scrofa
6YDP|1|AA (6YDP)
  • 12S rRNA
  • Electron microscopy
  • Release Date: 2020-07-15
  • Standardized name: tRNA
  • Source: Mitochondria
  • Rfam: RF00005
3.0 Å960(1) 6YDP|1|AA
72NR_3.0_93855.16
Exact match
Homo sapiens
7QI4|1|AA (7QI4)
  • 12S mitochondrial rRNA, 12s rRNA
  • Electron microscopy
  • Release Date: 2022-07-13
  • Standardized name: SSU rRNA
  • Source: Mitochondria
  • Rfam: RF00177
2.2 Å950(20) 7QI4|1|AA, 7P2E|1|A, 6ZM6|1|AA, 7QI5|1|AA, 7PNX|1|A, 8ANY|1|AA, 8CSS|1|A, 6ZM5|1|AA, 7QI6|1|AA, 6VMI|1|AA, 7PO3|1|A, 7PO1|1|A, 7PO0|1|A, 6VLZ|1|AA, 6RW4|1|A, 8OIS|1|AA, 8CSR|1|A, 8CST|1|A, 8CSQ|1|A, 8CSP|1|A
73NR_3.0_97060.1
Exact match
Trypanosoma cruzi
5T5H|1|B (5T5H)
  • RNA LARGE SUBUNIT BETA, srRNA3
  • Electron microscopy
  • Release Date: 2016-10-12
  • Standardized name: LSU rRNA
  • Source: Eukarya
  • Rfam: RF02543
2.5 Å910(1) 5T5H|1|B
74NR_3.0_48882.1
Exact match
Chlamydomonas reinhardtii
7PKT|1|7+7PKT|1|6 (7PKT)
  • L7 rRNA, L6 rRNA
  • Electron microscopy
  • Release Date: 2022-06-15
  • Standardized name: LSU rRNA
  • Source: Mitochondria
  • Rfam: RF02541
3.0 Å578(1) 7PKT|1|7+7PKT|1|6
75NR_3.0_81085.1
Exact match
[Eubacterium] rectale
7UIN|1|B (7UIN)
  • E.r IIC Intron
  • Electron microscopy
  • Release Date: 2022-11-23
  • Standardized name: Group II catalytic intron
  • Source: Bacteria
  • Rfam: RF00029
2.8 Å541(1) 7UIN|1|B
76NR_3.0_77647.2
Exact match
Polytomella magna
8A22|1|A7+8A22|1|A6 (8A22)
  • mtLSU-7, mtLSU-6
  • Electron microscopy
  • Release Date: 2022-11-16
  • Standardized name: LSU rRNA
  • Source: Mitochondria
  • Rfam: RF02541
2.9 Å534(1) 8A22|1|A7+8A22|1|A6
77NR_3.0_61911.1
Exact match
Cutibacterium acnes
8CVO|1|A (8CVO)
  • 16S ribosomal RNA
  • Electron microscopy
  • Release Date: 2023-03-15
  • Standardized name: SSU rRNA
  • Source: Bacteria
  • Rfam: RF00177
3.0 Å469(1) 8CVO|1|A
78NR_3.0_54814.1
Exact match
Solanum lycopersicum
7QIY|1|2 (7QIY)
  • 18S rRNA head
  • Electron microscopy
  • Release Date: 2022-06-15
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
2.6 Å447(1) 7QIY|1|2
79NR_3.0_26809.1
Exact match
Chlamydomonas reinhardtii
7PKT|1|8 (7PKT)
  • L8 rRNA
  • Electron microscopy
  • Release Date: 2022-06-15
  • Standardized name: LSU rRNA
  • Source: Mitochondria
  • Rfam: RF02541
3.0 Å413(1) 7PKT|1|8
80NR_3.0_35054.4
Exact match
Oceanobacillus iheyensis
4FAR|1|A (4FAR)
  • Group II intron, Ligated EXON product, G[...]
  • X-ray diffraction
  • Release Date: 2012-11-14
  • Standardized name: Group II catalytic intron D1-D4-1
  • Source: Bacteria
  • Rfam: RF01998
2.9 Å389(10) 4FAR|1|A, 4E8N|1|A, 4FAU|1|A, 4E8Q|1|A, 4Y1O|1|A, 4Y1O|1|B, 4FAW|1|A, 3G78|1|A, 4Y1N|1|B, 4Y1N|1|A
81NR_3.0_67969.2
Exact match
Polytomella magna
8A22|1|B3+8A22|1|B2+8A22|1|B1 (8A22)
  • mtSSU-3, mtSSU-2, mtSSU-1
  • Electron microscopy
  • Release Date: 2022-11-16
  • Standardized name: SSU rRNA
  • Source: Mitochondria
  • Rfam: RF00177
2.9 Å373(1) 8A22|1|B3+8A22|1|B2+8A22|1|B1
82NR_3.0_11738.2
Exact match
Polytomella magna
8A22|1|A8 (8A22)
  • mtLSU-8
  • Electron microscopy
  • Release Date: 2022-11-16
  • Standardized name: LSU rRNA
  • Source: Mitochondria
  • Rfam: RF02541
2.9 Å350(1) 8A22|1|A8
83NR_3.0_69141.3
Exact match
Tetrahymena thermophila
7YGA|1|N (7YGA)
  • Group I intron, 5 prime fragment, Group [...]
  • Electron microscopy
  • Release Date: 2023-03-29
  • Standardized name: Group I catalytic intron
  • Source: Eukarya
  • Rfam: RF00028
2.4 Å343(10) 7YGA|1|N, 7XD6|1|N, 7YGB|1|N, 8I7N|1|N, 7YGC|1|N, 7XD5|1|N, 7YG9|1|N, 7YG8|1|N, 7YCI|1|N, 7R6L|1|A
84NR_3.0_40909.2
Exact match
Polytomella magna
8A22|1|B4 (8A22)
  • mtSSU-4
  • Electron microscopy
  • Release Date: 2022-11-16
  • Standardized name: SSU rRNA
  • Source: Mitochondria
  • Rfam: RF00177
2.9 Å332(1) 8A22|1|B4
85NR_3.0_05306.1
Exact match
Saccharomyces cerevisiae BY4741
7R6Q|1|1+7R6Q|1|2 (7R6Q)
  • 25S rRNA, 5.8S rRNA
  • Electron microscopy
  • Release Date: 2022-11-09
  • Standardized name: LSU rRNA + 5.8S rRNA
  • Source: Eukarya
  • Rfam: RF02543 + RF00002
3.0 Å295(1) 7R6Q|1|1+7R6Q|1|2
86NR_3.0_64006.2
Exact match
Saccharomyces cerevisiae
7C79|1|A (7C79)
  • RNA component of RNase MRP NME1, Ribonuc[...]
  • Electron microscopy
  • Release Date: 2020-07-08
  • Standardized name: RMRP
  • Source: Eukarya
  • Rfam: RF00030
2.5 Å295(3) 7C79|1|A, 7C7A|1|A, 6W6V|1|A
87NR_3.0_37229.2
Exact match
Canis lupus familiaris
7OBR|1|1 (7OBR)
  • SRP RNA, SRP RNA 7SL
  • Electron microscopy
  • Release Date: 2021-07-21
  • Standardized name: SRP RNA
  • Source: Eukarya
  • Rfam: RF00017
2.8 Å249(2) 7OBR|1|1, 7QWQ|1|1
88NR_3.0_85482.2
Exact match
synthetic construct
8EA4|1|7 (8EA4)
  • sg_RNA
  • Electron microscopy
  • Release Date: 2022-11-30
3.0 Å230(1) 8EA4|1|7
89NR_3.0_40063.1
Exact match
Caldanaerobacter subterraneus subsp. tengcongensis
8SA3|1|A (8SA3)
  • adenosylcobalamin riboswitch form 2
  • Electron microscopy
  • Release Date: 2023-07-26
  • Standardized name: Cobalamin riboswitch
  • Source: Bacteria
  • Rfam: RF00174
3.0 Å210(2) 8SA3|1|A, 8SA3|1|B
90NR_3.0_56686.2
Exact match
Polytomella magna
8A22|1|A3+8A22|1|A2 (8A22)
  • mtLSU-3, mtLSU-2
  • Electron microscopy
  • Release Date: 2022-11-16
  • Standardized name: LSU rRNA
  • Source: Mitochondria
  • Rfam: RF02541
2.9 Å207(1) 8A22|1|A3+8A22|1|A2
91NR_3.0_01867.1
New id, no parents
Saccharomyces cerevisiae
8EVS|1|EC (8EVS)
  • TSV IRES
  • Electron microscopy
  • Release Date: 2023-09-06
2.6 Å201(1) 8EVS|1|EC
92NR_3.0_01315.2
Exact match
Saccharomyces cerevisiae
7B9V|1|2+7B9V|1|6 (7B9V)
  • U2 snRNA, U6 snRNA, Branched intron and [...]
  • Electron microscopy
  • Release Date: 2021-03-10
  • Standardized name: U2 snRNA + U6 snRNA
  • Source: Eukarya
  • Rfam: RF00004 + RF00026
2.8 Å196(1) 7B9V|1|2+7B9V|1|6
93NR_3.0_04576.1
New id, 1 parent
Taura syndrome virus
8EVP|1|EC (8EVP)
  • Taura syndrome virus (TSV) internal ribo[...]
  • Electron microscopy
  • Release Date: 2023-09-06
2.4 Å195(6) 8EVP|1|EC, 8EWC|1|EC, 8EUB|1|EC, 8EVQ|1|EC, 8EVR|1|EC, 8EWB|1|EC
94NR_3.0_57460.4
Exact match
Didymium iridis
6GYV|1|A (6GYV)
  • RNA (189-MER), Lariat-capping ribozyme
  • X-ray diffraction, solution scattering
  • Release Date: 2018-08-22
2.5 Å191(2) 6GYV|1|A, 4P9R|1|A
95NR_3.0_13732.1
Exact match
synthetic construct
7UTN|1|C (7UTN)
  • RNA (222-MER)
  • Electron microscopy
  • Release Date: 2022-06-15
2.7 Å184(1) 7UTN|1|C
96NR_3.0_40535.1
Exact match
Leishmania donovani
3JCS|1|3 (3JCS)
  • 26S gamma ribosomal RNA
  • Electron microscopy
  • Release Date: 2016-07-20
2.8 Å184(1) 3JCS|1|3
97NR_3.0_81338.1
Exact match
Chlamydomonas reinhardtii
7PKT|1|3+7PKT|1|4+7PKT|1|5+7PKT|1|2 (7PKT)
  • L3b rRNA, L4 rRNA, L5 rRNA, L2a rRNA
  • Electron microscopy
  • Release Date: 2022-06-15
  • Standardized name: LSU rRNA + LSU rRNA
  • Source: Mitochondria
  • Rfam: RF02541 + RF02541
3.0 Å184(1) 7PKT|1|3+7PKT|1|4+7PKT|1|5+7PKT|1|2
98NR_3.0_29450.1
Exact match
Cricket paralysis virus
7ZJW|1|I (7ZJW)
  • CrPV IRES
  • Electron microscopy
  • Release Date: 2022-10-19
  • Standardized name: CrPV IRES
  • Source: Viruses
  • Rfam: RF00458
2.8 Å183(1) 7ZJW|1|I
99NR_3.0_00917.1
Exact match
metagenome
7XHT|1|B (7XHT)
  • RNA (228-MER)
  • Electron microscopy
  • Release Date: 2022-12-14
2.6 Å179(1) 7XHT|1|B
100NR_3.0_30457.14
Exact match
Saccharomyces cerevisiae
7DCO|1|B (7DCO)
  • U5 snRNA, 5' exon of UBC4 mRNA, pre-mRNA
  • Electron microscopy
  • Release Date: 2021-03-17
  • Standardized name: U5 snRNA
  • Source: Eukarya
  • Rfam: RF00020
2.5 Å178(2) 7DCO|1|B, 7B9V|1|5
101NR_3.0_43482.1
Exact match
Homo sapiens
7MQA|1|L2 (7MQA)
  • U3 snoRNA
  • Electron microscopy
  • Release Date: 2021-09-22
  • Standardized name: U3 snoRNA
  • Source: Eukarya
  • Rfam: RF00012
2.7 Å177(1) 7MQA|1|L2
102NR_3.0_29848.1
Exact match
3DIL|1|A (3DIL)
  • RNA (174-MER)
  • X-ray diffraction
  • Release Date: 2008-09-16
1.9 Å173(11) 3DIL|1|A, 3DIX|1|A, 3DIR|1|A, 3DIY|1|A, 3DIQ|1|A, 3DIO|1|X, 3DIG|1|X, 3DJ2|1|A, 3DIZ|1|A, 3DIM|1|A, 3DJ0|1|A
103NR_3.0_22273.1
Exact match
Leishmania donovani
6AZ3|1|3 (6AZ3)
  • srRNA1, rRNA gamma
  • Electron microscopy
  • Release Date: 2017-12-06
2.5 Å169(2) 6AZ3|1|3, 5T2A|1|E
104NR_3.0_22385.1
Exact match
Saccharomyces cerevisiae
7DCO|1|H+7DCO|1|F (7DCO)
  • U2 snRNA, U6 snRNA, pre-mRNA
  • Electron microscopy
  • Release Date: 2021-03-17
  • Standardized name: U2 snRNA + U6 snRNA
  • Source: Eukarya
  • Rfam: RF00004 + RF00026
2.5 Å169(1) 7DCO|1|H+7DCO|1|F
105NR_3.0_33460.4
Exact match
Homo sapiens
7VPX|1|L (7VPX)
  • U1 snRNA, 5SS
  • Electron microscopy
  • Release Date: 2023-05-03
  • Standardized name: U1 snRNA
  • Source: Eukarya
  • Rfam: RF00003
3.0 Å164(1) 7VPX|1|L
106NR_3.0_90840.5
Exact match
Homo sapiens
8G9Z|1|E (8G9Z)
  • tRNASec, selenocysteine tRNA, RNA (90-ME[...]
  • X-ray diffraction
  • Release Date: 2023-04-05
  • Standardized name: Selenocysteine transfer RNA
  • Source: Eukarya
  • Rfam: RF01852
2.1 Å164(6) 8G9Z|1|E, 7MDL|1|E, 4ZDO|1|E, 4ZDP|1|E, 3HL2|1|E, 7ZJW|1|F
107NR_3.0_13465.1
Exact match
Chlamydomonas reinhardtii
7PKT|1|1 (7PKT)
  • L1 rRNA
  • Electron microscopy
  • Release Date: 2022-06-15
3.0 Å162(1) 7PKT|1|1
108NR_3.0_22479.1
Exact match
3D0U|1|A (3D0U)
  • Lysine Riboswitch RNA, RNA (161-MER), Ly[...]
  • X-ray diffraction
  • Release Date: 2008-07-01
2.8 Å161(4) 3D0U|1|A, 3D0X|1|A, 4ERL|1|A, 4ERJ|1|A
109NR_3.0_70717.1
Exact match
Mycobacterium tuberculosis
6UFG|1|A (6UFG)
  • RNA (166-MER)
  • X-ray diffraction
  • Release Date: 2019-11-20
2.9 Å160(1) 6UFG|1|A
110NR_3.0_39627.4
Exact match
synthetic construct
2R8S|1|R (2R8S)
  • P4-P6 RNA RIBOZYME DOMAIN, P4-P6 DELC209[...]
  • X-ray diffraction
  • Release Date: 2007-12-04
2.0 Å158(9) 2R8S|1|R, 6D8O|1|A, 6D8O|1|B, 1HR2|1|B, 1HR2|1|A, 1L8V|1|B, 1L8V|1|A, 1GID|1|B, 1GID|1|A
111NR_3.0_85596.2
Exact match
Tetrahymena thermophila
7UY6|1|B (7UY6)
  • Telomerase RNA
  • Electron microscopy
  • Release Date: 2022-07-13
  • Standardized name: or TERC
  • Source: Eukarya
  • Rfam: RF00025
2.9 Å156(1) 7UY6|1|B
112NR_3.0_72627.1
Exact match
1U9S|1|A (1U9S)
  • RIBONUCLEASE P
  • X-ray diffraction
  • Release Date: 2004-10-26
2.9 Å155(1) 1U9S|1|A
113NR_3.0_47162.1
Exact match
3PDR|1|X (3PDR)
  • M-Box RNA, ykoK riboswitch aptamer, M-bo[...]
  • X-ray diffraction
  • Release Date: 2011-02-23
  • Standardized name: M-box riboswitch (ykoK leader)
  • Source: Bacteria
  • Rfam: RF00380
1.9 Å153(3) 3PDR|1|X, 3PDR|1|A, 2QBZ|1|X
114NR_3.0_85253.1
Exact match
Sulfoacidibacillus thermotolerans
8DZJ|1|E (8DZJ)
  • sgRNA
  • Electron microscopy
  • Release Date: 2023-07-12
2.9 Å153(1) 8DZJ|1|E
115NR_3.0_01258.2
Exact match
Leishmania donovani
6AZ3|1|4 (6AZ3)
  • 26S delta ribosomal RNA, srRNA2, rRNA de[...]
  • Electron microscopy
  • Release Date: 2017-12-06
  • Standardized name: LSU rRNA
  • Source: Eukarya
  • Rfam: RF02543
2.5 Å149(3) 6AZ3|1|4, 5T2A|1|G, 3JCS|1|4
116NR_3.0_73426.6
Exact match
Homo sapiens
7EVO|1|H (7EVO)
  • U2 snRNA, BPS oligo, pre-mRNA
  • Electron microscopy
  • Release Date: 2022-08-03
  • Standardized name: U2 snRNA
  • Source: Eukarya
  • Rfam: RF00004
2.5 Å148(6) 7EVO|1|H, 8HK1|1|H, 7Q4O|1|2+7Q4O|1|h, 7Q4P|1|2, 7Q3L|1|2, 7VPX|1|H
117NR_3.0_26892.1
Exact match
Trypanosoma cruzi
5T5H|1|E (5T5H)
  • srRNA1
  • Electron microscopy
  • Release Date: 2016-10-12
2.5 Å146(1) 5T5H|1|E
118NR_3.0_08692.3
Exact match
3G9C|1|Q (3G9C)
  • GlmS ribozyme, substrate strand RNA 13-m[...]
  • X-ray diffraction
  • Release Date: 2009-11-03
2.9 Å140(16) 3G9C|1|Q, 2NZ4|1|Q, 3G9C|1|R, 2NZ4|1|R, 3G9C|1|S, 2NZ4|1|P, 2NZ4|1|S, 3G9C|1|P, 3L3C|1|Q, 3L3C|1|R, 3L3C|1|P, 3L3C|1|S, 3G8T|1|R, 3G8T|1|Q, 3G8T|1|P, 3G8T|1|S
119NR_3.0_17578.2
Exact match
Homo sapiens
8C6J|1|2+8C6J|1|6 (8C6J)
  • U2snRNA, U6snRNA, pre-mRNA, U2 snRNA, U6[...]
  • Electron microscopy
  • Release Date: 2023-07-12
  • Standardized name: U2 snRNA + U6 snRNA
  • Source: Eukarya
  • Rfam: RF00004 + RF00026
2.8 Å140(2) 8C6J|1|2+8C6J|1|6, 6ICZ|1|H+6ICZ|1|F
120NR_3.0_43040.2
Exact match
Polytomella magna
8A22|1|A5+8A22|1|A4 (8A22)
  • mtLSU-5, mtLSU-4
  • Electron microscopy
  • Release Date: 2022-11-16
2.9 Å136(1) 8A22|1|A5+8A22|1|A4
121NR_3.0_66484.2
Exact match
3HHN|1|E (3HHN)
  • Class I ligase ribozyme, self-ligation p[...]
  • X-ray diffraction
  • Release Date: 2009-11-24
3.0 Å136(2) 3HHN|1|E, 3HHN|1|C
122NR_3.0_81267.1
Exact match
Homo sapiens
6ID1|1|H+6ID1|1|F (6ID1)
  • U2snRNA, U6snRNA, pre-mRNA
  • Electron microscopy
  • Release Date: 2019-03-13
  • Standardized name: U2 snRNA + U6 snRNA
  • Source: Eukarya
  • Rfam: RF00004 + RF00026
2.9 Å136(1) 6ID1|1|H+6ID1|1|F
123NR_3.0_82191.1
Exact match
Homo sapiens
8SP9|1|C (8SP9)
  • tRNA scaffold,CVB3 Cloverleaf RNA
  • X-ray diffraction
  • Release Date: 2023-08-09
2.9 Å136(1) 8SP9|1|C
124NR_3.0_16564.1
Exact match
synthetic construct
7WJU|1|C (7WJU)
  • sgRNAv1
  • Electron microscopy
  • Release Date: 2023-01-18
2.7 Å133(1) 7WJU|1|C
125NR_3.0_01253.1
Exact match
Burkholderia sp. TJI49
7MLW|1|F (7MLW)
  • Guanidine-I riboswitch
  • X-ray diffraction
  • Release Date: 2022-01-12
  • Standardized name: Guanidine-I riboswitch
  • Source: Bacteria
  • Rfam: RF00442
2.7 Å126(1) 7MLW|1|F
126NR_3.0_47433.1
Exact match
Caldanaerobacter subterraneus
3V7E|1|C (3V7E)
  • SAM-I riboswitch aptamer with an enginee[...]
  • X-ray diffraction
  • Release Date: 2012-03-07
  • Standardized name: SAM-I riboswitch
  • Source: Bacteria
  • Rfam: RF00162
2.8 Å126(2) 3V7E|1|C, 3V7E|1|D
127NR_3.0_26197.1
Exact match
Thermococcus kodakarensis
6SKG|1|BB (6SKG)
  • 5S rRNA, 5S ribosomal RNA
  • Electron microscopy
  • Release Date: 2020-07-29
  • Standardized name: 5S rRNA
  • Source: Archaea
  • Rfam: RF00001
2.7 Å125(3) 6SKG|1|BB, 6TH6|1|BB, 6SKF|1|BB
128NR_3.0_67328.2
Exact match
Homo sapiens
6QW6|1|4 (6QW6)
  • U4 snRNA, U6 snRNA
  • Electron microscopy
  • Release Date: 2019-04-17
  • Standardized name: U4 snRNA
  • Source: Eukarya
  • Rfam: RF00015
2.9 Å125(1) 6QW6|1|4
129NR_3.0_70955.1
Exact match
1L9A|1|B (1L9A)
  • signal recognition particle RNA S domain
  • X-ray diffraction
  • Release Date: 2002-06-28
2.9 Å125(1) 1L9A|1|B
130NR_3.0_94866.2
Exact match
Homo sapiens
6N5P|1|A (6N5P)
  • RNA (125-MER), RNA (126-MER), RNA (127-M[...]
  • X-ray diffraction
  • Release Date: 2019-11-27
  • Standardized name: cyclic di-AMP riboswitch
  • Source: Eukarya
  • Rfam: RF00379
3.0 Å124(7) 6N5P|1|A, 6N5Q|1|A, 6N5T|1|A, 6N5N|1|A, 6N5S|1|A, 6N5O|1|A, 6WTL|1|A
131NR_3.0_17405.9
Exact match
Deinococcus radiodurans
5DM6|1|Y (5DM6)
  • ribosomal 5S RNA, 5S ribosomal RNA
  • X-ray diffraction
  • Release Date: 2015-11-11
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.9 Å122(3) 5DM6|1|Y, 5DM7|1|Y, 2ZJR|1|Y
132NR_3.0_25303.2
Exact match
Haloarcula marismortui
4V9F|1|9 (4V9F)
  • 5S RRNA, 5S ribosomal RNA
  • X-ray diffraction
  • Release Date: 2014-07-09
  • Standardized name: 5S rRNA
  • Source: Archaea
  • Rfam: RF00001
2.4 Å122(54) 4V9F|1|9, 1S72|1|9, 1YI2|1|9, 1JJ2|1|9, 3CCL|1|9, 3CCU|1|9, 1YIJ|1|9, 3G71|1|9, 1YHQ|1|9, 3CMA|1|9, 3G6E|1|9, 3I56|1|9, 3CCV|1|9, 3CD6|1|9, 2QEX|1|9, 3CCM|1|9, 1YJ9|1|9, 3CC4|1|9, 1YJN|1|9, 2OTL|1|9, 1YIT|1|9, 3CC2|1|9, 3CCS|1|9, 2OTJ|1|9, 3CCQ|1|9, 3CC7|1|9, 3CCR|1|9, 2QA4|1|9, 3CCE|1|9, 3OW2|1|9, 1VQ8|1|9, 1VQO|1|9, 1VQK|1|9, 1VQ9|1|9, 1VQP|1|9, 1VQ7|1|9, 1VQN|1|9, 1VQ4|1|9, 1VQ6|1|9, 3CME|1|9, 1M90|1|B, 1QVG|1|9, 1VQ5|1|9, 1NJI|1|B, 3CXC|1|9, 3CPW|1|9, 1Q81|1|B, 1Q86|1|B, 1Q82|1|B, 1K9M|1|B, 1KD1|1|B, 1K8A|1|B, 1FFK|1|9, 1N8R|1|B
133NR_3.0_35133.5
Exact match
2Z75|1|B (2Z75)
  • glmS ribozyme RNA, glmS ribozyme amino R[...]
  • X-ray diffraction
  • Release Date: 2007-09-04
  • Standardized name: glmS ribozyme
  • Source: Bacteria
  • Rfam: RF00234
1.7 Å122(12) 2Z75|1|B, 2GCV|1|B, 2Z74|1|B, 2H0X|1|B, 2H0W|1|B, 2GCS|1|B, 3B4B|1|B, 2HO6|1|B, 2HO7|1|B, 3B4A|1|B, 3B4C|1|B, 2H0S|1|B
134NR_3.0_69729.1
Exact match
Sulfolobus acidocaldarius DSM 639
8HKU|1|A5S (8HKU)
  • 5s rRNA (122-MER)
  • Electron microscopy
  • Release Date: 2023-08-16
  • Standardized name: 5S rRNA
  • Source: Archaea
  • Rfam: RF00001
2.7 Å122(1) 8HKU|1|A5S
135NR_3.0_18586.58
Updated, 1 parent
Saccharomyces cerevisiae
5TBW|1|AS (5TBW)
  • 5.8s rRNA, 5S ribosomal RNA, 5S rRNA, 5S[...]
  • X-ray diffraction
  • Release Date: 2017-07-26
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
3.0 Å121(50) 5TBW|1|AS, 5TBW|1|3, 4V88|1|A3, 4V88|1|A7, 7OSA|1|AB, 7OSM|1|AB, 8EVT|1|A3, 7UOO|1|3, 8EVP|1|A3, 7V08|1|3, 7ZW0|1|LC, 8AGX|1|h, 7TOP|1|A5S, 8EWC|1|A3, 7UQB|1|3, 7UQZ|1|3, 7ZUX|1|4, 8AAF|1|h, 8EUB|1|A3, 6T4Q|1|C4, 8AGW|1|h, 8AGT|1|h, 8AGV|1|h, 8AGZ|1|h, 8EVS|1|A3, 8HFR|1|2f, 8AGU|1|h, 8EVQ|1|A3, 7TOO|1|A5S, 7MPJ|1|A3, 6TB3|1|BR, 6SNT|1|4, 8EWB|1|A3, 8EVR|1|A3, 7AZY|1|F, 4U4R|1|3, 4U3U|1|7, 6WOO|1|7, 7UG6|1|3, 4U4R|1|7, 4U3U|1|3, 4U4Q|1|7, 4U4Q|1|3, 4U3M|1|7, 4U52|1|7, 4U3M|1|3, 4U4U|1|7, 6YLG|1|3, 4U52|1|3, 4U4U|1|3
136NR_3.0_83277.1
Exact match
Candida albicans SC5314
7PZY|1|3 (7PZY)
  • 5S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-05-18
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.3 Å121(5) 7PZY|1|3, 7Q08|1|3, 7Q0F|1|3, 7Q0R|1|3, 7Q0P|1|3
137NR_3.0_10255.33
Updated, 1 parent
Oryctolagus cuniculus
7O7Y|1|B7 (7O7Y)
  • 5S rRNA, 5S ribosomal RNA, 5S
  • Electron microscopy
  • Release Date: 2021-06-02
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.2 Å120(16) 7O7Y|1|B7, 7OYD|1|K, 7O7Z|1|B7, 8B6C|1|7, 7UCK|1|7, 8BPO|1|B1, 7OBR|1|7, 7QWQ|1|7, 7ZJW|1|L7, 8B5L|1|7, 6SGC|1|74, 7QWR|1|7, 8P2K|1|B7, 7O80|1|B7, 7TOR|1|A5S, 6R5Q|1|7
138NR_3.0_11525.1
Exact match
Neurospora crassa
7R81|1|B1 (7R81)
  • 5S rRNA
  • Electron microscopy
  • Release Date: 2021-12-01
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.7 Å120(1) 7R81|1|B1
139NR_3.0_21609.1
Exact match
Mus musculus
7CPU|1|L7 (7CPU)
  • Mus musculus 5S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-02-02
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.8 Å120(1) 7CPU|1|L7
140NR_3.0_42467.1
Exact match
Drosophila melanogaster
6XU8|1|A7 (6XU8)
  • 5S ribosomal RNA
  • Electron microscopy
  • Release Date: 2021-07-28
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
3.0 Å120(1) 6XU8|1|A7
141NR_3.0_42622.67
Exact match
Thermus thermophilus
7RQB|1|1B (7RQB)
  • 5S Ribosomal RNA, 5S rRNA
  • X-ray diffraction
  • Release Date: 2022-01-26
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.5 Å120(182) 7RQB|1|1B, 8FC6|1|1B, 8FC3|1|1B, 5FDV|1|1B, 8FC5|1|1B, 5FDU|1|1B, 8FC2|1|1B, 8FC5|1|2B, 4Y4O|1|1B, 8FC1|1|1B, 7U2J|1|1B, 4Y4O|1|2B, 5IBB|1|16, 5HCQ|1|1B, 8FC6|1|2B, 8FC2|1|2B, 7RQB|1|2B, 4WPO|1|AB, 8EKB|1|1B, 5E81|1|16, 8T8B|1|1B, 6CFL|1|1B, 6CAE|1|1B, 7RQE|1|1B, 7U2H|1|1B, 5FDV|1|2B, 5IB7|1|16, 4V8I|1|BB, 5FDU|1|2B, 5IBB|1|1J, 8FC3|1|2B, 8T8C|1|1B, 6XHX|1|1B, 8FC4|1|1B, 7RQ8|1|1B, 8EV7|1|1B, 5W4K|1|1B, 5E81|1|1J, 6CFK|1|1B, 4WQU|1|AB, 6XHY|1|1B, 5NDK|1|16, 4WSD|1|16, 5HCR|1|1B, 7RQC|1|1B, 7U2J|1|2B, 5NDK|1|1J, 6OF1|1|1B, 6XHX|1|2B, 5J4B|1|1B, 4LNT|1|YB, 6CFJ|1|1B, 4WQF|1|AB, 5IB7|1|1J, 8EKB|1|2B, 4V8D|1|BB, 8CVK|1|1B, 4V8G|1|BB, 6XHY|1|2B, 4W2G|1|BB, 6XHW|1|1B, 5J4C|1|1B, 4Z8C|1|1B, 5J4B|1|2B, 6CFL|1|2B, 8EV6|1|1B, 7U2I|1|1B, 4V9R|1|BB, 7RQE|1|2B, 5HD1|1|1B, 7MD7|1|1B, 5HCP|1|1B, 4V9H|1|BB, 6ND5|1|1B, 6XHV|1|1B, 8T8B|1|2B, 4W2I|1|BB, 7RQD|1|1B, 4V8D|1|DB, 5WIS|1|1B, 4Z3S|1|1B, 4WQY|1|AB, 6CAE|1|2B, 4Z8C|1|2B, 4LNT|1|RB, 1VY4|1|BB, 5HAU|1|1B, 4WPO|1|CB, 7RQC|1|2B, 8CVJ|1|1B, 4V8B|1|BB, 5J8B|1|B, 4W2H|1|BB, 6O97|1|1B, 4WSD|1|1J, 7U2H|1|2B, 6XQD|1|1B, 6CFK|1|2B, 8CVL|1|1B, 5J4C|1|2B, 8EV7|1|2B, 8FC4|1|2B, 5HAU|1|2B, 5HCQ|1|2B, 8FC1|1|2B, 7RQA|1|1B, 6OF1|1|2B, 6XHV|1|2B, 8CVK|1|2B, 1VY7|1|BB, 8T8C|1|2B, 4W2F|1|BB, 5WIT|1|1B, 6CFJ|1|2B, 7RQD|1|2B, 5W4K|1|2B, 6XHW|1|2B, 1VY5|1|BB, 7RQ9|1|1B, 8EV6|1|2B, 4W2I|1|DB, 4Y4P|1|1B, 5DOY|1|1B, 7U2I|1|2B, 4V8G|1|DB, 4W2G|1|DB, 7RQ8|1|2B, 4WQF|1|CB, 7MD7|1|2B, 5HCR|1|2B, 4Z3S|1|2B, 4V9R|1|DB, 7JQL|1|1B, 6ND5|1|2B, 8CVJ|1|2B, 7RQA|1|2B, 6O97|1|2B, 7RQ9|1|2B, 5HD1|1|2B, 6ND6|1|1B, 8CVL|1|2B, 6UO1|1|1B, 4W2F|1|DB, 1VY6|1|BB, 5WIS|1|2B, 4WQU|1|CB, 1VY4|1|DB, 4WQY|1|CB, 6XQD|1|2B, 4V8B|1|DB, 5F8K|1|1B, 5DOY|1|2B, 4V90|1|BB, 5HCP|1|2B, 4Y4P|1|2B, 4W2H|1|DB, 6UO1|1|2B, 4V51|1|BB, 6XQE|1|1B, 1VY5|1|DB, 4W2E|1|B, 6ND6|1|2B, 7JQL|1|2B, 4V51|1|DB, 5WIT|1|2B, 4V8I|1|DB, 4V7L|1|BB, 1VY6|1|DB, 6XQE|1|2B, 1VY7|1|DB, 4V7L|1|DB, 5F8K|1|2B, 4V7Y|1|BB, 4V67|1|BB, 4V7X|1|BB, 4V7W|1|BB, 4V7Y|1|DB, 4V67|1|DB, 4V7W|1|DB, 4V7X|1|DB, 6GSJ|1|16, 6GSJ|1|1J
142NR_3.0_43536.1
Exact match
Danio rerio
7OYB|1|71 (7OYB)
  • 5S rRNA
  • Electron microscopy
  • Release Date: 2022-07-13
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.4 Å120(1) 7OYB|1|71
143NR_3.0_43871.1
Exact match
Cutibacterium acnes
8CVM|1|b (8CVM)
  • 5S ribosomal RNA
  • Electron microscopy
  • Release Date: 2023-03-15
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.7 Å120(2) 8CVM|1|b, 8CRX|1|b
144NR_3.0_52752.19
Exact match
Homo sapiens
8GLP|1|L7 (8GLP)
  • 5S rRNA (120-MER), 5S rRNA, 5S ribosomal[...]
  • Electron microscopy
  • Release Date: 2023-04-19
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
1.7 Å120(38) 8GLP|1|L7, 8A3D|1|B, 7OW7|1|B, 8G5Y|1|L7, 7XNY|1|L2, 8G60|1|L7, 8FL7|1|L4, 8FLE|1|L4, 8FLB|1|L4, 6ZMI|1|L7, 8G5Z|1|L7, 8FL6|1|L4, 8FLA|1|L4, 8FLD|1|L4, 6ZM7|1|L7, 7XNX|1|L2, 8FL3|1|L4, 7F5S|1|L7, 8FLF|1|L4, 8FL9|1|L4, 8G6J|1|L7, 6XA1|1|L7, 8IDT|1|5, 8FLC|1|L4, 6Y6X|1|L7, 8FL2|1|L4, 6Z6N|1|L7, 6QZP|1|L7, 8FL0|1|L4, 8G61|1|L7, 6Z6L|1|L7, 6ZME|1|L7, 7QVP|1|L7, 7QVP|1|L9, 8IDY|1|5, 8INF|1|5, 8FL4|1|L4, 6Y2L|1|L7
145NR_3.0_75628.3
Exact match
Solanum lycopersicum
8AZW|1|C (8AZW)
  • 5S rRNA
  • Electron microscopy
  • Release Date: 2023-06-07
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.1 Å120(4) 8AZW|1|C, 8B2L|1|C3, 7QIW|1|5, 7QIZ|1|5
146NR_3.0_90150.1
Exact match
Trypanosoma cruzi
5T5H|1|G (5T5H)
  • srRNA2
  • Electron microscopy
  • Release Date: 2016-10-12
2.5 Å120(1) 5T5H|1|G
147NR_3.0_10157.120
Exact match
Escherichia coli
5J7L|1|DB (5J7L)
  • 5S rRNA, 5S ribosomal RNA, Ribosomal RNA[...]
  • X-ray diffraction
  • Release Date: 2016-07-27
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
3.0 Å119(161) 5J7L|1|DB, 4YBB|1|DB, 6I7V|1|DB, 4WOI|1|BB, 5J91|1|DB, 4U27|1|BB, 4WOI|1|CB, 4V9D|1|CB, 4V9P|1|CB, 4V9P|1|EB, 4U24|1|BB, 4V9O|1|AB, 4U26|1|BB, 4V9P|1|GB, 4V9O|1|CB, 4U25|1|BB, 4V9O|1|EB, 4V9P|1|AB, 4U1U|1|BB, 4U20|1|BB, 4U1V|1|BB, 5J7L|1|CB, 4V9D|1|DB, 6I7V|1|CB, 4V9O|1|GB, 4U27|1|DB, 4U25|1|DB, 4U1V|1|DB, 4YBB|1|CB, 4U26|1|DB, 4U1U|1|DB, 4U20|1|DB, 4U24|1|DB, 5J91|1|CB, 5J5B|1|DB, 5J5B|1|CB, 8B0X|1|b, 8CEU|1|b, 8FTO|1|b, 8AYE|1|b, 7K00|1|b, 8CGD|1|b, 8BIL|1|1, 8G6W|1|b, 8BIM|1|1, 8E30|1|J, 8G6Y|1|b, 8E3O|1|J, 8EMM|1|b, 8ANA|1|b, 8BGE|1|1, 8E49|1|J, 6XZ7|1|B, 7QQ3|1|J, 8E43|1|J, 8BHL|1|1, 8E41|1|J, 7ZP8|1|a, 8EIU|1|b, 8E33|1|J, 7LVK|1|J, 6PJ6|1|J, 8BF7|1|1, 7N1P|1|5, 8AKN|1|b, 8G6X|1|b, 7PJS|1|B, 7Z20|1|a, 8BHP|1|1, 7O1A|1|BB, 8E3M|1|J, 8E45|1|J, 7S1H|1|J, 8E32|1|J, 8E46|1|J, 8E3L|1|J, 8E48|1|J, 8E42|1|J, 8E35|1|J, 7S1K|1|J, 7BL4|1|B, 8E47|1|J, 7N2U|1|5, 7S1J|1|J, 7N2V|1|5, 7S1G|1|J, 7S1I|1|J, 7SA4|1|4, 8E36|1|J, 7UG7|1|5, 7YLA|1|J, 6XZB|1|B2, 6YSS|1|B, 6PC6|1|J, 8BH4|1|1, 8E44|1|J, 7ZOD|1|a, 6PCR|1|J, 6PC7|1|J, 6YS3|1|a, 7O1C|1|BB, 7N30|1|5, 7NWT|1|3, 7N31|1|5, 7ZTA|1|05S1, 6TBV|1|05S1, 6TC3|1|05S1, 8EKC|1|B, 6XZA|1|B2, 7N2C|1|5, 6PCQ|1|J, 7ZQ5|1|a, 6PC5|1|J, 7M5D|1|3, 8BHJ|1|1, 7ZQ6|1|a, 8AM9|1|b, 8BGH|1|1, 6QDW|1|a, 7NSO|1|B, 7ST2|1|2, 5AFI|1|B, 7OT5|1|3, 8SYL|1|B, 7B5K|1|B, 7OTC|1|B, 6Y69|1|B, 8BHN|1|1, 7O19|1|BB, 6ORE|1|3, 7P3K|1|b, 7OIZ|1|b, 6PCT|1|J, 6WYV|1|J, 7TOS|1|5S, 6U48|1|CB, 5NWY|1|O, 5MDV|1|3, 6ZU1|1|BB, 6ZTO|1|BB, 6ZTP|1|BB, 7OII|1|3, 7OIF|1|3, 7ST6|1|2, 6WDE|1|2, 6PCS|1|J, 6WD0|1|2, 6HRM|1|3, 8AP4|1|b, 6PC8|1|J, 6H4N|1|B, 7Q4K|1|BB, 8B7Y|1|J, 6QUL|1|B, 6PCH|1|J, 5WFS|1|B, 5WDT|1|B, 5IQR|1|3, 8CGV|1|b, 8CGK|1|b, 8CAM|1|b
148NR_3.0_15429.1
Exact match
Chaetomium thermophilum var. thermophilum DSM 1495
7OLC|1|3 (7OLC)
  • 5S rRNA
  • Electron microscopy
  • Release Date: 2022-01-26
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.9 Å119(2) 7OLC|1|3, 7OLD|1|3
149NR_3.0_25416.1
New id, 1 parent
Spraguea lophii 42_110
7QCA|1|L70 (7QCA)
  • RNA 5S
  • Electron microscopy
  • Release Date: 2022-11-30
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.8 Å119(1) 7QCA|1|L70
150NR_3.0_49345.1
Exact match
Xenopus laevis
7OYC|1|71 (7OYC)
  • 5S rRNA
  • Electron microscopy
  • Release Date: 2022-07-20
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.4 Å119(1) 7OYC|1|71
151NR_3.0_51489.1
Exact match
Paranosema locustae
6ZU5|1|L70 (6ZU5)
  • 5S rRNA
  • Electron microscopy
  • Release Date: 2020-11-04
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.9 Å119(1) 6ZU5|1|L70
152NR_3.0_55569.1
Exact match
Rattus norvegicus
7QGG|1|E (7QGG)
  • RNA (121-MER)
  • Electron microscopy
  • Release Date: 2022-10-26
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.9 Å119(1) 7QGG|1|E
153NR_3.0_69984.2
Exact match
Leishmania donovani
6AZ3|1|8 (6AZ3)
  • 5S ribosomal RNA, 5S rRNA, rRNA 5S
  • Electron microscopy
  • Release Date: 2017-12-06
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.5 Å119(3) 6AZ3|1|8, 5T2A|1|D, 3JCS|1|8
154NR_3.0_96182.1
Exact match
Encephalitozoon cuniculi GB-M1
7QEP|1|2 (7QEP)
  • 5S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-02-09
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.7 Å119(1) 7QEP|1|2
155NR_3.0_07539.1
Exact match
Schizosaccharomyces pombe
8EUG|1|9 (8EUG)
  • RNA (118-MER)
  • Electron microscopy
  • Release Date: 2022-11-30
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.8 Å118(1) 8EUG|1|9
156NR_3.0_50314.5
Exact match
Spinacia oleracea
6ERI|1|Ax (6ERI)
  • 5S ribosomal RNA
  • Electron microscopy
  • Release Date: 2018-04-18
  • Standardized name: 5S rRNA
  • Source: Chloroplast
  • Rfam: RF00001
3.0 Å118(1) 6ERI|1|Ax
157NR_3.0_38966.3
Exact match
synthetic construct
6KC8|1|B (6KC8)
  • sgRNA
  • X-ray diffraction
  • Release Date: 2019-11-06
2.9 Å117(3) 6KC8|1|B, 6JE3|1|B, 6JDQ|1|B
158NR_3.0_64727.1
Exact match
Pseudomonas aeruginosa
7UNW|1|B (7UNW)
  • 5S rRNA, 5S Ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-06-22
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.6 Å117(6) 7UNW|1|B, 7UNV|1|B, 6SPB|1|B, 7UNU|1|B, 7UNR|1|B, 6SPF|1|B
159NR_3.0_67629.1
Exact match
Giardia lamblia ATCC 50803
7PWO|1|3 (7PWO)
  • rRNA 5S
  • Electron microscopy
  • Release Date: 2022-04-20
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.8 Å117(2) 7PWO|1|3, 7PWG|1|3
160NR_3.0_12971.6
Exact match
Enterococcus faecalis
7P7Q|1|B (7P7Q)
  • 5S rRNA
  • Electron microscopy
  • Release Date: 2022-02-23
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.4 Å116(7) 7P7Q|1|B, 6W6P|1|B, 7P7T|1|B, 7NHK|1|B, 7P7R|1|B, 7P7S|1|B, 6WU9|1|B
161NR_3.0_79594.1
Exact match
uncultured archaeon
7C7L|1|C (7C7L)
  • sgRNA
  • Electron microscopy
  • Release Date: 2020-12-23
3.0 Å116(1) 7C7L|1|C
162NR_3.0_26536.2
Exact match
Mycobacterium tuberculosis
7SFR|1|B (7SFR)
  • 5S rRNA
  • Electron microscopy
  • Release Date: 2022-10-12
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.6 Å115(1) 7SFR|1|B
163NR_3.0_41742.5
Exact match
Mycobacterium tuberculosis H37Rv
8FR8|1|B (8FR8)
  • 5S rRNA, 5S rRNA (118-MER)
  • Electron microscopy
  • Release Date: 2023-05-17
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.8 Å115(7) 8FR8|1|B, 7KGB|1|B, 7MT7|1|B, 7MT2|1|B, 7MSM|1|B, 7MT3|1|B, 7MSC|1|B
164NR_3.0_51824.1
Exact match
RNA transcription vector pBRDI1
5WTI|1|B (5WTI)
  • RNA (123-MER)
  • X-ray diffraction
  • Release Date: 2017-11-01
2.7 Å115(1) 5WTI|1|B
165NR_3.0_67384.3
Exact match
Acinetobacter baumannii
7UW1|1|B (7UW1)
  • 5s ribosomal RNA
  • Electron microscopy
  • Release Date: 2023-04-19
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.2 Å115(19) 7UW1|1|B, 7UVZ|1|B, 7UVX|1|B, 7UVW|1|B, 7RYG|1|B, 7UVY|1|B, 7RYH|1|B, 6YSI|1|5, 7UVV|1|B, 7M4Y|1|B, 7M4W|1|B, 7RYF|1|B, 7M4X|1|B, 6YHS|1|5, 7M4V|1|B, 7M4Z|1|B, 6V3A|1|B, 6V3B|1|B, 6V3D|1|B
166NR_3.0_83891.20
Exact match
Staphylococcus aureus
6S0Z|1|B (6S0Z)
  • 5S Ribosomal RNA, 5S rRNA, 5S
  • Electron microscopy
  • Release Date: 2019-08-21
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.3 Å115(8) 6S0Z|1|B, 6S0X|1|B, 6HMA|1|B, 7ASM|1|B, 7ASP|1|3, 5NGM|1|AB, 7P48|1|B, 7ASN|1|B
167NR_3.0_84439.1
Exact match
Planctomycetes bacterium
7WAY|1|D (7WAY)
  • RNA
  • Electron microscopy
  • Release Date: 2022-03-16
2.9 Å115(1) 7WAY|1|D
168NR_3.0_16357.1
Exact match
Listeria monocytogenes EGD-e
8A57|1|B (8A57)
  • 5S rRNA, 5S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-11-02
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.3 Å114(3) 8A57|1|B, 8A5I|1|B, 7NHN|1|B
169NR_3.0_54575.1
Exact match
Trypanosoma cruzi
5T5H|1|D (5T5H)
  • 5S rRNA
  • Electron microscopy
  • Release Date: 2016-10-12
  • Standardized name: 5S rRNA
  • Source: Eukarya
  • Rfam: RF00001
2.5 Å114(1) 5T5H|1|D
170NR_3.0_97435.12
Exact match
Bacillus subtilis subsp. subtilis str. 168
8BUU|1|B (8BUU)
  • 5S ribosomal RNA, 5s rRNA
  • Electron microscopy
  • Release Date: 2023-04-05
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.9 Å112(3) 8BUU|1|B, 7AQC|1|B, 7AS8|1|B
171NR_3.0_27790.1
Exact match
Deinococcus radiodurans R1
8BF8|1|B (8BF8)
  • Deinococcus radiodurans R1 chromosome 1,[...]
  • Electron microscopy
  • Release Date: 2023-04-12
2.8 Å111(2) 8BF8|1|B, 8EX9|1|B
172NR_3.0_51377.2
Exact match
Staphylococcus aureus
7TTW|1|2 (7TTW)
  • 5S rRNA
  • Electron microscopy
  • Release Date: 2022-07-06
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.9 Å111(3) 7TTW|1|2, 6WQN|1|2, 7TTU|1|2
173NR_3.0_80225.1
Exact match
Human mastadenovirus C
6OL3|1|C (6OL3)
  • Adenovirus Virus-Associated (VA) RNA I a[...]
  • X-ray diffraction
  • Release Date: 2019-07-03
  • Standardized name: VA RNA
  • Source: Viruses
  • Rfam: RF00102
2.7 Å111(1) 6OL3|1|C
174NR_3.0_54615.1
Exact match
Flavobacterium johnsoniae
7JIL|1|3 (7JIL)
  • RNA (111-MER)
  • Electron microscopy
  • Release Date: 2020-12-02
  • Standardized name: 5S rRNA
  • Source: Bacteria
  • Rfam: RF00001
2.8 Å110(1) 7JIL|1|3
175NR_3.0_38557.2
Exact match
Polytomella magna
8A22|1|A1 (8A22)
  • mtLSU-1
  • Electron microscopy
  • Release Date: 2022-11-16
2.9 Å109(1) 8A22|1|A1
176NR_3.0_40570.1
Exact match
Thermoanaerobacter mathranii
6CK5|1|A (6CK5)
  • PRPP riboswitch
  • X-ray diffraction
  • Release Date: 2018-06-20
  • Standardized name: Guanidine-I riboswitch
  • Source: Bacteria
  • Rfam: RF00442
2.5 Å108(2) 6CK5|1|A, 6CK5|1|B
177NR_3.0_53735.1
Exact match
Caldanaerobacter subterraneus
4QLM|1|A (4QLM)
  • RNA (108-MER), RNA (117-MER)
  • X-ray diffraction
  • Release Date: 2014-08-13
  • Standardized name: cyclic di-AMP riboswitch
  • Source: Bacteria
  • Rfam: RF00379
2.7 Å108(2) 4QLM|1|A, 4QLN|1|A
178NR_3.0_47203.2
Exact match
6WJR|1|X (6WJR)
  • FMN riboswitch, RNA (112-MER)
  • X-ray diffraction
  • Release Date: 2020-09-02
  • Standardized name: FMN riboswitch (RFN element)
  • Source: Bacteria
  • Rfam: RF00050
2.7 Å107(3) 6WJR|1|X, 3F2Q|1|X, 3F2T|1|X
179NR_3.0_05530.5
Exact match
Spinacia oleracea
6ERI|1|AB (6ERI)
  • 4.5S ribosomal RNA
  • Electron microscopy
  • Release Date: 2018-04-18
3.0 Å106(1) 6ERI|1|AB
180NR_3.0_27096.1
Exact match
Bacillus subtilis
4WFL|1|A (4WFL)
  • RNA
  • X-ray diffraction
  • Release Date: 2014-10-15
  • Standardized name: LSRP RNA
  • Source: Bacteria
  • Rfam: RF01854
2.5 Å105(1) 4WFL|1|A
181NR_3.0_98802.1
Exact match
Syntrophothermus lipocalidus
6DLR|1|A (6DLR)
  • PRPP Riboswitch
  • X-ray diffraction
  • Release Date: 2018-11-14
  • Standardized name: Guanidine-I riboswitch
  • Source: Bacteria
  • Rfam: RF00442
2.7 Å105(5) 6DLR|1|A, 6DLT|1|A, 6DLS|1|A, 6DLQ|1|A, 6DNR|1|A
182NR_3.0_18848.1
Exact match
Lactococcus lactis
6CB3|1|B (6CB3)
  • Lactococcus lactis yybP-ykoY riboswitch,[...]
  • X-ray diffraction
  • Release Date: 2018-06-13
1.9 Å100(10) 6CB3|1|B, 6CB3|1|A, 4Y1J|1|A, 4Y1J|1|B, 6CC3|1|A, 4Y1I|1|A, 4Y1I|1|B, 6CC3|1|B, 6CC1|1|B, 6CC1|1|A
183NR_3.0_20814.1
Exact match
[Eubacterium] siraeum
3SUX|1|X (3SUX)
  • Riboswitch
  • X-ray diffraction
  • Release Date: 2011-09-14
  • Standardized name: THF riboswitch
  • Source: Bacteria
  • Rfam: RF01831
2.9 Å100(2) 3SUX|1|X, 3SUH|1|X
184NR_3.0_86427.1
Exact match
Sulfobacillus acidophilus
6DME|1|A (6DME)
  • ppGpp Riboswitch
  • X-ray diffraction
  • Release Date: 2018-11-14
2.7 Å100(5) 6DME|1|A, 6DMC|1|B, 6DMC|1|A, 6DMD|1|A, 6DMD|1|B
185NR_3.0_50424.1
Exact match
Alicyclobacillus acidoterrestris
5U30|1|B (5U30)
  • sgRNA
  • X-ray diffraction
  • Release Date: 2017-01-25
2.9 Å99(2) 5U30|1|B, 5U31|1|B
186NR_3.0_03365.1
Exact match
Nocardia farcinica
6UFM|1|B (6UFM)
  • RNA (98-MER)
  • X-ray diffraction
  • Release Date: 2019-12-04
2.8 Å98(1) 6UFM|1|B
187NR_3.0_63567.1
Exact match
Faecalibacterium prausnitzii
6XKO|1|A (6XKO)
  • PreQ1-III Riboswitch (Class 3), Class II[...]
  • X-ray diffraction
  • Release Date: 2021-12-29
  • Standardized name: PreQ1-III riboswitch
  • Source: Bacteria
  • Rfam: RF02680
2.8 Å98(3) 6XKO|1|A, 6XKN|1|A, 4RZD|1|A
188NR_3.0_70719.1
Exact match
Xanthomonas oryzae
6N2V|1|A (6N2V)
  • X. oryzae Mn riboswitch optimized constr[...]
  • X-ray diffraction
  • Release Date: 2019-10-02
2.9 Å98(2) 6N2V|1|A, 6N2V|1|B
189NR_3.0_08831.2
Exact match
Methanocaldococcus jannaschii
3NDB|1|M (3NDB)
  • 7S.S SRP RNA, RNA (101-MER), 7S RNA, SRP[...]
  • X-ray diffraction
  • Release Date: 2011-02-23
  • Standardized name: SRP RNA
  • Source: Archaea
  • Rfam: RF01857
3.0 Å97(7) 3NDB|1|M, 4XCO|1|M, 4XCO|1|E, 1Z43|1|A, 2V3C|1|N, 2V3C|1|M, 1LNG|1|B
190NR_3.0_33394.4
Exact match
5B2T|1|A (5B2T)
  • RNA (97-MER), Guide RNA, RNA (81-MER)
  • X-ray diffraction
  • Release Date: 2016-03-23
2.2 Å97(6) 5B2T|1|A, 5B2R|1|A, 5B2S|1|A, 4OO8|1|B, 4OO8|1|E, 6AI6|1|B
191NR_3.0_57834.3
Exact match
Homo sapiens
6ID0|1|F+6ID0|1|H (6ID0)
  • U6snRNA, U2snRNA, pre-mRNA
  • Electron microscopy
  • Release Date: 2019-03-13
  • Standardized name: U6 snRNA + U2 snRNA
  • Source: Eukarya
  • Rfam: RF00026 + RF00004
2.9 Å97(1) 6ID0|1|F+6ID0|1|H
192NR_3.0_73286.18
Exact match
Homo sapiens
8C6J|1|5 (8C6J)
  • U5snRNA, pre-mRNA, U5 snRNA, PM5 5' Exon
  • Electron microscopy
  • Release Date: 2023-07-12
  • Standardized name: U5 snRNA
  • Source: Eukarya
  • Rfam: RF00020
2.8 Å97(6) 8C6J|1|5, 6QW6|1|5, 7DVQ|1|B, 6ICZ|1|B, 6ID0|1|B, 6ID1|1|B
193NR_3.0_12869.1
Exact match
4L81|1|A (4L81)
  • SAM-I/IV variant riboswitch aptamer doma[...]
  • X-ray diffraction
  • Release Date: 2014-05-28
3.0 Å96(1) 4L81|1|A
194NR_3.0_62361.1
Exact match
Corynebacterium diphtheriae
6JOO|1|B (6JOO)
  • Guide RNA
  • X-ray diffraction
  • Release Date: 2019-04-17
2.9 Å96(1) 6JOO|1|B
195NR_3.0_37888.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7O7Z|1|AH (7O7Z)
  • mRNA containing SARS-CoV-2 sequence
  • Electron microscopy
  • Release Date: 2021-06-02
  • Standardized name: Coronavirus frameshifting stimulation element
  • Source: Viruses
  • Rfam: RF00507
2.4 Å95(1) 7O7Z|1|AH
196NR_3.0_89968.1
Exact match
synthetic construct
6DVK|1|H (6DVK)
  • RNA (95-MER)
  • X-ray diffraction
  • Release Date: 2019-06-26
2.6 Å95(1) 6DVK|1|H
197NR_3.0_29205.1
Exact match
Caldanaerobacter subterraneus
4AOB|1|A (4AOB)
  • SAM-I RIBOSWITCH
  • X-ray diffraction
  • Release Date: 2012-05-09
  • Standardized name: SAM-I riboswitch
  • Source: Bacteria
  • Rfam: RF00162
3.0 Å94(1) 4AOB|1|A
198NR_3.0_84517.1
Exact match
5FJC|1|A (5FJC)
  • SAM-I riboswitch, RNA (94-MER)
  • X-ray diffraction
  • Release Date: 2016-05-25
  • Standardized name: SAM-I riboswitch
  • Source: Bacteria
  • Rfam: RF00162
1.7 Å94(24) 5FJC|1|A, 5FK4|1|A, 2YGH|1|A, 3GX5|1|A, 4B5R|1|A, 5FK3|1|A, 5FK2|1|A, 5FKF|1|A, 3GX3|1|A, 5FK6|1|A, 3IQR|1|A, 7EAF|1|A, 3IQP|1|A, 3GX7|1|A, 3IQN|1|A, 5FK1|1|A, 5FKD|1|A, 2GIS|1|A, 2YDH|1|A, 3GX2|1|A, 5FKH|1|A, 5FKG|1|A, 5FKE|1|A, 3GX6|1|A
199NR_3.0_41222.1
Exact match
Leishmania donovani
6AZ3|1|5 (6AZ3)
  • srRNA4, rRNA epsilon
  • Electron microscopy
  • Release Date: 2017-12-06
2.5 Å93(2) 6AZ3|1|5, 5T2A|1|H
200NR_3.0_60079.1
Exact match
Campylobacter jejuni
5X2G|1|B (5X2G)
  • sgRNA
  • X-ray diffraction
  • Release Date: 2017-03-29
2.4 Å93(2) 5X2G|1|B, 5X2H|1|B
201NR_3.0_90160.4
Exact match
synthetic construct
5B2P|1|B (5B2P)
  • Guide RNA
  • X-ray diffraction
  • Release Date: 2016-03-02
1.7 Å93(3) 5B2P|1|B, 5B2O|1|B, 5B2Q|1|B
202NR_3.0_63789.1
Exact match
Methanopyrus kandleri
3ADD|1|C (3ADD)
  • selenocysteine tRNA
  • X-ray diffraction
  • Release Date: 2010-07-28
  • Standardized name: Selenocysteine transfer RNA
  • Source: Archaea
  • Rfam: RF01852
2.4 Å92(6) 3ADD|1|C, 3ADD|1|D, 3ADB|1|D, 3ADB|1|C, 3ADC|1|C, 3ADC|1|D
203NR_3.0_88154.1
Exact match
synthetic construct
4RUM|1|A (4RUM)
  • NiCo riboswitch RNA
  • X-ray diffraction
  • Release Date: 2015-04-08
2.6 Å92(1) 4RUM|1|A
204NR_3.0_49553.1
Exact match
3CUL|1|C (3CUL)
  • RNA (92-MER)
  • X-ray diffraction
  • Release Date: 2008-06-24
2.8 Å91(4) 3CUL|1|C, 3CUN|1|C, 3CUL|1|D, 3CUN|1|D
205NR_3.0_60628.1
Exact match
Hepatovirus A
6MWN|1|B (6MWN)
  • HAV dV RNA (92-MER)
  • X-ray diffraction
  • Release Date: 2019-08-14
  • Standardized name: IRES
  • Source: Viruses
  • Rfam: RF00228
2.8 Å91(2) 6MWN|1|B, 6MWN|1|A
206NR_3.0_75326.1
Exact match
1M5K|1|B (1M5K)
  • RNA HAIRPIN RIBOZYME, RNA INHIBITOR SUBS[...]
  • X-ray diffraction
  • Release Date: 2002-08-02
2.4 Å91(8) 1M5K|1|B, 1M5K|1|E, 1M5O|1|B, 1M5P|1|B, 1M5O|1|E, 1M5V|1|B, 1M5P|1|E, 1M5V|1|E
207NR_3.0_79575.1
Exact match
Trypanosoma cruzi
5T5H|1|H (5T5H)
  • srRNA4
  • Electron microscopy
  • Release Date: 2016-10-12
2.5 Å91(1) 5T5H|1|H
208NR_3.0_12260.3
Exact match
Vibrio cholerae
3MXH|1|R (3MXH)
  • c-di-GMP Riboswitch, G20A mutant c-di-GM[...]
  • X-ray diffraction
  • Release Date: 2010-08-25
2.3 Å90(9) 3MXH|1|R, 3MUM|1|R, 3UCZ|1|R, 4YB1|1|R, 3MUR|1|R, 3UD4|1|R, 3MUT|1|R, 3IRW|1|R, 3UCU|1|R
209NR_3.0_12576.1
Exact match
Acidothermus cellulolyticus 11B
6WBR|1|B (6WBR)
  • RNA (94-MER)
  • X-ray diffraction
  • Release Date: 2020-11-18
2.9 Å90(1) 6WBR|1|B
210NR_3.0_43225.1
Exact match
Donggang virus
7KGA|1|B (7KGA)
  • RNA (90-MER)
  • X-ray diffraction
  • Release Date: 2021-06-23
  • Standardized name: Flavivirus DB element
  • Source: Viruses
  • Rfam: RF00525
2.1 Å90(1) 7KGA|1|B
211NR_3.0_50248.1
Exact match
Homo sapiens
8HMY|1|T (8HMY)
  • Pre-tRNA
  • Electron microscopy
  • Release Date: 2023-04-19
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.9 Å90(1) 8HMY|1|T
212NR_3.0_68018.1
Exact match
Coxsackievirus B3
8DP3|1|R (8DP3)
  • RNA (90-MER)
  • X-ray diffraction
  • Release Date: 2023-04-19
1.9 Å90(1) 8DP3|1|R
213NR_3.0_91539.1
Exact match
Sulfobacillus acidophilus
5T83|1|A (5T83)
  • RNA (95-MER)
  • X-ray diffraction
  • Release Date: 2017-01-11
  • Standardized name: Guanidine-I riboswitch
  • Source: Bacteria
  • Rfam: RF00442
2.7 Å90(1) 5T83|1|A
214NR_3.0_96800.1
Exact match
metagenome
7UR5|1|v (7UR5)
  • allo-tRNAUTu1, Allo-tRNAUTu1A
  • Electron microscopy
  • Release Date: 2022-08-10
2.6 Å90(5) 7UR5|1|v, 7UR5|1|w, 7UR5|1|y, 7URI|1|y, 7URM|1|v
215NR_3.0_78797.5
Exact match
4LVW|1|A (4LVW)
  • Tetrahydrofolate riboswitch, THF riboswi[...]
  • X-ray diffraction
  • Release Date: 2014-03-19
1.8 Å89(9) 4LVW|1|A, 4LVX|1|A, 4LVY|1|A, 4LW0|1|A, 4LVV|1|A, 4LVZ|1|A, 6Q57|1|A, 7KD1|1|A, 3SD3|1|A
216NR_3.0_86192.1
Exact match
Donggang virus
7KGA|1|A (7KGA)
  • RNA (90-MER)
  • X-ray diffraction
  • Release Date: 2021-06-23
  • Standardized name: Flavivirus DB element
  • Source: Viruses
  • Rfam: RF00525
2.1 Å89(1) 7KGA|1|A
217NR_3.0_90416.1
Exact match
Leishmania donovani
6AZ1|1|1 (6AZ1)
  • 18S rRNA, ribosomal RNA 18S
  • Electron microscopy
  • Release Date: 2017-12-06
  • Standardized name: SSU rRNA
  • Source: Eukarya
  • Rfam: RF01960
2.7 Å88(3) 6AZ1|1|1, 5T2A|1|2, 5OSG|1|2
218NR_3.0_61877.3
Exact match
Saccharomyces cerevisiae BY4741
7R6Q|1|6 (7R6Q)
  • ITS-2, ITS2 rRNA, ITS2
  • Electron microscopy
  • Release Date: 2022-11-09
3.0 Å87(4) 7R6Q|1|6, 7UOO|1|6, 7V08|1|6, 7U0H|1|6
219NR_3.0_67965.1
Exact match
Pea enation mosaic virus 2
8SH5|1|R (8SH5)
  • RNA (88-MER)
  • X-ray diffraction
  • Release Date: 2023-08-16
2.8 Å87(1) 8SH5|1|R
220NR_3.0_73216.5
Exact match
Escherichia coli
4V8B|1|AB (4V8B)
  • TRNA-LEU, MRNA, PtRNA-Leu
  • X-ray diffraction
  • Release Date: 2014-07-09
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å87(3) 4V8B|1|AB, 4V8B|1|CB, 7NSO|1|8
221NR_3.0_32185.1
Exact match
Vibrio cholerae
3OXE|1|A (3OXE)
  • Domain II of glycine riboswitch
  • X-ray diffraction
  • Release Date: 2010-12-29
2.9 Å86(14) 3OXE|1|A, 3OXB|1|A, 3OXB|1|B, 3OXE|1|B, 3OXD|1|A, 3OXD|1|B, 3OXM|1|A, 3OXM|1|B, 3OWI|1|A, 3OWZ|1|A, 3OWI|1|B, 3OWW|1|A, 3OWW|1|B, 3OWZ|1|B
222NR_3.0_47926.1
Exact match
Escherichia coli
7OIF|1|z (7OIF)
  • tRNA-Ser, mRNA
  • Electron microscopy
  • Release Date: 2022-01-19
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å86(1) 7OIF|1|z
223NR_3.0_57598.2
Exact match
Mus musculus
3RG5|1|B (3RG5)
  • tRNA(Sec)
  • X-ray diffraction
  • Release Date: 2011-06-08
  • Standardized name: Selenocysteine transfer RNA
  • Source: Eukarya
  • Rfam: RF01852
2.0 Å86(2) 3RG5|1|B, 3RG5|1|A
224NR_3.0_59099.1
Exact match
synthetic construct
5AOX|1|C (5AOX)
  • ALU JO CONSENSUS RNA
  • X-ray diffraction
  • Release Date: 2015-11-11
2.0 Å86(2) 5AOX|1|C, 5AOX|1|F
225NR_3.0_63075.1
Exact match
Geobacillus kaustophilus
7UQ6|1|B (7UQ6)
  • RNA (86-MER)
  • X-ray diffraction
  • Release Date: 2022-06-15
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å85(1) 7UQ6|1|B
226NR_3.0_69993.1
Exact match
synthetic construct
7ZO1|1|A (7ZO1)
  • CD34 sgRNA
  • X-ray diffraction
  • Release Date: 2022-10-26
2.4 Å85(1) 7ZO1|1|A
227NR_3.0_91654.1
Exact match
Oryza sativa
7JNH|1|B (7JNH)
  • Core double ENE RNA (Xtal construct) fro[...]
  • X-ray diffraction
  • Release Date: 2021-01-20
2.9 Å85(1) 7JNH|1|B
228NR_3.0_96336.1
Exact match
synthetic construct
7QR8|1|A (7QR8)
  • PTPRC sgRNA
  • X-ray diffraction
  • Release Date: 2022-10-26
2.8 Å85(1) 7QR8|1|A
229NR_3.0_01779.1
Exact match
marine metagenome
4FRG|1|B (4FRG)
  • cobalamin riboswitch aptamer domain
  • X-ray diffraction
  • Release Date: 2012-10-17
3.0 Å84(2) 4FRG|1|B, 4FRG|1|X
230NR_3.0_04754.1
Exact match
Dickeya dadantii
5U3G|1|B (5U3G)
  • ykkC riboswitch
  • X-ray diffraction
  • Release Date: 2017-02-01
  • Standardized name: Guanidine-I riboswitch
  • Source: Bacteria
  • Rfam: RF00442
2.3 Å84(1) 5U3G|1|B
231NR_3.0_44791.1
Exact match
synthetic construct
7QR0|1|A (7QR0)
  • sgRNA, TRAC sgRNA
  • X-ray diffraction
  • Release Date: 2022-10-26
2.3 Å84(3) 7QR0|1|A, 7QR1|1|A, 7OX8|1|A
232NR_3.0_55025.1
Exact match
synthetic construct
7QQP|1|A (7QQP)
  • sgRNA, AAVS1 sgRNA
  • X-ray diffraction
  • Release Date: 2022-10-26
2.6 Å84(6) 7QQP|1|A, 7QQR|1|A, 7QQO|1|A, 7QR7|1|A, 7QQQ|1|A, 7OX9|1|A
233NR_3.0_79803.1
Exact match
Bos taurus
7O80|1|AT (7O80)
  • P-site Leu-tRNA(Leu), mRNA containing SA[...]
  • Electron microscopy
  • Release Date: 2021-06-02
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.9 Å84(1) 7O80|1|AT
234NR_3.0_83770.1
Exact match
synthetic construct
7QQX|1|A (7QQX)
  • FANCF sgRNA
  • X-ray diffraction
  • Release Date: 2022-10-26
2.4 Å84(6) 7QQX|1|A, 7QQS|1|A, 7QQU|1|A, 7QQT|1|A, 7QQZ|1|A, 7QQV|1|A
235NR_3.0_89292.5
Exact match
4V8D|1|CD (4V8D)
  • TRNA-TYR, MRNA
  • X-ray diffraction
  • Release Date: 2014-07-09
3.0 Å84(4) 4V8D|1|CD, 4V8D|1|AD, 4V8D|1|AB, 4V8D|1|CB
236NR_3.0_98075.1
Exact match
2ZZM|1|B (2ZZM)
  • RNA (84-MER)
  • X-ray diffraction
  • Release Date: 2009-09-15
2.7 Å84(1) 2ZZM|1|B
237NR_3.0_02656.1
Exact match
Turnip yellow mosaic virus
4P5J|1|A (4P5J)
  • Turnip yellow mosaic virus mRNA for the [...]
  • X-ray diffraction
  • Release Date: 2014-06-04
  • Standardized name: tRNA-like 3' UTR element
  • Source: Viruses
  • Rfam: RF00233
2.0 Å83(1) 4P5J|1|A
238NR_3.0_27557.1
Exact match
4KZD|1|R (4KZD)
  • RNA (84-MER), RNA (86-MER), RNA (83-MER)[...]
  • X-ray diffraction
  • Release Date: 2014-06-18
2.2 Å83(4) 4KZD|1|R, 6B14|1|R, 6B3K|1|R, 4KZE|1|R
239NR_3.0_31480.1
Exact match
Geobacter
4YAZ|1|R (4YAZ)
  • RNA (84-MER)
  • X-ray diffraction
  • Release Date: 2015-04-15
  • Standardized name: Cyclic di-GMP-I riboswitch
  • Source: Bacteria
  • Rfam: RF01051
2.0 Å83(4) 4YAZ|1|R, 4YAZ|1|A, 4YB0|1|R, 4YB0|1|A
240NR_3.0_11709.1
Exact match
Escherichia coli
3ZGZ|1|B (3ZGZ)
  • TRNA-LEU UAA ISOACCEPTOR, TRNALEU5 UAA I[...]
  • X-ray diffraction
  • Release Date: 2013-01-30
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.4 Å82(14) 3ZGZ|1|B, 4AQ7|1|B, 5OMW|1|B, 3ZGZ|1|E, 4AS1|1|B, 4ARI|1|B, 4AQ7|1|E, 4CQN|1|B, 3ZJT|1|B, 5OMW|1|E, 3ZJU|1|B, 4ARC|1|B, 4CQN|1|E, 3ZJV|1|B
241NR_3.0_18859.1
Exact match
synthetic construct
6JQ5|1|B+6JQ5|1|A (6JQ5)
  • RNA (82-MER)
  • X-ray diffraction
  • Release Date: 2019-06-12
2.1 Å82(1) 6JQ5|1|B+6JQ5|1|A
242NR_3.0_30254.1
Exact match
synthetic construct
7KVT|1|B (7KVT)
  • Squash RNA aptamer bound to DFHBI-1T wit[...]
  • X-ray diffraction
  • Release Date: 2022-01-19
2.7 Å82(3) 7KVT|1|B, 7KVU|1|G, 7KVV|1|D
243NR_3.0_85745.1
Exact match
synthetic construct
6JQ6|1|U (6JQ6)
  • RNA (81-MER)
  • X-ray diffraction
  • Release Date: 2019-06-12
2.6 Å82(1) 6JQ6|1|U
244NR_3.0_11927.1
Exact match
Schizosaccharomyces pombe
8ESQ|1|6 (8ESQ)
  • RNA (81-MER), RNA (75-MER)
  • Electron microscopy
  • Release Date: 2022-11-30
2.8 Å81(2) 8ESQ|1|6, 8EV3|1|6
245NR_3.0_13919.1
Exact match
3AM1|1|B (3AM1)
  • ASL-truncated tRNA
  • X-ray diffraction
  • Release Date: 2010-12-29
2.4 Å81(1) 3AM1|1|B
246NR_3.0_99121.1
Exact match
synthetic construct
5FQ5|1|A (5FQ5)
  • SGRNA, RNA (95-MER)
  • X-ray diffraction
  • Release Date: 2016-03-23
2.1 Å81(13) 5FQ5|1|A, 5FW2|1|A, 4UN4|1|A, 6AEG|1|A, 4UN5|1|A, 5FW3|1|A, 4UN3|1|A, 6K4Q|1|A, 6K4P|1|A, 5FW1|1|A, 6K57|1|A, 6AEB|1|A, 6AEB|1|E
247NR_3.0_06798.1
Exact match
synthetic construct
7WV3|1|E (7WV3)
  • RNA (80-MER)
  • Electron microscopy
  • Release Date: 2022-11-16
2.3 Å80(1) 7WV3|1|E
248NR_3.0_09775.1
Exact match
Agrobacterium tumefaciens
5AH5|1|D (5AH5)
  • TRNA-LEU TAA ISOACCEPTOR
  • X-ray diffraction
  • Release Date: 2016-02-17
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.1 Å80(2) 5AH5|1|D, 5AH5|1|C
249NR_3.0_13221.1
Exact match
Thermus thermophilus
1H3E|1|B (1H3E)
  • WILD-TYPE TRNATYR(GUA)
  • X-ray diffraction
  • Release Date: 2002-10-27
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å80(1) 1H3E|1|B
250NR_3.0_35448.1
Exact match
Leishmania donovani
3JCS|1|5 (3JCS)
  • 26S epsilon ribosomal RNA
  • Electron microscopy
  • Release Date: 2016-07-20
2.8 Å80(1) 3JCS|1|5
251NR_3.0_73731.2
Exact match
Thermus thermophilus
3U4M|1|B (3U4M)
  • RNA (80-MER), fragment of 23S rRNA, 23S [...]
  • X-ray diffraction
  • Release Date: 2012-08-08
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.0 Å80(6) 3U4M|1|B, 4QVI|1|B, 3UMY|1|B, 4QG3|1|B, 3U56|1|B, 5NPM|1|B
252NR_3.0_41726.1
Exact match
Escherichia coli K-12
8JOZ|1|B (8JOZ)
  • tRNA Ser (88-MER)
  • X-ray diffraction
  • Release Date: 2023-08-30
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.2 Å79(1) 8JOZ|1|B
253NR_3.0_75310.1
Exact match
Salmonella enterica
6CU1|1|A (6CU1)
  • YrlA effector-binding module
  • X-ray diffraction
  • Release Date: 2018-10-31
  • Standardized name: Y RNA-like
  • Source: Bacteria
  • Rfam: RF02553
3.0 Å79(1) 6CU1|1|A
254NR_3.0_12697.1
Exact match
Streptococcus thermophilus
6RJA|1|D (6RJA)
  • RNA (78-MER)
  • Electron microscopy
  • Release Date: 2019-10-02
3.0 Å78(2) 6RJA|1|D, 6RJA|1|G
255NR_3.0_23989.1
Exact match
Thermus thermophilus
2BTE|1|B (2BTE)
  • TRNALEU TRANSCRIPT WITH ANTICODON CAG
  • X-ray diffraction
  • Release Date: 2005-09-15
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å78(2) 2BTE|1|B, 2BTE|1|E
256NR_3.0_42241.3
Exact match
7TZS|1|X (7TZS)
  • TPP riboswitch, thi-box riboswitch, thiM[...]
  • X-ray diffraction
  • Release Date: 2022-05-25
  • Standardized name: TPP riboswitch (THI element)
  • Source: Bacteria
  • Rfam: RF00059
2.2 Å78(19) 7TZS|1|X, 2GDI|1|X, 2GDI|1|Y, 7TZS|1|Y, 7TDA|1|A, 7TDB|1|A, 4NYA|1|A, 2HOJ|1|A, 7TDC|1|A, 2HOM|1|A, 2HOL|1|A, 7TZR|1|X, 4NYD|1|A, 4NYA|1|B, 7TZR|1|Y, 2HOO|1|A, 7TZT|1|A, 7TZU|1|A, 7TD7|1|A
257NR_3.0_56041.1
Exact match
Archaeoglobus fulgidus
3AMT|1|B (3AMT)
  • RNA (78-MER)
  • X-ray diffraction
  • Release Date: 2011-10-12
  • Standardized name: tRNA
  • Source: Archaea
  • Rfam: RF00005
2.9 Å78(1) 3AMT|1|B
258NR_3.0_72172.1
Exact match
Homo sapiens
5CCB|1|N (5CCB)
  • tRNA3Lys
  • X-ray diffraction
  • Release Date: 2015-11-04
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.0 Å78(2) 5CCB|1|N, 5CCX|1|N
259NR_3.0_11374.1
Exact match
Mycobacterium tuberculosis
6UFG|1|B (6UFG)
  • RNA (77-MER)
  • X-ray diffraction
  • Release Date: 2019-11-20
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å77(1) 6UFG|1|B
260NR_3.0_11689.4
Exact match
Saccharomyces cerevisiae
7ZUX|1|7 (7ZUX)
  • P/E-site tRNA, P/E tRNA
  • Electron microscopy
  • Release Date: 2023-02-22
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.5 Å77(2) 7ZUX|1|7, 6ZVI|1|e
261NR_3.0_27756.1
Exact match
Arabidopsis thaliana
3D2V|1|A (3D2V)
  • NUCLEIC ACID, TPP-specific riboswitch
  • X-ray diffraction
  • Release Date: 2008-07-01
  • Standardized name: TPP riboswitch (THI element)
  • Source: Eukarya
  • Rfam: RF00059
2.0 Å77(8) 3D2V|1|A, 3D2X|1|A, 3D2V|1|B, 3D2G|1|A, 3D2X|1|B, 2CKY|1|A, 3D2G|1|B, 2CKY|1|B
262NR_3.0_44698.1
Exact match
Mycolicibacterium smegmatis
6UFM|1|A (6UFM)
  • RNA (77-MER)
  • X-ray diffraction
  • Release Date: 2019-12-04
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.8 Å77(1) 6UFM|1|A
263NR_3.0_45098.2
Exact match
Escherichia coli K-12
7B5K|1|x (7B5K)
  • P-site Isoleucine tRNA (77-MER), mRNA
  • Electron microscopy
  • Release Date: 2021-05-26
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å77(1) 7B5K|1|x
264NR_3.0_47494.1
Exact match
Mycolicibacterium smegmatis MC2 155
8FR8|1|E (8FR8)
  • fMet tRNA (77-MER), mRNA
  • Electron microscopy
  • Release Date: 2023-05-17
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.8 Å77(1) 8FR8|1|E
265NR_3.0_54588.1
Exact match
Mycobacterium tuberculosis H37Rv
7K98|1|C (7K98)
  • tRNA(Phe)
  • X-ray diffraction
  • Release Date: 2021-05-12
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.2 Å77(6) 7K98|1|C, 7K98|1|F, 7KA0|1|C, 7K9M|1|C, 7KAB|1|C, 7KA0|1|F
266NR_3.0_56101.4
Exact match
Escherichia coli K-12
7ZP8|1|v (7ZP8)
  • P-site tRNA-Pro, mRNA, Pro-tRNA
  • Electron microscopy
  • Release Date: 2022-08-10
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.2 Å77(6) 7ZP8|1|v, 7Z20|1|v, 7ZOD|1|v, 7O1A|1|B8, 7O1C|1|B8, 7O19|1|B8
267NR_3.0_65284.1
Exact match
2ZUE|1|B (2ZUE)
  • tRNA-Arg
  • X-ray diffraction
  • Release Date: 2009-08-18
2.0 Å77(2) 2ZUE|1|B, 2ZUF|1|B
268NR_3.0_70863.1
Exact match
Homo sapiens
6SVS|1|A (6SVS)
  • RNA (79-mer)
  • X-ray diffraction
  • Release Date: 2020-01-01
2.5 Å77(2) 6SVS|1|A, 6SVS|1|B
269NR_3.0_96870.1
Exact match
Escherichia coli K-12
7ST2|1|5 (7ST2)
  • tRNA Pro, mRNA
  • Electron microscopy
  • Release Date: 2022-02-23
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å77(2) 7ST2|1|5, 7ST6|1|5
270NR_3.0_01056.1
Exact match
Escherichia coli BW25113
8AKN|1|Z (8AKN)
  • Isoleucine-tRNA, mRNA
  • Electron microscopy
  • Release Date: 2023-03-08
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.3 Å76(1) 8AKN|1|Z
271NR_3.0_05887.1
Exact match
Escherichia coli
7YSE|1|E (7YSE)
  • RNA (76-MER), Gly-tRNA
  • X-ray diffraction
  • Release Date: 2023-02-01
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å76(3) 7YSE|1|E, 7YSE|1|F, 7ZQ6|1|M
272NR_3.0_17351.3
Exact match
Homo sapiens
7QVP|1|B4 (7QVP)
  • tRNA, mRNA, tRNA P/P
  • Electron microscopy
  • Release Date: 2022-10-12
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
3.0 Å76(3) 7QVP|1|B4, 6Y2L|1|B4, 7QVP|1|D5
273NR_3.0_20230.1
Exact match
Escherichia coli K-12
7B5K|1|z (7B5K)
  • atRNA synthetic Stop tRNA (76-MER), mRNA
  • Electron microscopy
  • Release Date: 2021-05-26
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å76(1) 7B5K|1|z
274NR_3.0_27306.1
Exact match
Lactobacillus rhamnosus
4JF2|1|A (4JF2)
  • PreQ1-II Riboswitch
  • X-ray diffraction
  • Release Date: 2013-04-17
2.3 Å76(1) 4JF2|1|A
275NR_3.0_30383.1
Exact match
Neurospora crassa
7R81|1|t1 (7R81)
  • tRNA, mRNA
  • Electron microscopy
  • Release Date: 2021-12-01
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.7 Å76(2) 7R81|1|t1, 7R81|1|u1
276NR_3.0_37355.1
Exact match
Saccharomyces cerevisiae
6WOO|1|3 (6WOO)
  • Met-tRNA-iMet, mRNA
  • Electron microscopy
  • Release Date: 2020-09-23
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.9 Å76(1) 6WOO|1|3
277NR_3.0_38961.4
Exact match
Saccharomyces cerevisiae
7OSM|1|ASIT (7OSM)
  • A/P-site tRNA, mRNA, PHE tRNA, A/P tRNA
  • X-ray diffraction
  • Release Date: 2021-12-08
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
3.0 Å76(3) 7OSM|1|ASIT, 7ZUX|1|6, 6ZVI|1|d
278NR_3.0_42401.1
Exact match
Thermus thermophilus
4RDX|1|C (4RDX)
  • tRNA(his)
  • X-ray diffraction
  • Release Date: 2015-03-25
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.6 Å76(1) 4RDX|1|C
279NR_3.0_44680.1
Exact match
Rattus norvegicus
7QGG|1|v (7QGG)
  • RNA (76-MER), RNA (5'-D(P*()P*()P*()P*()[...]
  • Electron microscopy
  • Release Date: 2022-10-26
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.9 Å76(1) 7QGG|1|v
280NR_3.0_44690.1
Exact match
Nicotiana tabacum
8B2L|1|i2 (8B2L)
  • tRNA, mRNA
  • Electron microscopy
  • Release Date: 2023-08-23
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.2 Å76(2) 8B2L|1|i2, 8B2L|1|W2
281NR_3.0_51130.1
Exact match
Saccharomyces cerevisiae W303
7ZW0|1|sn (7ZW0)
  • tRNA, mRNA
  • Electron microscopy
  • Release Date: 2022-10-05
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.4 Å76(1) 7ZW0|1|sn
282NR_3.0_53745.1
Exact match
Saccharomyces cerevisiae W303
7ZW0|1|sl (7ZW0)
  • tRNA, mRNA, Ala tRNA, A-site Ala aminoac[...]
  • Electron microscopy
  • Release Date: 2022-10-05
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.4 Å76(14) 7ZW0|1|sl, 8AGX|1|x, 8AGX|1|y, 8AAF|1|x, 8AAF|1|y, 8AGT|1|x, 8AGV|1|x, 8AGW|1|x, 8AGZ|1|x, 8AGT|1|y, 8AGV|1|y, 8AGW|1|y, 8AGZ|1|y, 8AGU|1|y
283NR_3.0_55964.1
Exact match
Lactobacillus rhamnosus
5D5L|1|A (5D5L)
  • PreQ1-II riboswitch
  • X-ray diffraction
  • Release Date: 2016-08-10
2.5 Å76(4) 5D5L|1|A, 5D5L|1|D, 5D5L|1|B, 5D5L|1|C
284NR_3.0_73703.1
Exact match
Saccharomyces cerevisiae
6R5Q|1|2 (6R5Q)
  • P-tRNA, mRNA
  • Electron microscopy
  • Release Date: 2019-07-10
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
3.0 Å76(1) 6R5Q|1|2
285NR_3.0_79985.1
Exact match
Rattus norvegicus
7QGG|1|u (7QGG)
  • RNA (76-MER), RNA (5'-D(P*()P*()P*()P*()[...]
  • Electron microscopy
  • Release Date: 2022-10-26
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.9 Å76(1) 7QGG|1|u
286NR_3.0_83641.1
Exact match
Escherichia coli
4Y1M|1|B (4Y1M)
  • E. coli yybP-ykoY riboswitch
  • X-ray diffraction
  • Release Date: 2015-04-08
3.0 Å76(2) 4Y1M|1|B, 4Y1M|1|A
287NR_3.0_94089.1
Exact match
Spizellomyces punctatus
8GKH|1|W (8GKH)
  • RNA (78-MER)
  • Electron microscopy
  • Release Date: 2023-07-05
2.7 Å76(1) 8GKH|1|W
288NR_3.0_95556.5
Exact match
Thermus thermophilus
4V90|1|AV (4V90)
  • RNA (77-MER), 5'-R(*UP*AP*AP*AP*AP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 2014-07-09
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å76(3) 4V90|1|AV, 5J8B|1|y, 5J8B|1|w
289NR_3.0_03715.1
Exact match
1QU2|1|T (1QU2)
  • ISOLEUCYL-TRNA
  • X-ray diffraction
  • Release Date: 1999-08-31
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.2 Å75(3) 1QU2|1|T, 1QU3|1|T, 1FFY|1|T
290NR_3.0_10787.1
Exact match
Methanocaldococcus jannaschii
5X6B|1|P (5X6B)
  • tRNACys
  • X-ray diffraction
  • Release Date: 2017-12-06
  • Standardized name: tRNA
  • Source: Archaea
  • Rfam: RF00005
2.6 Å75(1) 5X6B|1|P
291NR_3.0_14254.1
Exact match
Homo sapiens
7LJ3|1|A (7LJ3)
  • RNA (75-MER)
  • Electron microscopy
  • Release Date: 2021-11-17
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.9 Å75(3) 7LJ3|1|A, 7LJ3|1|C, 7LJ3|1|B
292NR_3.0_19931.1
Exact match
Mus musculus
7CPU|1|S6 (7CPU)
  • Met-tRNA
  • Electron microscopy
  • Release Date: 2022-02-02
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.8 Å75(1) 7CPU|1|S6
293NR_3.0_20717.1
Exact match
Chlamydomonas reinhardtii
7PKT|1|0 (7PKT)
  • L3a rRNA (5S)
  • Electron microscopy
  • Release Date: 2022-06-15
3.0 Å75(1) 7PKT|1|0
294NR_3.0_24366.1
Exact match
Saccharomyces cerevisiae
6R5Q|1|3 (6R5Q)
  • E-tRNA
  • Electron microscopy
  • Release Date: 2019-07-10
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
3.0 Å75(1) 6R5Q|1|3
295NR_3.0_29085.1
Exact match
1N78|1|C (1N78)
  • TRNA(GLU), tRNA
  • X-ray diffraction
  • Release Date: 2003-02-25
2.1 Å75(14) 1N78|1|C, 1N78|1|D, 2DXI|1|C, 1N77|1|C, 2DXI|1|D, 2CV2|1|C, 1N77|1|D, 2CV2|1|D, 2CV1|1|D, 2CV1|1|C, 2CV0|1|C, 2CV0|1|D, 1G59|1|B, 1G59|1|D
296NR_3.0_52699.1
Exact match
Bos taurus
2DR2|1|B (2DR2)
  • transfer RNA-Trp
  • X-ray diffraction
  • Release Date: 2006-07-11
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
3.0 Å75(1) 2DR2|1|B
297NR_3.0_57348.1
Exact match
1GAX|1|D (1GAX)
  • TRNA(VAL), tRNA (Val)
  • X-ray diffraction
  • Release Date: 2000-12-06
2.9 Å75(4) 1GAX|1|D, 1GAX|1|C, 1IVS|1|C, 1IVS|1|D
298NR_3.0_58761.1
Exact match
2CSX|1|C (2CSX)
  • RNA (75-MER), RNA (74-MER)
  • X-ray diffraction
  • Release Date: 2005-09-20
2.7 Å75(4) 2CSX|1|C, 2CT8|1|D, 2CT8|1|C, 2CSX|1|D
299NR_3.0_60125.4
Exact match
Saccharomyces cerevisiae
6T4Q|1|6 (6T4Q)
  • tRNA, mRNA, ICG tRNA Arg (P/P)
  • Electron microscopy
  • Release Date: 2019-12-25
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.6 Å75(2) 6T4Q|1|6, 6SNT|1|6
300NR_3.0_65433.1
Exact match
Escherichia coli BW25113
8AM9|1|8 (8AM9)
  • Leucine tRNA, mRNA
  • Electron microscopy
  • Release Date: 2023-03-08
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.8 Å75(1) 8AM9|1|8
301NR_3.0_70416.1
Exact match
Escherichia coli
6YS3|1|v (6YS3)
  • glycine-tRNA glyT
  • Electron microscopy
  • Release Date: 2020-09-30
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.6 Å75(2) 6YS3|1|v, 6QDW|1|v
302NR_3.0_71217.4
Exact match
Homo sapiens
6ZMI|1|CC (6ZMI)
  • tRNA, E-site tRNA, pe/E tRNA, tNRA E/E
  • Electron microscopy
  • Release Date: 2020-08-19
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.6 Å75(9) 6ZMI|1|CC, 6ZM7|1|CC, 7XNX|1|CC, 6ZVH|1|x, 6Z6N|1|CC, 6ZME|1|CC, 7QVP|1|CC, 6Z6L|1|CC, 7OLD|1|5
303NR_3.0_96269.13
Exact match
Homo sapiens
6ZP4|1|1 (6ZP4)
  • E site tRNA (75-MER), tRNA, tRNA P/E, mR[...]
  • Electron microscopy
  • Release Date: 2020-07-29
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.9 Å75(3) 6ZP4|1|1, 6QZP|1|S6, 7QVP|1|B5
304NR_3.0_96274.2
Exact match
Saccharomyces cerevisiae
6T4Q|1|7 (6T4Q)
  • tRNA (E/E), mRNA
  • Electron microscopy
  • Release Date: 2019-12-25
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.6 Å75(1) 6T4Q|1|7
305NR_3.0_04935.1
Exact match
3AKZ|1|E (3AKZ)
  • tRNAGln, tRNA
  • X-ray diffraction
  • Release Date: 2010-09-29
2.9 Å74(6) 3AKZ|1|E, 3AKZ|1|F, 3AKZ|1|H, 3AKZ|1|G, 4YVJ|1|C, 4YVK|1|C
306NR_3.0_09431.1
Exact match
4PR6|1|B (4PR6)
  • HDV RIBOZYME SELF-CLEAVED
  • X-ray diffraction
  • Release Date: 2014-10-29
2.3 Å74(1) 4PR6|1|B
307NR_3.0_19534.1
Exact match
Oryctolagus cuniculus
6YAL|1|1 (6YAL)
  • initiator methionylated tRNA, beta-globi[...]
  • Electron microscopy
  • Release Date: 2020-04-08
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
3.0 Å74(1) 6YAL|1|1
308NR_3.0_39569.1
Exact match
Saccharomyces cerevisiae
4YYE|1|C (4YYE)
  • tRNA
  • X-ray diffraction
  • Release Date: 2016-01-06
  • Standardized name: tRNA
  • Source: Mitochondria
  • Rfam: RF00005
2.3 Å74(2) 4YYE|1|C, 4YYE|1|D
309NR_3.0_56633.6
Exact match
Escherichia coli K-12
7P3K|1|V (7P3K)
  • tRNA, mRNA
  • Electron microscopy
  • Release Date: 2021-10-27
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å74(2) 7P3K|1|V, 7OIZ|1|V
310NR_3.0_64397.1
Exact match
Enterococcus faecalis
7P7Q|1|D (7P7Q)
  • tRNA-fMETi, RNA (5'-R(P*GP*GP*AP*GP*GP*U[...]
  • Electron microscopy
  • Release Date: 2022-02-23
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.4 Å74(4) 7P7Q|1|D, 7P7T|1|D, 7NHK|1|D, 7P7S|1|D
311NR_3.0_65073.1
Exact match
Clostridium acetobutylicum
3Q3Z|1|V (3Q3Z)
  • c-di-GMP-II riboswitch
  • X-ray diffraction
  • Release Date: 2011-05-11
  • Standardized name: Cyclic di-GMP-II riboswitch
  • Source: Bacteria
  • Rfam: RF01786
2.5 Å74(2) 3Q3Z|1|V, 3Q3Z|1|A
312NR_3.0_68467.11
Exact match
Oryctolagus cuniculus
8P2K|1|AT (8P2K)
  • P-site Val-tRNA
  • Electron microscopy
  • Release Date: 2023-07-19
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.9 Å74(1) 8P2K|1|AT
313NR_3.0_70420.1
Exact match
1J1U|1|B (1J1U)
  • tRNA(Tyr)
  • X-ray diffraction
  • Release Date: 2003-06-03
2.0 Å74(1) 1J1U|1|B
314NR_3.0_83386.1
Exact match
Escherichia coli
1U0B|1|A (1U0B)
  • Cysteinyl-tRNA synthetase
  • X-ray diffraction
  • Release Date: 2004-11-23
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.3 Å74(1) 1U0B|1|A
315NR_3.0_98593.1
Exact match
Methanocaldococcus jannaschii
5D8H|1|A (5D8H)
  • 23S ribosomal RNA
  • X-ray diffraction
  • Release Date: 2016-08-24
  • Standardized name: LSU rRNA
  • Source: Archaea
  • Rfam: RF02540
2.8 Å74(1) 5D8H|1|A
316NR_3.0_99566.1
Exact match
Neurospora crassa
6YWE|1|bb (6YWE)
  • tRNA P/E state, mRNA
  • Electron microscopy
  • Release Date: 2020-11-11
  • Standardized name: tRNA
  • Source: Mitochondria
  • Rfam: RF00005
3.0 Å74(1) 6YWE|1|bb
317NR_3.0_02527.1
Exact match
Escherichia coli
7OT5|1|z (7OT5)
  • tRNA-Leu, mRNA
  • Electron microscopy
  • Release Date: 2022-01-19
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å73(2) 7OT5|1|z, 7OII|1|z
318NR_3.0_06496.1
Exact match
Homo sapiens
5E6M|1|C (5E6M)
  • tRNA(Gly)
  • X-ray diffraction
  • Release Date: 2016-07-20
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.9 Å73(2) 5E6M|1|C, 5E6M|1|E
319NR_3.0_24187.1
Exact match
Acinetobacter baumannii
7UVZ|1|v (7UVZ)
  • tRNA-met, mRNA
  • Electron microscopy
  • Release Date: 2023-04-19
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.2 Å73(9) 7UVZ|1|v, 7UVW|1|v, 7RYG|1|v, 7UVY|1|v, 7M4Y|1|v, 7UVV|1|v, 7RYF|1|v, 7M4X|1|v, 6V3A|1|v
320NR_3.0_31819.5
Exact match
1QTQ|1|B (1QTQ)
  • GLUTAMINYL TRNA, GLUTAMINE TRNA APTAMER,[...]
  • X-ray diffraction
  • Release Date: 1998-05-27
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.3 Å73(20) 1QTQ|1|B, 4JXX|1|B, 1ZJW|1|B, 4V7L|1|AW, 4V7L|1|CW, 1EUY|1|B, 4V7L|1|AY, 4V7L|1|CY, 1QRS|1|B, 1QRT|1|B, 1QRU|1|B, 1GTR|1|B, 2RD2|1|B, 1GTS|1|B, 5NWY|1|M, 2RE8|1|B, 1GSG|1|T, 1O0C|1|B, 1O0B|1|B, 1EXD|1|B
321NR_3.0_43299.1
Exact match
Listeria monocytogenes
5VW1|1|C (5VW1)
  • sgRNA
  • X-ray diffraction
  • Release Date: 2017-06-28
2.6 Å73(1) 5VW1|1|C
322NR_3.0_45659.1
Exact match
synthetic construct
4ZNP|1|A (4ZNP)
  • pfI Riboswitch
  • X-ray diffraction
  • Release Date: 2015-08-26
2.9 Å73(2) 4ZNP|1|A, 4ZNP|1|B
323NR_3.0_83985.1
Exact match
Bacillus subtilis subsp. subtilis str. 168
7AS8|1|2 (7AS8)
  • tRNA-Ala-1-1
  • Electron microscopy
  • Release Date: 2020-12-09
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å73(1) 7AS8|1|2
324NR_3.0_87112.1
Exact match
Staphylococcus aureus
7P48|1|5 (7P48)
  • P-site tRNA, mRNA
  • Electron microscopy
  • Release Date: 2022-02-02
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å73(1) 7P48|1|5
325NR_3.0_96162.2
Exact match
Staphylococcus aureus
7EL1|1|B (7EL1)
  • RNA (73-MER)
  • X-ray diffraction
  • Release Date: 2021-07-28
2.2 Å73(3) 7EL1|1|B, 5CZZ|1|B, 5AXW|1|B
326NR_3.0_12494.1
Exact match
Salmonella enterica
6CFJ|1|1x (6CFJ)
  • P-site tRNA, mRNA
  • X-ray diffraction
  • Release Date: 2018-03-07
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.8 Å72(2) 6CFJ|1|1x, 6CFJ|1|2x
327NR_3.0_20721.9
Exact match
Thermus thermophilus
5E81|1|2K (5E81)
  • tRNA-fMet, mRNA, P-site tRNA
  • X-ray diffraction
  • Release Date: 2016-01-27
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å72(3) 5E81|1|2K, 5J8B|1|x, 5E81|1|2L
328NR_3.0_20965.1
Exact match
Streptococcus pyogenes
4ZT0|1|D (4ZT0)
  • single-guide RNA, gRNA, sgRNA
  • X-ray diffraction
  • Release Date: 2015-07-08
2.9 Å72(5) 4ZT0|1|D, 4ZT0|1|B, 7Z4L|1|A, 7S4X|1|B, 7Z4J|1|A
329NR_3.0_61171.1
Exact match
Escherichia coli
6GSJ|1|3L (6GSJ)
  • tRNAThr
  • X-ray diffraction
  • Release Date: 2018-07-04
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å72(2) 6GSJ|1|3L, 6GSJ|1|3K
330NR_3.0_73165.3
Exact match
Hepatitis delta virus
4PRF|1|B (4PRF)
  • RNA (HEPATITIS DELTA VIRUS GENOMIC RIBOZ[...]
  • X-ray diffraction
  • Release Date: 2014-10-29
2.4 Å72(12) 4PRF|1|B, 2OJ3|1|B, 1SJF|1|B, 1VC0|1|B, 1VC6|1|B, 1VBZ|1|B, 1SJ4|1|R, 1SJ3|1|R, 2OIH|1|B, 1VBY|1|B, 1VBX|1|B, 1DRZ|1|B
331NR_3.0_89775.1
Exact match
uncultured archaeon
7V94|1|B (7V94)
  • sgRNA
  • Electron microscopy
  • Release Date: 2022-04-13
2.6 Å72(2) 7V94|1|B, 7V93|1|B
332NR_3.0_90476.1
Exact match
Homo sapiens
8GLP|1|Pt (8GLP)
  • P-site tRNA, mRNA
  • Electron microscopy
  • Release Date: 2023-04-19
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
1.7 Å72(4) 8GLP|1|Pt, 8G5Y|1|Pt, 8G60|1|Pt, 8G6J|1|Pt
333NR_3.0_98033.1
Exact match
2AZX|1|D (2AZX)
  • 72-MER
  • X-ray diffraction
  • Release Date: 2006-08-01
2.8 Å72(2) 2AZX|1|D, 2AZX|1|C
334NR_3.0_01439.1
Exact match
Zika virus
5TPY|1|A (5TPY)
  • RNA (71-MER)
  • X-ray diffraction
  • Release Date: 2016-12-14
2.8 Å71(1) 5TPY|1|A
335NR_3.0_18038.1
Exact match
Escherichia coli K-12
7N2V|1|Pt (7N2V)
  • tRNA, mRNA
  • Electron microscopy
  • Release Date: 2021-07-14
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.5 Å71(1) 7N2V|1|Pt
336NR_3.0_28348.1
Exact match
synthetic construct
4JXZ|1|B (4JXZ)
  • RNA (71-MER), RNA (72-MER)
  • X-ray diffraction
  • Release Date: 2013-05-01
2.4 Å71(2) 4JXZ|1|B, 4JYZ|1|B
337NR_3.0_32685.1
Exact match
Homo sapiens
7QI6|1|Ax (7QI6)
  • P/E-tRNA, mRNA
  • Electron microscopy
  • Release Date: 2023-05-17
  • Standardized name: tRNA
  • Source: Mitochondria
  • Rfam: RF00005
3.0 Å71(1) 7QI6|1|Ax
338NR_3.0_33389.1
Exact match
2DU3|1|D (2DU3)
  • tRNA
  • X-ray diffraction
  • Release Date: 2007-03-13
2.6 Å71(2) 2DU3|1|D, 2DU4|1|C
339NR_3.0_35542.118
Exact match
Escherichia coli
5L4O|1|A (5L4O)
  • P-site tRNA, mRNA, FORMYL-METHIONYL-TRNA[...]
  • X-ray diffraction
  • Release Date: 2017-03-01
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.8 Å71(212) 5L4O|1|A, 5HCQ|1|1x, 5IBB|1|2K, 8EKB|1|1x, 6CAE|1|1x, 7U2J|1|1x, 5HCQ|1|2x, 8EKB|1|2x, 7OSA|1|PSIT, 7U2H|1|1x, 5IB7|1|2K, 4V8D|1|CC, 7RQ8|1|1x, 5HCR|1|1x, 4Z8C|1|1x, 5J4B|1|1x, 7U2J|1|2x, 6XHY|1|1x, 4WSD|1|2L, 8EV7|1|1x, 4V8D|1|AC, 5IBB|1|2L, 6XHY|1|2x, 5J4B|1|2x, 4Z8C|1|2x, 4WSD|1|2K, 6CAE|1|2x, 5J4C|1|1x, 4WPO|1|BX, 5W4K|1|1x, 1VY4|1|AX, 6OF1|1|1x, 6XHW|1|1x, 4W2H|1|AX, 7RQ8|1|2x, 5HCR|1|2x, 5HD1|1|1x, 4LNT|1|XV, 5HCP|1|1x, 6OF1|1|2x, 8CVK|1|1x, 5HAU|1|1w, 5J4C|1|2x, 7U2I|1|1x, 4W2I|1|AX, 6XHV|1|1x, 5WIS|1|1x, 5IB7|1|2L, 4W2G|1|CX, 6XQD|1|1x, 6ND5|1|1x, 4LNT|1|QV, 4W2H|1|CX, 5W4K|1|2x, 8EV7|1|2x, 8CVK|1|2x, 7U2H|1|2x, 6XHW|1|2x, 5HAU|1|2w, 6XQD|1|2x, 6XHV|1|2x, 4Y4P|1|1x, 4W2G|1|AX, 6O97|1|1x, 8CVJ|1|1x, 5HCP|1|2x, 5DOY|1|1x, 5WIT|1|1x, 8EV6|1|1x, 5HD1|1|2x, 4W2I|1|CX, 6ND5|1|2x, 8CVJ|1|2x, 8CVL|1|1x, 7RQ9|1|1x, 1VY7|1|AX, 4Z3S|1|1x, 1VY4|1|CX, 4W2F|1|AX, 1VY5|1|AX, 4WPO|1|DX, 4V51|1|CV, 7JQL|1|1x, 7U2I|1|2x, 8CVL|1|2x, 7JQL|1|2x, 4V9R|1|AX, 7RQ9|1|2x, 4V9R|1|CX, 4W2F|1|CX, 5WIS|1|2x, 4V51|1|AV, 6ND6|1|1x, 6O97|1|2x, 4Y4P|1|2x, 1VY6|1|AX, 4Z3S|1|2x, 6UO1|1|2x, 6UO1|1|1x, 1VY6|1|CX, 8EV6|1|2x, 4WQY|1|BX, 5DOY|1|2x, 5WIT|1|2x, 5F8K|1|1x, 7OSM|1|PSIT, 6ND6|1|2x, 1VY5|1|CX, 4V8B|1|AC, 6XQE|1|1x, 4V67|1|AY, 6XQE|1|2x, 4V7L|1|CX, 4V8B|1|CC, 4V7L|1|AX, 5F8K|1|2x, 4V67|1|CY, 4WQY|1|DX, 1VY7|1|CX, 4V8B|1|AD, 4V8B|1|CD, 4V67|1|AZ, 4V67|1|CZ, 6GSJ|1|2L, 6GSJ|1|2K, 8B0X|1|Z, 8FTO|1|Z, 8AYE|1|Z, 7K00|1|Z, 8G6W|1|Z, 8BIL|1|4, 8EMM|1|Y, 8EMM|1|Z, 6XZ7|1|f, 8G6Y|1|Z, 8BIM|1|4, 8BGE|1|4, 8EIU|1|Y, 8EIU|1|Z, 8BF7|1|4, 8BHL|1|4, 7TOP|1|APTN, 8G6X|1|Z, 8BHP|1|4, 7SA4|1|5, 7SA4|1|6, 6XZB|1|f2, 8BH4|1|4, 7UG7|1|Dt, 7KGB|1|y, 7TOO|1|APTN, 7UNW|1|v, 7MT7|1|y, 7MT7|1|x, 8G5Z|1|Pt, 7MT2|1|y, 6XZA|1|f2, 7MSM|1|y, 7MT3|1|y, 8CVM|1|C, 7UNV|1|v, 8EKC|1|x, 7NWT|1|5, 6AZ1|1|3, 8BHJ|1|4, 8BGH|1|4, 7ZAH|1|4, 8CRX|1|C, 7TOR|1|ETRN, 7ST2|1|6, 8AM9|1|Y, 7P7R|1|D, 6Y69|1|w, 7M5D|1|5, 7NHN|1|D, 7TOR|1|PTRN, 7MSC|1|y, 8BUU|1|V, 5AFI|1|v, 5AFI|1|w, 6WDE|1|5, 7ST6|1|6, 6H4N|1|w, 6WD0|1|5, 6WDE|1|6, 6WD0|1|6, 7ST6|1|7, 7UNU|1|v, 8SYL|1|x, 7UNR|1|v, 8B7Y|1|n, 8G61|1|Pt, 7ZAG|1|4, 5WDT|1|v, 5WFS|1|v, 5WDT|1|w, 5WFS|1|w, 6ORE|1|5, 5MDV|1|5, 6ZTP|1|AW, 6ZU1|1|AW, 6ZTO|1|AW, 8BHN|1|4, 7ZAI|1|4, 8AP4|1|Z, 2FMT|1|D, 2FMT|1|C, 7ZHG|1|4, 6YSI|1|8+6YSI|1|6, 5IQR|1|5, 6YS5|1|7, 6YTF|1|7
340NR_3.0_36247.1
Exact match
2OIU|1|Q (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-ray diffraction
  • Release Date: 2007-03-13
2.6 Å71(1) 2OIU|1|Q
341NR_3.0_54171.1
Exact match
Oryctolagus cuniculus
7UCK|1|2 (7UCK)
  • P-site tRNA, mRNA
  • Electron microscopy
  • Release Date: 2022-06-01
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.8 Å71(1) 7UCK|1|2
342NR_3.0_59327.1
Exact match
Streptococcus thermophilus
6M0X|1|B (6M0X)
  • RNA (71-MER), RNA (72-MER)
  • X-ray diffraction
  • Release Date: 2020-09-09
2.6 Å71(3) 6M0X|1|B, 6M0W|1|B, 6M0V|1|B
343NR_3.0_60142.1
Exact match
2OIU|1|P (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-ray diffraction
  • Release Date: 2007-03-13
2.6 Å71(1) 2OIU|1|P
344NR_3.0_63265.1
Exact match
Bacillus subtilis
3LA5|1|A (3LA5)
  • Adenosine RIboswitch
  • X-ray diffraction
  • Release Date: 2010-01-26
  • Standardized name: Purine riboswitch
  • Source: Bacteria
  • Rfam: RF00167
1.7 Å71(1) 3LA5|1|A
345NR_3.0_64798.1
Exact match
Homo sapiens
8OIT|1|AG (8OIT)
  • fMet-tRNAMet (P site), mRNA, P-site Met-[...]
  • Electron microscopy
  • Release Date: 2023-06-14
2.9 Å71(3) 8OIT|1|AG, 6YDP|1|AV, 8OIS|1|AG
346NR_3.0_69516.1
Exact match
Vibrio vulnificus
1Y26|1|X (1Y26)
  • Vibrio vulnificus A-riboswitch
  • X-ray diffraction
  • Release Date: 2004-12-28
  • Standardized name: Purine riboswitch
  • Source: Bacteria
  • Rfam: RF00167
2.1 Å71(1) 1Y26|1|X
347NR_3.0_73445.1
Exact match
Vibrio vulnificus
4LX6|1|A (4LX6)
  • Mutated adenine riboswitch aptamer
  • X-ray diffraction
  • Release Date: 2014-07-16
  • Standardized name: Purine riboswitch
  • Source: Bacteria
  • Rfam: RF00167
2.2 Å71(2) 4LX6|1|A, 4LX5|1|A
348NR_3.0_74174.1
Exact match
unidentified
5KPY|1|A (5KPY)
  • 5-hydroxytryptophan RNA aptamer
  • X-ray diffraction
  • Release Date: 2017-01-11
2.0 Å71(1) 5KPY|1|A
349NR_3.0_79254.1
Exact match
Thermus thermophilus
3KFU|1|L (3KFU)
  • tRNA-Asn
  • X-ray diffraction
  • Release Date: 2010-08-25
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å71(4) 3KFU|1|L, 3KFU|1|K, 3KFU|1|N, 3KFU|1|M
350NR_3.0_90969.1
Exact match
2ZZN|1|D (2ZZN)
  • RNA (71-MER)
  • X-ray diffraction
  • Release Date: 2009-09-15
3.0 Å71(2) 2ZZN|1|D, 2ZZN|1|C
351NR_3.0_91296.1
Exact match
Leishmania donovani
6AZ3|1|6 (6AZ3)
  • srRNA3, rRNA zeta
  • Electron microscopy
  • Release Date: 2017-12-06
2.5 Å71(2) 6AZ3|1|6, 5T2A|1|F
352NR_3.0_94683.1
Exact match
Vibrio vulnificus
4XNR|1|X (4XNR)
  • Vibrio vulnificus Adenine Riboswitch, Vi[...]
  • X-ray diffraction
  • Release Date: 2015-05-06
  • Standardized name: Purine riboswitch
  • Source: Bacteria
  • Rfam: RF00167
2.2 Å71(7) 4XNR|1|X, 4TZY|1|X, 4TZX|1|X, 5UZA|1|X, 6VWV|1|B, 6VWV|1|A, 5SWE|1|X
353NR_3.0_04298.1
Exact match
Geobacillus kaustophilus
6PMO|1|B (6PMO)
  • tRNA-Gly
  • X-ray diffraction
  • Release Date: 2019-11-20
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.7 Å70(1) 6PMO|1|B
354NR_3.0_07733.2
Exact match
Escherichia coli
5IB7|1|3L (5IB7)
  • tRNALys
  • X-ray diffraction
  • Release Date: 2016-05-25
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å70(2) 5IB7|1|3L, 5IB7|1|3K
355NR_3.0_26998.1
Exact match
1KXK|1|A (1KXK)
  • ai5g group II Self-splicing intron
  • X-ray diffraction
  • Release Date: 2002-03-22
3.0 Å70(1) 1KXK|1|A
356NR_3.0_32332.1
Exact match
Thermus thermophilus
5E81|1|3L (5E81)
  • tRNA-Lys
  • X-ray diffraction
  • Release Date: 2016-01-27
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å70(2) 5E81|1|3L, 5E81|1|3K
357NR_3.0_42502.1
Exact match
Escherichia coli
5HR7|1|D (5HR7)
  • tRNA Glu
  • X-ray diffraction
  • Release Date: 2016-04-13
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.4 Å70(2) 5HR7|1|D, 5HR7|1|C
358NR_3.0_65561.1
Exact match
Escherichia coli
6GSJ|1|1K (6GSJ)
  • tRNAThr, RNA (27-MER)
  • X-ray diffraction
  • Release Date: 2018-07-04
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å70(2) 6GSJ|1|1K, 6GSJ|1|1L
359NR_3.0_83618.1
Exact match
Homo sapiens
7QI4|1|Ax (7QI4)
  • P-site tRNA, mRNA, P/P-tRNA, E/E-tRNA
  • Electron microscopy
  • Release Date: 2022-07-13
  • Standardized name: tRNA
  • Source: Mitochondria
  • Rfam: RF00005
2.2 Å70(7) 7QI4|1|Ax, 6ZM6|1|x, 7QI5|1|Ax, 7QI5|1|Ay, 8ANY|1|Ax, 8ANY|1|Ay, 6ZM5|1|x
360NR_3.0_93427.1
Exact match
Methanosarcina mazei
5UD5|1|C (5UD5)
  • RNA (70-MER)
  • X-ray diffraction
  • Release Date: 2017-10-11
  • Standardized name: tRNA
  • Source: Archaea
  • Rfam: RF00005
2.4 Å70(4) 5UD5|1|C, 5UD5|1|D, 5V6X|1|C, 5V6X|1|D
361NR_3.0_06497.1
Exact match
Homo sapiens
8FKW|1|L2 (8FKW)
  • ITS2 rRNA
  • Electron microscopy
  • Release Date: 2023-07-12
2.5 Å69(14) 8FKW|1|L2, 8FKV|1|L2, 8FLD|1|L2, 8FLA|1|L2, 8FKX|1|L2, 8FL6|1|L2, 8FL2|1|L2, 8FKY|1|L2, 8FKQ|1|L2, 8FKU|1|L2, 8FKT|1|L2, 8FKR|1|L2, 8FKP|1|L2, 8FKS|1|L2
362NR_3.0_07720.1
Exact match
Homo sapiens
7QR4|1|B (7QR4)
  • RNA CPEB3 ribozyme
  • X-ray diffraction
  • Release Date: 2022-10-26
2.8 Å69(1) 7QR4|1|B
363NR_3.0_12051.2
Exact match
Polytomella magna
8A22|1|A9 (8A22)
  • mt-5S
  • Electron microscopy
  • Release Date: 2022-11-16
2.9 Å69(1) 8A22|1|A9
364NR_3.0_20039.1
Exact match
Homo sapiens
8G60|1|At (8G60)
  • A-site tRNA, mRNA
  • Electron microscopy
  • Release Date: 2023-04-19
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.5 Å69(2) 8G60|1|At, 8G6J|1|At
365NR_3.0_20115.1
Exact match
Homo sapiens
6RFL|1|U (6RFL)
  • chr17.trna16-GlnTTG
  • Electron microscopy
  • Release Date: 2019-12-11
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.8 Å69(1) 6RFL|1|U
366NR_3.0_24890.3
Exact match
Escherichia coli
6TC3|1|PTR1 (6TC3)
  • P-site Arg-tRNA, mRNA
  • Electron microscopy
  • Release Date: 2020-01-01
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.7 Å69(2) 6TC3|1|PTR1, 6TBV|1|PTR1
367NR_3.0_38681.1
Exact match
Staphylococcus aureus
7ENI|1|B (7ENI)
  • sgRNA (74-MER)
  • X-ray diffraction
  • Release Date: 2022-04-20
2.6 Å69(1) 7ENI|1|B
368NR_3.0_45040.1
Exact match
3EPH|1|E (3EPH)
  • tRNA
  • X-ray diffraction
  • Release Date: 2008-11-04
3.0 Å69(2) 3EPH|1|E, 3EPH|1|F
369NR_3.0_57264.1
Exact match
synthetic construct
7L0Z|1|G (7L0Z)
  • RNA aptamer (69-MER), RNA (69-MER)
  • X-ray diffraction
  • Release Date: 2021-05-26
2.1 Å69(2) 7L0Z|1|G, 5OB3|1|A
370NR_3.0_66984.1
Exact match
Bacillus subtilis
3IVN|1|A (3IVN)
  • A-riboswitch
  • X-ray diffraction
  • Release Date: 2010-01-19
  • Standardized name: Purine riboswitch
  • Source: Bacteria
  • Rfam: RF00167
2.8 Å69(2) 3IVN|1|A, 3IVN|1|B
371NR_3.0_79523.1
Exact match
3FOZ|1|D (3FOZ)
  • tRNA(Phe)
  • X-ray diffraction
  • Release Date: 2009-01-20
2.5 Å69(1) 3FOZ|1|D
372NR_3.0_82055.1
Exact match
Saccharomyces cerevisiae
6ASO|1|I (6ASO)
  • Saccharomyces cerevisiae strain HB_S_GIM[...]
  • X-ray diffraction
  • Release Date: 2018-05-09
  • Standardized name: U6 snRNA
  • Source: Eukarya
  • Rfam: RF00026
2.7 Å69(1) 6ASO|1|I
373NR_3.0_82540.1
Exact match
Pan troglodytes
7QR3|1|C (7QR3)
  • chimpanzee CPEB3 ribozyme
  • X-ray diffraction
  • Release Date: 2022-10-26
2.2 Å69(2) 7QR3|1|C, 7QR3|1|D
374NR_3.0_85174.1
Exact match
Escherichia coli
1QF6|1|B (1QF6)
  • THREONINE TRNA
  • X-ray diffraction
  • Release Date: 1999-05-06
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å69(1) 1QF6|1|B
375NR_3.0_88566.1
Exact match
Escherichia coli
3MOJ|1|A (3MOJ)
  • RNA (69-MER)
  • X-ray diffraction
  • Release Date: 2010-08-04
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.9 Å69(1) 3MOJ|1|A
376NR_3.0_89111.1
Exact match
Escherichia coli
7U2I|1|1w (7U2I)
  • A-site Aminoacyl-tRNA Gly-NH-tRNAgly, MG[...]
  • X-ray diffraction
  • Release Date: 2022-07-13
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.6 Å69(12) 7U2I|1|1w, 7U2J|1|1w, 7U2H|1|1w, 7U2J|1|2w, 7U2I|1|2w, 7U2H|1|2w, 7U2J|1|1y, 7U2H|1|1y, 7U2J|1|2y, 7U2H|1|2y, 7U2I|1|1y, 7U2I|1|2y
377NR_3.0_91806.3
Exact match
Bacillus subtilis subsp. subtilis str. 168
7AQC|1|T (7AQC)
  • Ala-tRNA (P-site)
  • Electron microscopy
  • Release Date: 2020-11-25
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å69(2) 7AQC|1|T, 7AQC|1|P
378NR_3.0_93101.1
Exact match
Potato virus X
6R7G|1|R (6R7G)
  • polyU RNA
  • Electron microscopy
  • Release Date: 2020-03-18
2.2 Å69(1) 6R7G|1|R
379NR_3.0_99134.1
Exact match
Escherichia coli K-12
7N2V|1|Dt (7N2V)
  • tRNA, mRNA
  • Electron microscopy
  • Release Date: 2021-07-14
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.5 Å69(1) 7N2V|1|Dt
380NR_3.0_04000.4
Exact match
Homo sapiens
6ZM6|1|w (6ZM6)
  • A-site tRNA with aminoacylation, mRNA, A[...]
  • Electron microscopy
  • Release Date: 2021-01-13
  • Standardized name: tRNA
  • Source: Mitochondria
  • Rfam: RF00005
2.6 Å68(5) 6ZM6|1|w, 7QI5|1|Aw, 8ANY|1|Aw, 6ZM5|1|w, 7QI6|1|Aw
381NR_3.0_19188.1
Exact match
Homo sapiens
4QEI|1|C (4QEI)
  • tRNA-Gly-CCC-2-2
  • X-ray diffraction
  • Release Date: 2015-05-20
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.9 Å68(1) 4QEI|1|C
382NR_3.0_20951.1
Exact match
Hepacivirus C
6U8D|1|A (6U8D)
  • JIIIabc RNA (68-MER)
  • X-ray diffraction
  • Release Date: 2019-12-04
1.8 Å68(4) 6U8D|1|A, 6U8K|1|B, 6U8K|1|A, 6U8K|1|C
383NR_3.0_23920.1
Exact match
synthetic construct
6P2H|1|A (6P2H)
  • RNA (69-MER)
  • X-ray diffraction
  • Release Date: 2019-10-23
2.8 Å68(1) 6P2H|1|A
384NR_3.0_33278.1
Exact match
Homo sapiens
5LYS|1|B (5LYS)
  • 7SK RNA
  • X-ray diffraction
  • Release Date: 2017-01-25
  • Standardized name: 7SK RNA
  • Source: Eukarya
  • Rfam: RF00100
2.3 Å68(6) 5LYS|1|B, 5LYV|1|B, 5LYS|1|A, 5LYU|1|B, 5LYU|1|A, 5LYV|1|A
385NR_3.0_40252.1
Exact match
2QUS|1|A (2QUS)
  • Hammerhead ribozyme
  • X-ray diffraction
  • Release Date: 2008-07-15
2.4 Å68(2) 2QUS|1|A, 2QUS|1|B
386NR_3.0_56204.1
Exact match
Escherichia coli
6UGG|1|B (6UGG)
  • ASPARTYL TRNA, ASPARTYL-TRNA, tRNAasp
  • X-ray diffraction
  • Release Date: 2020-01-01
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.0 Å68(5) 6UGG|1|B, 6UGG|1|A, 1C0A|1|B, 1EFW|1|D, 1EFW|1|C
387NR_3.0_65615.1
Exact match
Escherichia coli
5HR6|1|C (5HR6)
  • tRNA Glu
  • X-ray diffraction
  • Release Date: 2016-04-13
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å68(2) 5HR6|1|C, 5HR6|1|D
388NR_3.0_70496.1
Exact match
Bacillus subtilis
1Y27|1|X (1Y27)
  • Bacillus subtilis xpt
  • X-ray diffraction
  • Release Date: 2004-12-28
  • Standardized name: Purine riboswitch
  • Source: Bacteria
  • Rfam: RF00167
2.4 Å68(1) 1Y27|1|X
389NR_3.0_72021.1
Exact match
Murray Valley encephalitis virus
4PQV|1|A (4PQV)
  • XRN1-resistant flaviviral RNA
  • X-ray diffraction
  • Release Date: 2014-04-30
  • Standardized name: Flavivirus 3' UTR stem loop IV
  • Source: Viruses
  • Rfam: RF01415
2.5 Å68(1) 4PQV|1|A
390NR_3.0_74971.1
Exact match
Escherichia coli
7E8O|1|X (7E8O)
  • histidine pre-tRNA
  • X-ray diffraction
  • Release Date: 2022-03-02
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.8 Å68(1) 7E8O|1|X
391NR_3.0_24819.3
Exact match
1IL2|1|C (1IL2)
  • T-RNA (75-MER), ASPARTYL TRANSFER RNA, T[...]
  • X-ray diffraction
  • Release Date: 2001-09-28
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.6 Å67(9) 1IL2|1|C, 1IL2|1|D, 2TRA|1|A, 3TRA|1|A, 1ASZ|1|S, 1ASY|1|S, 1ASZ|1|R, 1ASY|1|R, 1VTQ|1|A
392NR_3.0_27778.1
Exact match
Pyrococcus abyssi
5WT1|1|C (5WT1)
  • RNA (76-MER)
  • X-ray diffraction
  • Release Date: 2017-12-13
  • Standardized name: tRNA
  • Source: Archaea
  • Rfam: RF00005
2.6 Å67(2) 5WT1|1|C, 5WT1|1|F
393NR_3.0_33675.3
Exact match
Sus scrofa
6YDP|1|BB (6YDP)
  • CP tRNAPhe
  • Electron microscopy
  • Release Date: 2020-07-15
  • Standardized name: tRNA
  • Source: Mitochondria
  • Rfam: RF00005
3.0 Å67(1) 6YDP|1|BB
394NR_3.0_49839.1
Exact match
Candida tropicalis MYA-3404
6ZDP|1|B (6ZDP)
  • Chains: B
  • X-ray diffraction
  • Release Date: 2021-04-28
2.9 Å67(1) 6ZDP|1|B
395NR_3.0_61479.1
Exact match
Thermus thermophilus
5IBB|1|1L (5IBB)
  • tRNAVal, mRNA
  • X-ray diffraction
  • Release Date: 2016-05-25
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å67(1) 5IBB|1|1L
396NR_3.0_69813.10
Exact match
Escherichia coli
7EQJ|1|B (7EQJ)
  • tRNAVal, mRNA, A-site and E-site tRNAs, [...]
  • X-ray diffraction
  • Release Date: 2022-01-19
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.0 Å67(23) 7EQJ|1|B, 7EQJ|1|A, 6OF1|1|1w, 5IBB|1|1K, 6CAE|1|1y, 6O97|1|1w, 6OF1|1|1y, 6OF1|1|2w, 6ND6|1|1y, 6O97|1|1y, 5IBB|1|3L, 6CAE|1|1w, 6OF1|1|2y, 6CAE|1|2y, 6ND6|1|1w, 6CAE|1|2w, 6O97|1|2y, 5IBB|1|3K, 6ND6|1|2y, 6O97|1|2w, 6ND6|1|2w, 7K00|1|Y, 7B5K|1|9
397NR_3.0_74214.1
Exact match
Escherichia coli
7P7T|1|C (7P7T)
  • A-site tRNA, mRNA
  • Electron microscopy
  • Release Date: 2022-02-23
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å67(1) 7P7T|1|C
398NR_3.0_76009.1
Exact match
Homo sapiens
7V9E|1|A (7V9E)
  • RNA (68-MER)
  • X-ray diffraction
  • Release Date: 2022-03-23
2.3 Å67(1) 7V9E|1|A
399NR_3.0_76114.1
Exact match
3RKF|1|C (3RKF)
  • Guanine riboswitch
  • X-ray diffraction
  • Release Date: 2011-08-17
2.5 Å67(4) 3RKF|1|C, 3RKF|1|B, 3RKF|1|A, 3RKF|1|D
400NR_3.0_76703.9
Exact match
Escherichia coli
5E81|1|1K (5E81)
  • tRNA-Lys, mRNA, tRNALys, tRNA, Chains: P[...]
  • X-ray diffraction
  • Release Date: 2016-01-27
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å67(14) 5E81|1|1K, 5IB7|1|1K, 5E81|1|1L, 5IB7|1|1L, 8BF7|1|5, 7N1P|1|Pt, 7N2U|1|Pt, 8BH4|1|5, 7N30|1|Pt, 7N31|1|Pt, 7N2C|1|Pt, 8BHJ|1|5, 7ZTA|1|PTR1, 8BHN|1|5
401NR_3.0_19951.67
Exact match
Escherichia coli
4YCO|1|D (4YCO)
  • A-site tRNA, mRNA, E-site tRNA, tRNA(Phe[...]
  • X-ray diffraction
  • Release Date: 2015-04-22
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.1 Å66(179) 4YCO|1|D, 4YCO|1|E, 4YCO|1|F, 3FOZ|1|C, 4WOI|1|DW, 5NDK|1|X1, 4V9H|1|AV, 3L0U|1|A, 2ZM5|1|C, 5NDK|1|X4, 4V9D|1|BV, 2ZXU|1|C, 4WQU|1|BW, 4W2E|1|w, 4WQF|1|BW, 5J4B|1|1y, 6CFJ|1|1w, 7RQ8|1|1y, 5W4K|1|1y, 6XHY|1|1w, 5WIT|1|1w, 6CFJ|1|1y, 6CFJ|1|2w, 8EV7|1|1y, 5J4C|1|1w, 5WIS|1|1y, 5J4C|1|1y, 4WQU|1|DW, 8EV7|1|1w, 6XHW|1|1w, 8CVK|1|1w, 6CFJ|1|2y, 5WIS|1|1w, 5J4B|1|1w, 6XHV|1|1w, 5NDK|1|W1, 6XHY|1|2w, 5J4C|1|2w, 4V51|1|AW, 4WQF|1|DW, 5J4B|1|2w, 7RQ9|1|1y, 5J4B|1|2y, 5J4C|1|2y, 5W4K|1|1w, 7RQ8|1|2y, 5NDK|1|W4, 8CVJ|1|1w, 6ND5|1|1y, 4WOI|1|AX, 4W2G|1|AW, 6XHW|1|2w, 5WIS|1|2y, 5WIT|1|2w, 8EV6|1|1y, 6XHV|1|2w, 8CVK|1|2w, 5DOY|1|1y, 5W4K|1|2y, 2ZM5|1|D, 8CVL|1|1w, 7RQ9|1|2y, 8EV7|1|2w, 4Y4P|1|1y, 4V9D|1|AV, 7RQ9|1|1w, 4Z3S|1|1y, 4WSD|1|1K, 7RQ8|1|1w, 5DOY|1|1w, 8CVJ|1|2w, 8EV7|1|2y, 5DOY|1|2y, 4V51|1|CW, 6ND5|1|1w, 4W2I|1|AW, 8CVL|1|2w, 4WSD|1|3L, 4W2I|1|CW, 4Z3S|1|2y, 4Z3S|1|1w, 5W4K|1|2w, 1VY4|1|AW, 6ND5|1|2y, 4WPO|1|BY, 4Y4P|1|2y, 8EV6|1|2y, 7RQ9|1|2w, 8EV6|1|1w, 4W2G|1|CW, 6UO1|1|2y, 6UO1|1|2w, 4WSD|1|3K, 4W2I|1|AY, 4W2F|1|AW, 4Y4P|1|1w, 4Z3S|1|2w, 6UO1|1|1y, 4W2I|1|CY, 1VY4|1|AY, 4WPO|1|DY, 4W2G|1|AY, 6XHY|1|1y, 6UO1|1|1w, 5WIS|1|2w, 2ZXU|1|D, 7RQ8|1|2w, 5NDK|1|V4, 4W2G|1|CY, 8EV6|1|2w, 5WIT|1|1y, 6ND5|1|2w, 4W2F|1|AY, 4Y4P|1|2w, 1VY7|1|AY, 5DOY|1|2w, 1VY5|1|AW, 1VY4|1|CY, 5WIT|1|2y, 4WSD|1|1L, 5NDK|1|V1, 4W2F|1|CW, 6XHV|1|1y, 6XHY|1|2y, 4W2F|1|CY, 6XHW|1|1y, 4WPO|1|BW, 1VY7|1|CY, 8CVJ|1|1y, 1VY5|1|AY, 6XHW|1|2y, 1VY4|1|CW, 8CVJ|1|2y, 6XHV|1|2y, 8CVK|1|1y, 8CVK|1|2y, 1VY5|1|CW, 8CVL|1|1y, 1VY5|1|CY, 8CVL|1|2y, 4WPO|1|DW, 4W2H|1|AY, 4WQU|1|BY, 4W2H|1|CY, 4W2E|1|x, 4WQU|1|DY, 4WQF|1|BY, 4WQF|1|DY, 8G6W|1|Y, 8AKN|1|X, 7S1K|1|A, 7S1I|1|A, 7S1G|1|A, 7N1P|1|Dt, 8G6X|1|Y, 8G6Y|1|Y, 7N2U|1|Dt, 6YSS|1|w, 7UG7|1|Pt, 6AZ1|1|2, 8G5Z|1|At, 6AZ1|1|4, 7N30|1|Dt, 7N31|1|Dt, 7N2C|1|Dt, 8EKC|1|w, 6WDE|1|7, 8G61|1|At, 8SYL|1|w, 5AFI|1|y, 8SYL|1|y, 5WDT|1|y, 5WFS|1|y, 7Q4K|1|D3, 6ZTO|1|AX, 6ZTP|1|AX, 6ZU1|1|AX, 5IQR|1|4, 5IQR|1|6
402NR_3.0_21705.1
Exact match
3SKI|1|A (3SKI)
  • RNA (68-MER)
  • X-ray diffraction
  • Release Date: 2011-08-17
2.3 Å66(8) 3SKI|1|A, 3SKI|1|B, 3SLM|1|B, 3SKZ|1|A, 3SLM|1|A, 3SLQ|1|A, 3SKZ|1|B, 3SLQ|1|B
403NR_3.0_31982.1
Exact match
Homo sapiens
7ONU|1|T (7ONU)
  • Mitochondrial Precursor tRNA-Tyr
  • Electron microscopy
  • Release Date: 2021-08-11
  • Standardized name: tRNA
  • Source: Mitochondria
  • Rfam: RF00005
3.0 Å66(1) 7ONU|1|T
404NR_3.0_34221.1
Exact match
Escherichia coli
1B23|1|R (1B23)
  • CYSTEINYL TRNA
  • X-ray diffraction
  • Release Date: 1998-12-07
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.6 Å66(1) 1B23|1|R
405NR_3.0_41935.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7MKY|1|A (7MKY)
  • RNA (66-MER)
  • X-ray diffraction
  • Release Date: 2021-05-26
1.3 Å66(2) 7MKY|1|A, 7LYJ|1|A
406NR_3.0_74880.3
Exact match
Saccharomyces cerevisiae
6TB3|1|n (6TB3)
  • tRNA, mRNA
  • Electron microscopy
  • Release Date: 2020-04-22
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.8 Å66(1) 6TB3|1|n
407NR_3.0_80237.1
Exact match
synthetic construct
7SZU|1|R (7SZU)
  • RNA aptamer
  • X-ray diffraction
  • Release Date: 2022-07-06
2.2 Å66(2) 7SZU|1|R, 7U0Y|1|R
408NR_3.0_03921.1
Exact match
Candida albicans SC5314
6ZDQ|1|C (6ZDQ)
  • RNA
  • X-ray diffraction
  • Release Date: 2021-04-28
3.0 Å65(1) 6ZDQ|1|C
409NR_3.0_26284.1
Exact match
Thermus thermophilus
1H4S|1|T (1H4S)
  • TRNAPRO(CGG)
  • X-ray diffraction
  • Release Date: 2001-06-18
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å65(2) 1H4S|1|T, 1H4Q|1|T
410NR_3.0_30439.1
Exact match
3EGZ|1|B (3EGZ)
  • Tetracycline aptamer and artificial ribo[...]
  • X-ray diffraction
  • Release Date: 2008-10-28
2.2 Å65(1) 3EGZ|1|B
411NR_3.0_56345.1
Exact match
Vibrio vulnificus
5SWD|1|B (5SWD)
  • Vibrio vulnificus strain 93U204 chromoso[...]
  • X-ray diffraction
  • Release Date: 2016-11-23
  • Standardized name: Purine riboswitch
  • Source: Bacteria
  • Rfam: RF00167
2.5 Å65(4) 5SWD|1|B, 5E54|1|B, 5E54|1|A, 5SWD|1|A
412NR_3.0_60469.1
Exact match
4N0T|1|B (4N0T)
  • U6 snRNA
  • X-ray diffraction
  • Release Date: 2014-05-14
1.7 Å65(3) 4N0T|1|B, 5TF6|1|B, 5TF6|1|D
413NR_3.0_80074.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7MLX|1|R (7MLX)
  • RNA (65-MER)
  • X-ray diffraction
  • Release Date: 2021-08-11
2.1 Å65(1) 7MLX|1|R
414NR_3.0_89429.5
Exact match
4FEN|1|B (4FEN)
  • 65-MER, Guanine riboswitch, 67-MER, Guan[...]
  • X-ray diffraction
  • Release Date: 2013-02-27
1.4 Å65(30) 4FEN|1|B, 4FEO|1|B, 4FEL|1|B, 4FEP|1|B, 4FEJ|1|B, 4FE5|1|B, 2XNZ|1|A, 2XNW|1|A, 6UBU|1|B, 6UC7|1|B, 3GOT|1|A, 6UC9|1|B, 6UC8|1|B, 2G9C|1|A, 3GAO|1|A, 3GER|1|A, 2EES|1|A, 3GOG|1|A, 3DS7|1|A, 2EET|1|A, 3FO4|1|A, 2EEV|1|A, 3DS7|1|B, 3FO6|1|A, 3G4M|1|A, 3GES|1|A, 2B57|1|A, 2EEW|1|A, 2EEU|1|A, 2XO1|1|A
415NR_3.0_10909.1
Exact match
Homo sapiens
6XA1|1|Bv (6XA1)
  • P-tRNA, mRNA
  • Electron microscopy
  • Release Date: 2020-10-07
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.8 Å64(1) 6XA1|1|Bv
416NR_3.0_36843.2
Exact match
Oryctolagus cuniculus
6SGC|1|23 (6SGC)
  • tRNA (Lys3), polyA mRNA
  • Electron microscopy
  • Release Date: 2019-12-04
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.8 Å64(2) 6SGC|1|23, 6SGC|1|33
417NR_3.0_46777.1
Exact match
Saccharomyces cerevisiae
1YFG|1|A (1YFG)
  • YEAST INITIATOR TRNA
  • X-ray diffraction
  • Release Date: 1997-09-03
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
3.0 Å64(1) 1YFG|1|A
418NR_3.0_47330.1
Exact match
3SKL|1|B (3SKL)
  • RNA (66-MER)
  • X-ray diffraction
  • Release Date: 2011-08-17
2.9 Å64(4) 3SKL|1|B, 3SKL|1|A, 3SKW|1|A, 3SKW|1|B
419NR_3.0_48352.1
Exact match
Schaalia odontolytica
4XWF|1|A (4XWF)
  • pfl RNA
  • X-ray diffraction
  • Release Date: 2015-09-09
  • Standardized name: ZMP/ZTP riboswitch
  • Source: Bacteria
  • Rfam: RF01750
1.8 Å64(2) 4XWF|1|A, 4XW7|1|A
420NR_3.0_54715.1
Exact match
Escherichia coli
7Q4K|1|D2 (7Q4K)
  • Met-tRNA (P site), MsrDL mRNA
  • Electron microscopy
  • Release Date: 2022-11-16
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å64(1) 7Q4K|1|D2
421NR_3.0_55424.1
Exact match
Homo sapiens
3NKB|1|B (3NKB)
  • The hepatitis delta virus ribozyme
  • X-ray diffraction
  • Release Date: 2010-09-01
1.9 Å64(1) 3NKB|1|B
422NR_3.0_83181.1
Exact match
2DLC|1|Y (2DLC)
  • T-RNA (76-MER)
  • X-ray diffraction
  • Release Date: 2007-06-12
2.4 Å64(1) 2DLC|1|Y
423NR_3.0_37691.1
Exact match
synthetic construct
8FCJ|1|M (8FCJ)
  • RNA
  • Electron microscopy
  • Release Date: 2023-08-09
2.8 Å63(1) 8FCJ|1|M
424NR_3.0_55114.1
Exact match
Geobacillus stearothermophilus
5B63|1|D (5B63)
  • tRNA-Arg, TRNA
  • X-ray diffraction
  • Release Date: 2017-05-31
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
3.0 Å63(4) 5B63|1|D, 5B63|1|B, 5YYN|1|D, 5YYN|1|B
425NR_3.0_59690.1
Exact match
1F7U|1|B (1F7U)
  • TRNA(ARG)
  • X-ray diffraction
  • Release Date: 2001-06-27
2.2 Å63(2) 1F7U|1|B, 1F7V|1|B
426NR_3.0_03470.1
Exact match
Thermus thermophilus
1SER|1|T (1SER)
  • TRNASER
  • X-ray diffraction
  • Release Date: 1994-04-30
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å62(1) 1SER|1|T
427NR_3.0_11024.1
Exact match
Escherichia coli K-12
7ZTA|1|ATR1 (7ZTA)
  • tRNA-Cys, mRNA
  • Electron microscopy
  • Release Date: 2023-04-12
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.7 Å62(1) 7ZTA|1|ATR1
428NR_3.0_51962.3
Exact match
Escherichia coli
4YCP|1|B (4YCP)
  • tRNATrp
  • X-ray diffraction
  • Release Date: 2015-04-22
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.6 Å62(1) 4YCP|1|B
429NR_3.0_72776.1
Exact match
synthetic construct
5BTP|1|B (5BTP)
  • RNA (62-MER)
  • X-ray diffraction
  • Release Date: 2015-08-12
2.8 Å62(2) 5BTP|1|B, 5BTP|1|A
430NR_3.0_83593.3
Exact match
Saccharomyces cerevisiae
5AXM|1|P (5AXM)
  • TRANSFER RNA (PHE), PHENYLALANINE TRANSF[...]
  • X-ray diffraction
  • Release Date: 2016-08-03
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.2 Å62(18) 5AXM|1|P, 1EVV|1|A, 5AXN|1|P, 6LVR|1|D, 6LVR|1|B, 4TNA|1|A, 1EHZ|1|A, 6XZ7|1|g, 1I9V|1|A, 6XZB|1|g2, 1TN1|1|A, 1TN2|1|A, 1TTT|1|F, 4TRA|1|A, 6TNA|1|A, 1TTT|1|D, 1TTT|1|E, 1TRA|1|A
431NR_3.0_00196.1
Exact match
Sulfurisphaera tokodaii
7VNV|1|A (7VNV)
  • RNA (78-MER)
  • X-ray diffraction
  • Release Date: 2022-05-04
  • Standardized name: tRNA
  • Source: Archaea
  • Rfam: RF00005
1.9 Å61(4) 7VNV|1|A, 7VNV|1|B, 7VNW|1|A, 7VNW|1|B
432NR_3.0_03414.1
Exact match
Leishmania donovani
3JCS|1|6 (3JCS)
  • 26S zeta ribosomal RNA
  • Electron microscopy
  • Release Date: 2016-07-20
2.8 Å61(1) 3JCS|1|6
433NR_3.0_39792.1
Exact match
Escherichia coli
4U7U|1|L (4U7U)
  • crRNA
  • X-ray diffraction
  • Release Date: 2014-08-27
3.0 Å61(2) 4U7U|1|L, 4U7U|1|X
434NR_3.0_46720.2
Exact match
Synechococcus elongatus
5DDP|1|A (5DDP)
  • RNA (61-MER), L-glutamine riboswitch RNA[...]
  • X-ray diffraction
  • Release Date: 2015-12-23
  • Standardized name: glnA
  • Source: Bacteria
  • Rfam: RF01739
2.3 Å61(4) 5DDP|1|A, 5DDP|1|B, 5DDR|1|B, 5DDR|1|A
435NR_3.0_57362.1
New id, no parents
Saccharomyces cerevisiae
8EVT|1|EC (8EVT)
  • TSV IRES
  • Electron microscopy
  • Release Date: 2023-09-06
2.2 Å61(1) 8EVT|1|EC
436NR_3.0_99751.1
Exact match
2HVY|1|E (2HVY)
  • H/ACA RNA
  • X-ray diffraction
  • Release Date: 2006-09-12
2.3 Å61(1) 2HVY|1|E
437NR_3.0_22108.1
Exact match
Bos taurus
7O7Y|1|AT (7O7Y)
  • P-site Phe-tRNA(Phe), mRNA containing SA[...]
  • Electron microscopy
  • Release Date: 2021-06-02
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.2 Å60(2) 7O7Y|1|AT, 7O7Z|1|AT
438NR_3.0_22486.1
Exact match
Streptococcus sp.
8GXB|1|B (8GXB)
  • NAD+ II riboswitch, 61-mer RNA
  • X-ray diffraction
  • Release Date: 2023-01-18
2.2 Å60(2) 8GXB|1|B, 8GXC|1|B
439NR_3.0_23049.1
Exact match
Thermus thermophilus
1KUQ|1|B (1KUQ)
  • RRNA FRAGMENT, 16S RIBOSOMAL RNA FRAGMEN[...]
  • X-ray diffraction
  • Release Date: 2003-06-24
2.8 Å60(3) 1KUQ|1|B, 1F7Y|1|B, 1DK1|1|B
440NR_3.0_24274.1
Exact match
Streptococcus sp.
8GXB|1|A (8GXB)
  • NAD+ II riboswitch, 61-mer RNA
  • X-ray diffraction
  • Release Date: 2023-01-18
2.2 Å60(2) 8GXB|1|A, 8GXC|1|A
441NR_3.0_34126.1
Exact match
3HAX|1|E (3HAX)
  • H/ACA RNA, 5'-R(*AP*UP*AP*AP*UP*UP*(FHU)[...]
  • X-ray diffraction
  • Release Date: 2009-06-23
2.1 Å60(1) 3HAX|1|E
442NR_3.0_51220.1
Exact match
Homo sapiens
7DVQ|1|F+7DVQ|1|H (7DVQ)
  • U6atac snRNA, U12 snRNA, pre-mRNA
  • Electron microscopy
  • Release Date: 2021-03-31
  • Standardized name: U6atac snRNA + U12 minor spliceosomal RNA
  • Source: Eukarya
  • Rfam: RF00619 + RF00007
2.9 Å60(1) 7DVQ|1|F+7DVQ|1|H
443NR_3.0_56916.1
Exact match
Escherichia coli K-12
7ZTA|1|ETR1 (7ZTA)
  • tRNA-Gln, mRNA
  • Electron microscopy
  • Release Date: 2023-04-12
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.7 Å60(1) 7ZTA|1|ETR1
444NR_3.0_59317.1
Exact match
synthetic construct
6DB9|1|R (6DB9)
  • RNA (60-MER)
  • X-ray diffraction
  • Release Date: 2018-11-14
2.0 Å60(2) 6DB9|1|R, 6DB8|1|R
445NR_3.0_68144.1
Exact match
Geobacillus kaustophilus
6PMO|1|A (6PMO)
  • T-box riboswitch discriminator
  • X-ray diffraction
  • Release Date: 2019-11-20
2.7 Å60(1) 6PMO|1|A
446NR_3.0_70313.2
Exact match
Escherichia coli
5H9F|1|L (5H9F)
  • crRNA (61-MER)
  • X-ray diffraction
  • Release Date: 2016-02-17
2.5 Å60(1) 5H9F|1|L
447NR_3.0_70662.1
Exact match
Vibrio cholerae
6PIJ|1|1 (6PIJ)
  • guide RNA, RNA (61-MER)
  • Electron microscopy
  • Release Date: 2019-10-02
2.9 Å60(2) 6PIJ|1|1, 6V9Q|1|K
448NR_3.0_70886.1
Exact match
Pseudomonas aeruginosa
7XG0|1|I (7XG0)
  • crRNA
  • Electron microscopy
  • Release Date: 2023-08-09
2.6 Å60(3) 7XG0|1|I, 7XG2|1|I, 7XG3|1|I
449NR_3.0_74932.1
Exact match
Pseudomonas aeruginosa
6B44|1|M (6B44)
  • Pseudomonas aeruginosa strain SMC4485 CR[...]
  • Electron microscopy
  • Release Date: 2017-10-18
2.9 Å60(1) 6B44|1|M
450NR_3.0_76909.1
Exact match
3RW6|1|H (3RW6)
  • constitutive transport element(CTE)of Ma[...]
  • X-ray diffraction
  • Release Date: 2011-08-10
2.3 Å60(2) 3RW6|1|H, 3RW6|1|F
451NR_3.0_94467.7
Exact match
Pseudomonas aeruginosa
6VQV|1|L (6VQV)
  • CrRNA (60-MER), RNA (60-MER), RNA (61-ME[...]
  • Electron microscopy
  • Release Date: 2020-03-11
2.6 Å60(8) 6VQV|1|L, 7TAW|1|M, 7TAW|1|m, 7TAX|1|M, 7ELN|1|J, 7ELN|1|T, 7ELM|1|T, 7ELM|1|J
452NR_3.0_48748.1
Exact match
metagenome
5T5A|1|A (5T5A)
  • DNA/RNA (71-MER)
  • X-ray diffraction
  • Release Date: 2017-03-08
2.0 Å59(1) 5T5A|1|A
453NR_3.0_52315.1
Exact match
4M4O|1|B (4M4O)
  • RNA (59-MER)
  • X-ray diffraction
  • Release Date: 2013-12-18
2.0 Å59(1) 4M4O|1|B
454NR_3.0_72196.1
Exact match
Bacillus halodurans C-125
7KKV|1|B (7KKV)
  • OLE* RNA
  • X-ray diffraction
  • Release Date: 2021-03-03
2.0 Å59(4) 7KKV|1|B, 7K9D|1|B, 7K9E|1|B, 7K9E|1|D
455NR_3.0_39651.1
Exact match
3HJW|1|D (3HJW)
  • RNA (58-MER), 5'-R(*GP*AP*GP*CP*GP*(FHU)[...]
  • X-ray diffraction
  • Release Date: 2009-06-23
2.4 Å58(6) 3HJW|1|D, 3LWV|1|D, 3LWR|1|D, 3LWP|1|D, 3LWO|1|D, 3LWQ|1|D
456NR_3.0_46025.2
Exact match
Escherichia coli
7XJG|1|H (7XJG)
  • RNA (81-MER), RNA (14-MER)
  • Electron microscopy
  • Release Date: 2022-09-14
2.5 Å58(4) 7XJG|1|H, 7XJG|1|E, 7V9X|1|H, 7V9X|1|E
457NR_3.0_49161.1
Exact match
Aeropyrum pernix
6XJQ|1|A (6XJQ)
  • Self-alkylating ribozyme (58-MER)
  • X-ray diffraction
  • Release Date: 2022-01-19
1.7 Å58(8) 6XJQ|1|A, 6XJW|1|A, 6XJQ|1|B, 6XJW|1|B, 6XJY|1|A, 6XJZ|1|B, 6XJZ|1|A, 6XJY|1|B
458NR_3.0_60807.1
Exact match
Saccharomyces cerevisiae BY4741
7UQB|1|6 (7UQB)
  • ITS2 rRNA
  • Electron microscopy
  • Release Date: 2023-03-15
2.4 Å58(2) 7UQB|1|6, 7UQZ|1|6
459NR_3.0_74849.1
Exact match
1MMS|1|C (1MMS)
  • 23S RIBOSOMAL RNA
  • X-ray diffraction
  • Release Date: 2000-04-17
2.6 Å58(2) 1MMS|1|C, 1MMS|1|D
460NR_3.0_00559.1
Exact match
Acidobacterium capsulatum ATCC 51196
7D7V|1|A (7D7V)
  • 17delU1A (58-MER)
  • X-ray diffraction
  • Release Date: 2020-11-25
  • Standardized name: nadA RNA
  • Source: Bacteria
  • Rfam: RF03013
2.8 Å57(1) 7D7V|1|A
461NR_3.0_25376.1
Exact match
Escherichia coli
6PRV|1|A (6PRV)
  • 58 NUCLEOTIDE RIBOSOMAL 23S RNA DOMAIN, [...]
  • X-ray diffraction
  • Release Date: 2020-01-08
  • Standardized name: LSU rRNA
  • Source: Bacteria
  • Rfam: RF02541
2.7 Å57(10) 6PRV|1|A, 6PRV|1|B, 6PRV|1|C, 6PRV|1|D, 1HC8|1|C, 1HC8|1|D, 1Y39|1|C, 1Y39|1|D, 1QA6|1|C, 1QA6|1|D
462NR_3.0_36634.1
Exact match
2QUW|1|B (2QUW)
  • Hammerhead ribozyme, cleaved fragment
  • X-ray diffraction
  • Release Date: 2008-07-15
2.2 Å57(2) 2QUW|1|B, 2QUW|1|D
463NR_3.0_06844.1
Exact match
Thermoclostridium caenicola
8EWG|1|B (8EWG)
  • RNA (56-MER)
  • Electron microscopy
  • Release Date: 2023-08-30
2.9 Å56(1) 8EWG|1|B
464NR_3.0_26186.1
Exact match
4JRC|1|B (4JRC)
  • Distal Stem I region of the glyQS T box [...]
  • X-ray diffraction
  • Release Date: 2013-04-24
2.7 Å56(2) 4JRC|1|B, 4JRC|1|A
465NR_3.0_57826.1
Exact match
Homo sapiens
7QH7|1|B (7QH7)
  • mitochondrial tRNAVal
  • Electron microscopy
  • Release Date: 2022-05-18
2.9 Å56(1) 7QH7|1|B
466NR_3.0_73108.1
Exact match
synthetic construct
7VTN|1|B (7VTN)
  • crRNA, target RNA
  • Electron microscopy
  • Release Date: 2022-09-07
3.0 Å56(1) 7VTN|1|B
467NR_3.0_73428.21
Exact match
Homo sapiens
7QI4|1|B (7QI4)
  • tRNAval, mitochondrial tRNAVal, MT-TRNAV[...]
  • Electron microscopy
  • Release Date: 2022-07-13
2.2 Å56(19) 7QI4|1|B, 6ZM6|1|B, 7PO4|1|B, 7QI5|1|B, 6ZM5|1|B, 7ODR|1|B, 8ANY|1|B, 8OIT|1|B9, 7OF0|1|B, 7QI6|1|B, 7O9M|1|B, 7OF7|1|B, 7OF6|1|B, 7OF4|1|B, 7OF3|1|B, 7OF2|1|B, 7OF5|1|B, 6VMI|1|B, 6VLZ|1|B
468NR_3.0_75133.1
Exact match
6DN2|1|Y+6DN2|1|X (6DN2)
  • FMN riboswitch, RNA (56-MER), RNA (54-ME[...]
  • X-ray diffraction
  • Release Date: 2018-09-05
2.9 Å56(4) 6DN2|1|Y+6DN2|1|X, 6DN3|1|Y+6DN3|1|X, 3F4H|1|Y+3F4H|1|X, 6BFB|1|Y+6BFB|1|X
469NR_3.0_85919.1
Exact match
Schizosaccharomyces pombe
8EUY|1|6 (8EUY)
  • RNA (93-MER)
  • Electron microscopy
  • Release Date: 2022-11-30
3.0 Å56(1) 8EUY|1|6
470NR_3.0_19502.2
Exact match
synthetic construct
4RGE|1|C (4RGE)
  • env22 twister ribozyme, RNA (54-MER)
  • X-ray diffraction
  • Release Date: 2014-12-03
2.9 Å55(4) 4RGE|1|C, 4RGE|1|B, 4RGE|1|A, 5DUN|1|A
471NR_3.0_26582.1
Exact match
4K27|1|U (4K27)
  • Myotonic Dystrophy Type 2 RNA
  • X-ray diffraction
  • Release Date: 2013-11-27
2.4 Å55(1) 4K27|1|U
472NR_3.0_36913.1
Exact match
Streptococcus parasanguinis
8HBA|1|B (8HBA)
  • RNA (55-MER)
  • X-ray diffraction
  • Release Date: 2023-03-22
2.6 Å55(3) 8HBA|1|B, 8HBA|1|A, 8HB8|1|A
473NR_3.0_46884.1
Exact match
1MZP|1|B (1MZP)
  • fragment of 23S rRNA
  • X-ray diffraction
  • Release Date: 2003-01-21
2.7 Å55(1) 1MZP|1|B
474NR_3.0_47836.1
Exact match
Bifidobacterium angulatum
6LAX|1|A (6LAX)
  • RNA (55-MER)
  • X-ray diffraction
  • Release Date: 2020-01-01
2.7 Å55(6) 6LAX|1|A, 6LAZ|1|A, 6LAS|1|A, 6LAZ|1|B, 6LAX|1|B, 6LAS|1|B
475NR_3.0_55702.1
Exact match
1C9S|1|W (1C9S)
  • SINGLE STRANDED RNA (55-MER)
  • X-ray diffraction
  • Release Date: 1999-09-15
1.9 Å55(1) 1C9S|1|W
476NR_3.0_24202.1
Exact match
Homo sapiens
4PKD|1|V (4PKD)
  • U1 snRNA stem-loops 1 and 2 (55-MER)
  • X-ray diffraction
  • Release Date: 2014-12-31
2.5 Å54(1) 4PKD|1|V
477NR_3.0_18889.3
Exact match
Fusobacterium nucleatum
5C45|1|X+5C45|1|Y (5C45)
  • FMN RIBOSWITCH
  • X-ray diffraction
  • Release Date: 2015-10-07
2.9 Å53(3) 5C45|1|X+5C45|1|Y, 5KX9|1|X+5KX9|1|Y, 2YIE|1|X+2YIE|1|Z
478NR_3.0_79184.1
Exact match
4GCW|1|B (4GCW)
  • TRNA(THR)
  • X-ray diffraction
  • Release Date: 2012-10-31
3.0 Å53(2) 4GCW|1|B, 2FK6|1|R
479NR_3.0_79951.1
Exact match
4OJI|1|A (4OJI)
  • RNA (52-MER)
  • X-ray diffraction
  • Release Date: 2014-07-23
2.3 Å53(1) 4OJI|1|A
480NR_3.0_04979.1
Exact match
Bergeyella zoohelcum
6AAY|1|B (6AAY)
  • RNA (52-MER)
  • X-ray diffraction
  • Release Date: 2019-03-13
2.8 Å52(1) 6AAY|1|B
481NR_3.0_31462.1
Exact match
Listeria seeligeri
6VRB|1|B (6VRB)
  • RNA (52-MER)
  • Electron microscopy
  • Release Date: 2020-06-10
3.0 Å52(1) 6VRB|1|B
482NR_3.0_58167.1
Exact match
3E5C|1|A (3E5C)
  • SMK box (SAM-III) Riboswitch, SMK box (S[...]
  • X-ray diffraction
  • Release Date: 2008-10-07
2.3 Å52(3) 3E5C|1|A, 3E5F|1|A, 3E5E|1|A
483NR_3.0_80360.2
Exact match
Candidatus Koribacter versatilis
6TFF|1|A (6TFF)
  • RNA, Chains: A
  • X-ray diffraction
  • Release Date: 2020-09-23
  • Standardized name: nadA RNA
  • Source: Bacteria
  • Rfam: RF03013
2.5 Å52(9) 6TFF|1|A, 6TFG|1|A, 6TF1|1|A, 6TF3|1|A, 6TF2|1|A, 6TB7|1|A, 6TF0|1|A, 6TFH|1|A, 6TFE|1|A
484NR_3.0_82984.1
Exact match
Thermotoga petrophila
4ENC|1|A (4ENC)
  • Fluoride riboswitch
  • X-ray diffraction
  • Release Date: 2012-05-09
  • Standardized name: Fluoride riboswitch
  • Source: Bacteria
  • Rfam: RF01734
2.3 Å52(5) 4ENC|1|A, 4ENB|1|A, 3VRS|1|A, 4ENA|1|A, 4EN5|1|A
485NR_3.0_83080.1
Exact match
2QWY|1|C (2QWY)
  • SAM-II riboswitch
  • X-ray diffraction
  • Release Date: 2008-01-22
2.8 Å52(3) 2QWY|1|C, 2QWY|1|A, 2QWY|1|B
486NR_3.0_07795.1
Exact match
synthetic construct
7D7W|1|A (7D7W)
  • 18GAAA (52-MER), 18GAAA(52-MER)
  • X-ray diffraction
  • Release Date: 2020-11-25
2.4 Å51(4) 7D7W|1|A, 7D7Z|1|A, 7D7X|1|A, 7D7Y|1|A
487NR_3.0_25308.1
Exact match
uncultured virus
8DC2|1|B (8DC2)
  • RNA (51-MER)
  • Electron microscopy
  • Release Date: 2022-12-14
3.0 Å51(1) 8DC2|1|B
488NR_3.0_65403.1
Exact match
uncultured Ruminococcus sp.
6IV9|1|B (6IV9)
  • RNA (51-MER), RNA (53-MER), crRNA (50-ME[...]
  • X-ray diffraction
  • Release Date: 2019-06-19
1.9 Å51(3) 6IV9|1|B, 6IV8|1|B, 6IV8|1|D
489NR_3.0_84656.1
Exact match
synthetic construct
7OAX|1|A (7OAX)
  • Chili RNA Aptamer
  • X-ray diffraction
  • Release Date: 2021-06-16
2.2 Å51(14) 7OAX|1|A, 7OAX|1|D, 7OAX|1|C, 7OAX|1|B, 7OAV|1|D, 7OAV|1|A, 7OA3|1|A, 7OAV|1|B, 7OAV|1|C, 7OA3|1|B, 7OAW|1|A, 7OAW|1|D, 7OAW|1|B, 7OAW|1|C
490NR_3.0_91756.1
Exact match
Sulfolobus islandicus
6S8B|1|V+6S8B|1|U (6S8B)
  • crRNA (51-mer), crRNA, Cognate target RN[...]
  • Electron microscopy
  • Release Date: 2020-07-08
2.4 Å51(3) 6S8B|1|V+6S8B|1|U, 6S6B|1|V, 6S91|1|V+6S91|1|U
491NR_3.0_12561.1
Exact match
Prochlorococcus sp.
6QN3|1|A+6QN3|1|B (6QN3)
  • RNA (51-MER)
  • X-ray diffraction
  • Release Date: 2019-06-12
  • Standardized name: Glutamine-II + Glutamine-II
  • Source: Bacteria
  • Rfam: RF01704 + RF01704
2.3 Å50(1) 6QN3|1|A+6QN3|1|B
492NR_3.0_15699.1
Exact match
Escherichia coli
6W5C|1|B (6W5C)
  • crRNA
  • Electron microscopy
  • Release Date: 2020-09-16
2.9 Å50(1) 6W5C|1|B
493NR_3.0_18633.1
Exact match
synthetic construct
7JRR|1|A (7JRR)
  • RNA (50-MER)
  • X-ray diffraction
  • Release Date: 2021-09-08
2.2 Å50(1) 7JRR|1|A
494NR_3.0_48255.1
Exact match
Tamana bat virus
7K16|1|P (7K16)
  • RNA (51-MER)
  • X-ray diffraction
  • Release Date: 2020-10-14
2.1 Å50(1) 7K16|1|P
495NR_3.0_83027.1
Exact match
Ralstonia solanacearum
3NPQ|1|A (3NPQ)
  • S-ADENOSYLHOMOCYSTEINE RIBOSWITCH
  • X-ray diffraction
  • Release Date: 2010-10-06
2.2 Å50(4) 3NPQ|1|A, 3NPQ|1|C, 3NPQ|1|B, 3NPN|1|A
496NR_3.0_89299.1
Exact match
Acidobacteriaceae bacterium KBS 83
7D81|1|A (7D81)
  • 832GAAA (50-MER)
  • X-ray diffraction
  • Release Date: 2020-11-25
  • Standardized name: nadA RNA
  • Source: Bacteria
  • Rfam: RF03013
2.1 Å50(2) 7D81|1|A, 7D82|1|A
497NR_3.0_24394.1
Exact match
metagenome
6UFJ|1|C (6UFJ)
  • Pistol (50-MER), RNA (5'-R(*UP*CP*UP*GP*[...]
  • X-ray diffraction
  • Release Date: 2019-12-18
2.6 Å49(6) 6UFJ|1|C, 6UFJ|1|A, 6UEY|1|C, 5KTJ|1|A, 6UEY|1|A, 5KTJ|1|C
498NR_3.0_25335.1
Exact match
synthetic construct
6LT7|1|C (6LT7)
  • 50-mer RNA
  • X-ray diffraction
  • Release Date: 2021-01-27
2.7 Å49(2) 6LT7|1|C, 6LT7|1|F
499NR_3.0_26368.1
Exact match
synthetic construct
6LTU|1|B (6LTU)
  • RNA (56-mer)
  • X-ray diffraction
  • Release Date: 2020-10-28
2.6 Å49(2) 6LTU|1|B, 6LTR|1|B
500NR_3.0_29875.1
Exact match
Potato leafroll virus
7JJU|1|A+7JJU|1|B (7JJU)
  • Potato leafroll virus xrRNA
  • X-ray diffraction
  • Release Date: 2020-09-09
  • Standardized name: PLRV_xrRNA + PLRV_xrRNA
  • Source: Viruses
  • Rfam: RF04222 + RF04222
2.6 Å49(1) 7JJU|1|A+7JJU|1|B
501NR_3.0_41414.1
Exact match
Mycolicibacterium mucogenicum
8HHL|1|B (8HHL)
  • crRNA (56-MER)
  • Electron microscopy
  • Release Date: 2023-04-12
2.9 Å49(1) 8HHL|1|B
502NR_3.0_52535.1
Exact match
Mesorhizobium loti
7WIE|1|V (7WIE)
  • RNA (50-MER)
  • X-ray diffraction
  • Release Date: 2023-01-18
2.9 Å49(5) 7WIE|1|V, 7WIB|1|V, 7WIF|1|V, 7WII|1|V, 7WI9|1|V
503NR_3.0_81496.1
Exact match
metagenome
5Y85|1|D (5Y85)
  • DNA/RNA (50-MER), RNA (5'-R(P*AP*CP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2017-11-22
2.0 Å49(4) 5Y85|1|D, 5Y85|1|B, 5Y87|1|D, 5Y87|1|B
504NR_3.0_98067.1
Exact match
synthetic construct
8EYU|1|A (8EYU)
  • RNA (49-MER), RNA (45-MER)
  • X-ray diffraction
  • Release Date: 2023-05-31
2.0 Å49(8) 8EYU|1|A, 8EYU|1|B, 8EYW|1|B, 8EYW|1|A, 8EYV|1|B, 8EYV|1|A, 8F0N|1|A, 8F0N|1|B
505NR_3.0_00810.1
Exact match
Escherichia coli
4C7O|1|E (4C7O)
  • SRP RNA
  • X-ray diffraction
  • Release Date: 2013-11-20
2.6 Å48(1) 4C7O|1|E
506NR_3.0_09706.1
Exact match
Methanocaldococcus jannaschii
2VPL|1|B (2VPL)
  • FRAGMENT OF MRNA FOR L1-OPERON CONTAININ[...]
  • X-ray diffraction
  • Release Date: 2008-09-23
2.3 Å48(2) 2VPL|1|B, 2VPL|1|D
507NR_3.0_10054.2
Exact match
synthetic construct
5DH6|1|A (5DH6)
  • hammerhead ribozyme, RNA (48-MER), RNA ([...]
  • X-ray diffraction
  • Release Date: 2015-10-07
2.8 Å48(5) 5DH6|1|A, 5DI4|1|A, 5DQK|1|A, 5EAO|1|A, 5DI2|1|A
508NR_3.0_12661.1
Exact match
Rhodobacter capsulatus SB 1003
7OS0|1|F (7OS0)
  • crRNA
  • X-ray diffraction
  • Release Date: 2022-01-19
2.2 Å48(2) 7OS0|1|F, 7OS0|1|D
509NR_3.0_27023.1
Exact match
synthetic construct
3LQX|1|B (3LQX)
  • 4.5 S RNA DOMAIN IV, 4.5S RNA DOMAIN IV,[...]
  • X-ray diffraction
  • Release Date: 2010-03-02
1.9 Å48(14) 3LQX|1|B, 1HQ1|1|B, 2PXE|1|B, 2PXD|1|B, 2PXT|1|B, 2PXB|1|B, 2PXF|1|B, 2PXP|1|B, 2PXL|1|B, 2PXV|1|B, 2PXU|1|B, 2PXK|1|B, 2PXQ|1|B, 1DUL|1|B
510NR_3.0_27926.1
Exact match
Desulfovibrio vulgaris str. Hildenborough
8DEX|1|L (8DEX)
  • RNA (48-MER)
  • Electron microscopy
  • Release Date: 2023-02-15
2.7 Å48(1) 8DEX|1|L
511NR_3.0_31040.1
Exact match
Drosophila melanogaster
5ZTM|1|C (5ZTM)
  • non-coding mRNA sequence roX2
  • X-ray diffraction
  • Release Date: 2019-03-06
2.9 Å48(1) 5ZTM|1|C
512NR_3.0_31751.1
Exact match
Desulfovibrio vulgaris str. Hildenborough
8DFS|1|L (8DFS)
  • RNA (48-MER)
  • Electron microscopy
  • Release Date: 2023-02-22
3.0 Å48(1) 8DFS|1|L
513NR_3.0_54098.1
Exact match
synthetic construct
7EOG|1|A (7EOG)
  • Pepper (49-MER)
  • X-ray diffraction
  • Release Date: 2021-11-24
1.5 Å48(10) 7EOG|1|A, 7EOH|1|A, 7EOP|1|A, 7EOI|1|A, 7EOJ|1|A, 7EOK|1|A, 7EON|1|A, 7EOO|1|A, 7EOL|1|A, 7EOM|1|A
514NR_3.0_06780.1
Exact match
1S03|1|A (1S03)
  • 47-MER
  • X-ray diffraction
  • Release Date: 2004-05-25
2.7 Å47(1) 1S03|1|A
515NR_3.0_07004.1
Exact match
1S03|1|B (1S03)
  • 47-MER
  • X-ray diffraction
  • Release Date: 2004-05-25
2.7 Å47(1) 1S03|1|B
516NR_3.0_11458.2
Exact match
Oryzias latipes
4O26|1|E (4O26)
  • Telomerase TR
  • X-ray diffraction
  • Release Date: 2014-05-07
3.0 Å47(2) 4O26|1|E, 4O26|1|F
517NR_3.0_21603.1
Exact match
Desulfovibrio vulgaris str. Hildenborough
8DFA|1|L (8DFA)
  • RNA (47-MER), DNA (48-MER), RNA (46-MER)
  • Electron microscopy
  • Release Date: 2023-02-22
2.8 Å47(2) 8DFA|1|L, 8DEJ|1|L+8DEJ|1|N
518NR_3.0_42222.1
Exact match
synthetic construct
5K7D|1|A (5K7D)
  • RNA 47-MER, DNA/RNA 11-MER
  • X-ray diffraction
  • Release Date: 2016-07-13
2.7 Å47(2) 5K7D|1|A, 5K7C|1|A
519NR_3.0_44868.1
Exact match
Candidatus Pelagibacter ubique
6FZ0|1|A (6FZ0)
  • metY SAM V (53-MER)
  • X-ray diffraction
  • Release Date: 2018-07-04
  • Standardized name: SAM-V riboswitch
  • Source: Bacteria
  • Rfam: RF01826
2.5 Å47(1) 6FZ0|1|A
520NR_3.0_68259.1
Exact match
Homo sapiens
5UNE|1|A+5UNE|1|B (5UNE)
  • RNA (47-MER)
  • X-ray diffraction
  • Release Date: 2017-03-29
2.9 Å47(1) 5UNE|1|A+5UNE|1|B
521NR_3.0_01806.1
Exact match
3IAB|1|R (3IAB)
  • P3 domain of the RNA component of RNase [...]
  • X-ray diffraction
  • Release Date: 2010-01-26
2.7 Å46(1) 3IAB|1|R
522NR_3.0_08212.1
Exact match
1XJR|1|A (1XJR)
  • s2m RNA
  • X-ray diffraction
  • Release Date: 2005-02-01
2.7 Å46(1) 1XJR|1|A
523NR_3.0_13595.1
Exact match
Rattus norvegicus
7ZJW|1|S (7ZJW)
  • GPX4 SECIS element
  • Electron microscopy
  • Release Date: 2022-10-19
  • Standardized name: SECIS_1
  • Source: Eukarya
  • Rfam: RF00031
2.8 Å46(1) 7ZJW|1|S
524NR_3.0_23835.1
Exact match
Pyrococcus horikoshii
5XTM|1|B (5XTM)
  • RNA (47-MER)
  • X-ray diffraction
  • Release Date: 2018-02-07
2.1 Å46(1) 5XTM|1|B
525NR_3.0_37028.1
Exact match
Pyrococcus horikoshii
5XTM|1|D (5XTM)
  • RNA (47-MER)
  • X-ray diffraction
  • Release Date: 2018-02-07
2.1 Å46(1) 5XTM|1|D
526NR_3.0_80828.1
Exact match
synthetic construct
4TS2|1|Y+4TS2|1|X (4TS2)
  • Spinach RNA aptamer, bimolecular constru[...]
  • X-ray diffraction
  • Release Date: 2014-07-23
2.9 Å46(2) 4TS2|1|Y+4TS2|1|X, 4TS0|1|Y+4TS0|1|X
527NR_3.0_80987.1
Exact match
2NUE|1|C (2NUE)
  • 46-MER
  • X-ray diffraction
  • Release Date: 2007-11-20
2.9 Å46(1) 2NUE|1|C
528NR_3.0_10203.1
Exact match
2GIC|1|R (2GIC)
  • 45-MER
  • X-ray diffraction
  • Release Date: 2006-08-22
2.9 Å45(1) 2GIC|1|R
529NR_3.0_28720.1
Exact match
4J1G|1|E (4J1G)
  • RNA (45-MER)
  • X-ray diffraction
  • Release Date: 2013-04-10
2.8 Å45(1) 4J1G|1|E
530NR_3.0_38259.1
Exact match
synthetic construct
3PU4|1|R (3PU4)
  • RNA (45-MER)
  • X-ray diffraction
  • Release Date: 2011-01-12
3.0 Å45(1) 3PU4|1|R
531NR_3.0_56742.1
Exact match
Sweet clover necrotic mosaic virus
6D3P|1|A (6D3P)
  • RNA (45-MER)
  • X-ray diffraction
  • Release Date: 2018-06-20
2.9 Å45(1) 6D3P|1|A
532NR_3.0_74244.1
Exact match
Ideonella sp. B508-1
7ELQ|1|A (7ELQ)
  • NMT1_Ir(46-MER), NMT1_Mn (46-MER), NMT1 [...]
  • X-ray diffraction
  • Release Date: 2021-06-30
  • Standardized name: NMT1 RNA
  • Source: Bacteria
  • Rfam: RF03054
2.6 Å45(8) 7ELQ|1|A, 7ELR|1|A, 7ELR|1|B, 7ELP|1|A, 7ELS|1|A, 7ELQ|1|B, 7ELP|1|B, 7ELS|1|B
533NR_3.0_85950.1
Exact match
3PTX|1|R (3PTX)
  • RNA (45-MER)
  • X-ray diffraction
  • Release Date: 2011-01-12
3.0 Å45(1) 3PTX|1|R
534NR_3.0_08971.1
Exact match
Homo sapiens
8HMZ|1|5+8HMZ|1|3 (8HMZ)
  • Pre-tRNA 5' END, Pre-tRNA 3' END
  • Electron microscopy
  • Release Date: 2023-04-19
2.9 Å44(1) 8HMZ|1|5+8HMZ|1|3
535NR_3.0_30539.1
Exact match
Influenza B virus
6SZU|1|V+6SZU|1|M (6SZU)
  • vRNA, mRNA
  • Electron microscopy
  • Release Date: 2020-04-15
2.4 Å44(1) 6SZU|1|V+6SZU|1|M
536NR_3.0_40657.1
Exact match
1G1X|1|J+1G1X|1|I (1G1X)
  • 16S RIBOSOMAL RNA
  • X-ray diffraction
  • Release Date: 2000-10-30
2.6 Å44(1) 1G1X|1|J+1G1X|1|I
537NR_3.0_48149.1
Exact match
synthetic construct
4RMO|1|B (4RMO)
  • RNA (45-MER)
  • X-ray diffraction
  • Release Date: 2015-09-30
2.2 Å44(8) 4RMO|1|B, 4RMO|1|D, 4RMO|1|H, 4RMO|1|F, 4RMO|1|J, 4RMO|1|L, 4RMO|1|N, 4RMO|1|P
538NR_3.0_62528.1
Exact match
synthetic construct
5EEU|1|W (5EEU)
  • (GAGUU)10GAG 53-NUCLEOTIDE RNA
  • X-ray diffraction
  • Release Date: 2016-05-04
2.0 Å44(11) 5EEU|1|W, 5EEV|1|W, 5EEX|1|W, 5EEW|1|W, 5EEY|1|W, 5EEZ|1|W, 5EF0|1|W, 1GTF|1|W, 5EF1|1|W, 5EF2|1|W, 5EF3|1|W
539NR_3.0_84424.1
Exact match
1GTN|1|W (1GTN)
  • (GAGCC)11G 56-NUCLEOTIDE RNA
  • X-ray diffraction
  • Release Date: 2002-04-05
2.5 Å44(1) 1GTN|1|W
540NR_3.0_99432.1
Exact match
1DUH|1|A (1DUH)
  • 4.5S RNA DOMAIN IV
  • X-ray diffraction
  • Release Date: 2000-05-08
2.7 Å44(1) 1DUH|1|A
541NR_3.0_23975.1
Exact match
Shewanella putrefaciens
5O7H|1|A (5O7H)
  • crRNA
  • X-ray diffraction
  • Release Date: 2017-08-16
3.0 Å43(1) 5O7H|1|A
542NR_3.0_37961.1
Exact match
Lachnospiraceae bacterium ND2006
7EU9|1|B (7EU9)
  • RNA (43-MER)
  • X-ray diffraction
  • Release Date: 2021-05-26
2.4 Å43(1) 7EU9|1|B
543NR_3.0_40386.1
Exact match
Lachnospiraceae bacterium NK4A179
5WLH|1|B (5WLH)
  • pre-crRNA
  • X-ray diffraction
  • Release Date: 2017-09-13
1.8 Å43(1) 5WLH|1|B
544NR_3.0_43343.1
Exact match
Escherichia coli
7D3J|1|B (7D3J)
  • RNA (43-MER)
  • X-ray diffraction
  • Release Date: 2021-05-19
2.5 Å43(2) 7D3J|1|B, 7D2L|1|B
545NR_3.0_46017.1
Exact match
Synechocystis sp. PCC 6803
7SBA|1|Z (7SBA)
  • crRNA
  • Electron microscopy
  • Release Date: 2022-06-08
2.9 Å43(1) 7SBA|1|Z
546NR_3.0_74260.1
Exact match
Homo sapiens
5BTM|1|A (5BTM)
  • RNA (55-mer)
  • X-ray diffraction
  • Release Date: 2015-07-15
2.8 Å43(2) 5BTM|1|A, 5BTM|1|B
547NR_3.0_92069.1
Exact match
synthetic construct
7ODF|1|F (7ODF)
  • RNA (43-MER)
  • Electron microscopy
  • Release Date: 2021-07-21
2.7 Å43(1) 7ODF|1|F
548NR_3.0_92884.1
Exact match
synthetic construct
7VTI|1|B (7VTI)
  • crRNA
  • X-ray diffraction
  • Release Date: 2022-08-24
1.9 Å43(1) 7VTI|1|B
549NR_3.0_58017.1
Exact match
4JNG|1|L (4JNG)
  • RNA (42-MER)
  • X-ray diffraction
  • Release Date: 2013-07-31
2.1 Å42(1) 4JNG|1|L
550NR_3.0_59651.1
Exact match
2OEU|1|A (2OEU)
  • Hammerhead Ribozyme, 5'-R(*GP*GP*CP*GP*U[...]
  • X-ray diffraction
  • Release Date: 2007-02-20
2.0 Å42(1) 2OEU|1|A
551NR_3.0_66328.1
Exact match
Saccharomyces cerevisiae
5M0H|1|A (5M0H)
  • ASH1 E3 (42 nt-TL/TLR)
  • X-ray diffraction
  • Release Date: 2017-01-18
2.7 Å42(1) 5M0H|1|A
552NR_3.0_67665.1
Exact match
Pseudomonas aeruginosa
7XFZ|1|E (7XFZ)
  • crRNA
  • Electron microscopy
  • Release Date: 2023-08-09
3.0 Å42(1) 7XFZ|1|E
553NR_3.0_74379.1
Exact match
synthetic construct
7PMM|1|D (7PMM)
  • RNA (45mer) containing HP92 of the 23S r[...]
  • X-ray diffraction
  • Release Date: 2022-09-14
3.0 Å42(2) 7PMM|1|D, 7PMM|1|C
554NR_3.0_83131.1
Exact match
synthetic construct
8AXF|1|Q (8AXF)
  • RNA (42-MER)
  • X-ray diffraction
  • Release Date: 2023-04-05
2.5 Å42(1) 8AXF|1|Q
555NR_3.0_85536.1
Exact match
Lachnospiraceae bacterium
5W1H|1|B (5W1H)
  • mature crRNA
  • X-ray diffraction
  • Release Date: 2017-09-13
2.0 Å42(3) 5W1H|1|B, 5W1I|1|B, 5W1I|1|D
556NR_3.0_90687.1
Exact match
1KH6|1|A (1KH6)
  • JIIIabc
  • X-ray diffraction
  • Release Date: 2002-04-26
2.9 Å42(1) 1KH6|1|A
557NR_3.0_95110.1
Exact match
1RPU|1|C+1RPU|1|D (1RPU)
  • 5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*UP*CP*AP*[...]
  • X-ray diffraction
  • Release Date: 2004-01-13
2.5 Å42(1) 1RPU|1|C+1RPU|1|D
558NR_3.0_22632.1
Exact match
4M6D|1|H (4M6D)
  • aptamer
  • X-ray diffraction
  • Release Date: 2013-12-11
2.7 Å41(6) 4M6D|1|H, 4M6D|1|F, 4M6D|1|J, 4M6D|1|D, 4M6D|1|L, 4M6D|1|B
559NR_3.0_52002.1
Exact match
synthetic construct
8D4A|1|B (8D4A)
  • RNA (41-MER), RNA (28-MER)
  • Electron microscopy
  • Release Date: 2023-01-18
2.7 Å41(2) 8D4A|1|B, 8D4B|1|B
560NR_3.0_88747.1
Exact match
synthetic construct
5NFV|1|B (5NFV)
  • pre-crRNA, crRNA (40-MER)
  • X-ray diffraction
  • Release Date: 2017-06-14
2.5 Å41(4) 5NFV|1|B, 6I1L|1|E, 6I1L|1|B, 6I1K|1|B
561NR_3.0_01073.1
Exact match
Thermobifida fusca
5NWQ|1|A (5NWQ)
  • Guanidine III riboswitch, RNA (41-MER), [...]
  • X-ray diffraction
  • Release Date: 2017-10-18
  • Standardized name: Guanidine-III riboswitch
  • Source: Bacteria
  • Rfam: RF01763
1.9 Å40(13) 5NWQ|1|A, 5NY8|1|A, 5NZD|1|A, 5NZD|1|B, 5NWQ|1|B, 5O62|1|A, 5NZ3|1|A, 5O69|1|A, 5NY8|1|B, 5NZ6|1|A, 5NZ3|1|B, 5O62|1|B, 5O69|1|B
562NR_3.0_13125.1
Exact match
1G1X|1|D+1G1X|1|E (1G1X)
  • 16S RIBOSOMAL RNA
  • X-ray diffraction
  • Release Date: 2000-10-30
2.6 Å40(1) 1G1X|1|D+1G1X|1|E
563NR_3.0_36746.1
Exact match
Francisella tularensis
5MGA|1|B (5MGA)
  • RNA (40-MER)
  • X-ray diffraction
  • Release Date: 2017-06-21
3.0 Å40(1) 5MGA|1|B
564NR_3.0_48252.1
Exact match
synthetic construct
5XUZ|1|B (5XUZ)
  • crRNA
  • X-ray diffraction
  • Release Date: 2017-08-09
2.4 Å40(5) 5XUZ|1|B, 5XUZ|1|F, 5XUT|1|B, 5XUS|1|B, 5XUU|1|B
565NR_3.0_74407.1
Exact match
Acidaminococcus
5XH7|1|B (5XH7)
  • RNA (43-MER), crRNA
  • X-ray diffraction
  • Release Date: 2017-06-14
2.0 Å40(3) 5XH7|1|B, 5XH6|1|B, 5B43|1|B
566NR_3.0_90696.1
Exact match
Leptotrichia shahii
5WTK|1|B (5WTK)
  • RNA (58-MER)
  • X-ray diffraction
  • Release Date: 2017-02-08
2.7 Å40(1) 5WTK|1|B
567NR_3.0_28021.1
Exact match
Biggievirus Mos11
7LYT|1|B (7LYT)
  • crRNA
  • Electron microscopy
  • Release Date: 2021-08-04
2.9 Å39(1) 7LYT|1|B
568NR_3.0_35127.1
Exact match
synthetic construct
6X5M|1|r (6X5M)
  • ggPAN RNA (39-MER), ggcA9 RNA (12-MER)
  • X-ray diffraction
  • Release Date: 2020-06-24
2.5 Å39(2) 6X5M|1|r, 6X5M|1|R
569NR_3.0_41959.1
Exact match
3P22|1|A (3P22)
  • Core ENE hairpin from KSHV PAN RNA, olig[...]
  • X-ray diffraction
  • Release Date: 2010-12-08
2.5 Å39(4) 3P22|1|A, 3P22|1|E, 3P22|1|C, 3P22|1|G
570NR_3.0_52747.1
Exact match
4KR6|1|C (4KR6)
  • RNA (39-MER)
  • X-ray diffraction
  • Release Date: 2014-04-23
2.9 Å39(1) 4KR6|1|C
571NR_3.0_53766.1
Exact match
4KR6|1|D (4KR6)
  • RNA (39-MER)
  • X-ray diffraction
  • Release Date: 2014-04-23
2.9 Å39(1) 4KR6|1|D
572NR_3.0_92888.1
Exact match
Escherichia coli
7Y9X|1|R (7Y9X)
  • crRNA (39-MER), tgRNA (5'-R(P*UP*AP*CP*C[...]
  • Electron microscopy
  • Release Date: 2022-11-09
2.5 Å39(5) 7Y9X|1|R, 8EEY|1|C+8EEY|1|D, 7WAH|1|R+7WAH|1|D, 7Y9Y|1|R+7Y9Y|1|D, 8EEX|1|C
573NR_3.0_08239.1
Exact match
synthetic construct
6E8S|1|A (6E8S)
  • iMango-III aptamer, Mango-III fluorescen[...]
  • X-ray diffraction
  • Release Date: 2019-04-17
2.4 Å38(4) 6E8S|1|A, 6E8S|1|B, 6UP0|1|D, 6UP0|1|C
574NR_3.0_18718.1
Exact match
synthetic construct
4PDB|1|I (4PDB)
  • SELEX RNA aptamer
  • X-ray diffraction
  • Release Date: 2014-09-03
2.6 Å38(1) 4PDB|1|I
575NR_3.0_37735.1
Exact match
1L2X|1|A (1L2X)
  • RNA pseudoknot
  • X-ray diffraction
  • Release Date: 2002-03-22
1.3 Å38(3) 1L2X|1|A, 437D|1|A, 1L3D|1|A
576NR_3.0_40597.1
Exact match
2HW8|1|B (2HW8)
  • mRNA, 36-MER
  • X-ray diffraction
  • Release Date: 2006-12-19
2.1 Å38(5) 2HW8|1|B, 1ZHO|1|D, 1ZHO|1|B, 1ZHO|1|F, 1ZHO|1|H
577NR_3.0_56375.1
Exact match
Desulfonema ishimotonii
8GS2|1|R+8GS2|1|D (8GS2)
  • crRNA, target RNA with non-matching PFS
  • Electron microscopy
  • Release Date: 2022-11-09
2.8 Å38(1) 8GS2|1|R+8GS2|1|D
578NR_3.0_78506.1
Exact match
2ZY6|1|A (2ZY6)
  • phenylalanyl transfer RNA
  • X-ray diffraction
  • Release Date: 2009-06-30
1.8 Å38(1) 2ZY6|1|A
579NR_3.0_79100.1
Exact match
Homo sapiens
6D12|1|C (6D12)
  • human 7SK RNA stem-loop 4
  • X-ray diffraction
  • Release Date: 2018-06-27
2.2 Å38(1) 6D12|1|C
580NR_3.0_84559.1
Exact match
synthetic construct
6E8U|1|B (6E8U)
  • RNA (37-MER)
  • X-ray diffraction
  • Release Date: 2019-04-17
1.6 Å38(2) 6E8U|1|B, 6PQ7|1|C
581NR_3.0_00338.1
Exact match
Escherichia coli
6SY4|1|C (6SY4)
  • TetR-binding aptamer K1 (43-MER)
  • X-ray diffraction
  • Release Date: 2020-02-05
2.7 Å37(1) 6SY4|1|C
582NR_3.0_41425.1
Exact match
Prevotella buccae
6DTD|1|C (6DTD)
  • RNA (37-MER)
  • X-ray diffraction
  • Release Date: 2019-02-20
1.7 Å37(1) 6DTD|1|C
583NR_3.0_49782.1
Exact match
1I6U|1|C (1I6U)
  • 16S RRNA FRAGMENT
  • X-ray diffraction
  • Release Date: 2001-08-03
2.6 Å37(2) 1I6U|1|C, 1I6U|1|D
584NR_3.0_51758.1
Exact match
synthetic construct
7RE1|1|T+7RE1|1|P (7RE1)
  • Template RNA, Product RNA
  • Electron microscopy
  • Release Date: 2021-12-01
2.9 Å37(1) 7RE1|1|T+7RE1|1|P
585NR_3.0_61960.1
Exact match
Lactococcus lactis subsp. lactis
6XN3|1|R+6XN3|1|T (6XN3)
  • Crispr RNA, target RNA
  • Electron microscopy
  • Release Date: 2022-01-12
3.0 Å37(1) 6XN3|1|R+6XN3|1|T
586NR_3.0_24663.1
Exact match
3GS5|1|C (3GS5)
  • RNA (36-MER)
  • X-ray diffraction
  • Release Date: 2009-04-21
2.8 Å36(1) 3GS5|1|C
587NR_3.0_26426.2
Exact match
synthetic construct
6C63|1|A (6C63)
  • RNA (36-MER), RNA (32-MER), RNA (35-MER)
  • X-ray diffraction
  • Release Date: 2018-08-08
2.9 Å36(9) 6C63|1|A, 6C63|1|B, 6C65|1|A, 6C65|1|B, 6C64|1|A, 6C64|1|B, 6C63|1|C, 6C65|1|C, 6C64|1|D
588NR_3.0_27088.1
Exact match
Mammalian orthoreovirus 3
7YED|1|T+7YED|1|N+7YED|1|M (7YED)
  • RNA (36-MER), RNA (5'-R(P*UP*UP*UP*AP*AP[...]
  • Electron microscopy
  • Release Date: 2023-04-05
3.0 Å36(1) 7YED|1|T+7YED|1|N+7YED|1|M
589NR_3.0_39458.1
Exact match
synthetic construct
6E8T|1|A (6E8T)
  • RNA (35-MER)
  • X-ray diffraction
  • Release Date: 2019-04-17
2.9 Å36(3) 6E8T|1|A, 6E8T|1|C, 6E8T|1|B
590NR_3.0_45693.1
Exact match
3VJR|1|B (3VJR)
  • tRNA CCA-acceptor
  • X-ray diffraction
  • Release Date: 2012-09-12
2.4 Å36(2) 3VJR|1|B, 3VJR|1|D
591NR_3.0_65081.1
Exact match
Escherichia coli
6SY6|1|D (6SY6)
  • RNA (36-MER)
  • X-ray diffraction
  • Release Date: 2020-02-05
2.9 Å36(1) 6SY6|1|D
592NR_3.0_76503.1
Exact match
synthetic construct
7UOB|1|T+7UOB|1|P (7UOB)
  • Template RNA (55-MER), Product RNA (35-M[...]
  • Electron microscopy
  • Release Date: 2022-11-30
2.7 Å36(2) 7UOB|1|T+7UOB|1|P, 7UOE|1|T+7UOE|1|P
593NR_3.0_02963.1
Exact match
synthetic construct
5DEA|1|C (5DEA)
  • sc1
  • X-ray diffraction
  • Release Date: 2015-09-23
2.8 Å35(2) 5DEA|1|C, 5DE5|1|C
594NR_3.0_14315.1
Exact match
synthetic construct
6E8T|1|D (6E8T)
  • RNA (35-MER)
  • X-ray diffraction
  • Release Date: 2019-04-17
2.9 Å35(1) 6E8T|1|D
595NR_3.0_14959.1
Exact match
Homo sapiens
6DCC|1|B (6DCC)
  • human 7SK RNA stem-loop 1 proximal, huma[...]
  • X-ray diffraction
  • Release Date: 2018-12-19
2.1 Å35(2) 6DCC|1|B, 6DCB|1|B
596NR_3.0_23939.1
Exact match
Kneallhazia solenopsae
4C4W|1|H (4C4W)
  • TSKT-23
  • X-ray diffraction
  • Release Date: 2014-02-12
3.0 Å35(2) 4C4W|1|H, 4C4W|1|D
597NR_3.0_25919.1
Exact match
synthetic construct
6CF2|1|G (6CF2)
  • RNA (35-MER)
  • X-ray diffraction
  • Release Date: 2018-07-25
3.0 Å35(1) 6CF2|1|G
598NR_3.0_38950.2
Exact match
Pectobacterium atrosepticum
2XDB|1|G (2XDB)
  • TOXI
  • X-ray diffraction
  • Release Date: 2011-01-12
2.6 Å35(6) 2XDB|1|G, 2XD0|1|H, 2XD0|1|I, 2XD0|1|V, 2XD0|1|G, 2XD0|1|U
599NR_3.0_52610.1
Exact match
synthetic construct
4PCJ|1|A (4PCJ)
  • RNA (35-MER), trCUG-3('5)
  • X-ray diffraction
  • Release Date: 2014-10-29
1.9 Å35(2) 4PCJ|1|A, 4FNJ|1|A
600NR_3.0_65533.1
Exact match
3OVB|1|C (3OVB)
  • RNA (35-MER), RNA (34-MER)
  • X-ray diffraction
  • Release Date: 2010-12-01
2.0 Å35(9) 3OVB|1|C, 3OVA|1|C, 3OVB|1|D, 3OUY|1|C, 3OVS|1|C, 3OUY|1|D, 3OV7|1|C, 3OVS|1|D, 3OV7|1|D
601NR_3.0_70098.1
Exact match
synthetic construct
5DEA|1|A (5DEA)
  • sc1
  • X-ray diffraction
  • Release Date: 2015-09-23
2.8 Å35(2) 5DEA|1|A, 5DE5|1|A
602NR_3.0_70895.1
Exact match
Haloarcula marismortui
5FJ4|1|H (5FJ4)
  • HMKT-7
  • X-ray diffraction
  • Release Date: 2016-05-25
3.0 Å35(2) 5FJ4|1|H, 5FJ4|1|D
603NR_3.0_73441.1
Exact match
synthetic construct
5BJO|1|E (5BJO)
  • RNA (36-MER)
  • X-ray diffraction
  • Release Date: 2017-09-27
2.4 Å35(7) 5BJO|1|E, 5BJP|1|E, 5BJO|1|Y, 5BJP|1|Y, 6E81|1|A, 6E80|1|A, 6E84|1|A
604NR_3.0_83324.1
Exact match
Candidatus Scalindua brodae
7Y81|1|B+7Y81|1|C (7Y81)
  • crRNA, Non-self RNA target, Self RNA tar[...]
  • Electron microscopy
  • Release Date: 2022-12-14
2.5 Å35(6) 7Y81|1|B+7Y81|1|C, 7Y84|1|B, 7Y82|1|B+7Y82|1|C, 7Y80|1|B, 7Y85|1|B+7Y85|1|C, 7Y83|1|B+7Y83|1|C
605NR_3.0_87221.2
Exact match
Candidatus Scalindua brodae
7XSP|1|D+7XSP|1|A (7XSP)
  • RNA (35-MER), RNA (5'-R(P*GP*GP*GP*GP*CP[...]
  • Electron microscopy
  • Release Date: 2022-11-09
2.9 Å35(3) 7XSP|1|D+7XSP|1|A, 7XSQ|1|D, 7XSR|1|D+7XSR|1|A
606NR_3.0_88496.1
Exact match
1ET4|1|A (1ET4)
  • VITAMIN B12 BINDING RNA, RNA APTAMER, 35[...]
  • X-ray diffraction
  • Release Date: 2000-11-13
2.3 Å35(9) 1ET4|1|A, 1ET4|1|C, 1ET4|1|B, 1ET4|1|D, 1ET4|1|E, 1DDY|1|C, 1DDY|1|G, 1DDY|1|A, 1DDY|1|E
607NR_3.0_95874.1
Exact match
3R9X|1|C (3R9X)
  • RNA301
  • X-ray diffraction
  • Release Date: 2011-06-22
2.8 Å35(1) 3R9X|1|C
608NR_3.0_99575.1
Exact match
Pectobacterium atrosepticum
7D8O|1|B (7D8O)
  • TOXI, Antitoxin RNA
  • X-ray diffraction
  • Release Date: 2022-01-05
2.1 Å35(7) 7D8O|1|B, 7D8O|1|F, 7D8O|1|H, 7D8O|1|L, 7D8O|1|D, 7D8O|1|J, 2XD0|1|W
609NR_3.0_04705.1
Exact match
synthetic construct
8DK7|1|C (8DK7)
  • RNA (34-MER)
  • X-ray diffraction
  • Release Date: 2022-11-30
2.5 Å34(2) 8DK7|1|C, 8DK7|1|F
610NR_3.0_07310.1
Exact match
Carnobacterium antarcticum
7REX|1|A (7REX)
  • RNA (34-MER), RNA (34-MER) Riboswitch
  • X-ray diffraction
  • Release Date: 2021-12-29
  • Standardized name: PreQ1
  • Source: Bacteria
  • Rfam: RF00522
2.6 Å34(6) 7REX|1|A, 7REX|1|B, 8FB3|1|B, 8FB3|1|C, 8FB3|1|A, 7REX|1|C
611NR_3.0_24216.1
Exact match
synthetic construct
8D29|1|C (8D29)
  • RNA (34-MER)
  • X-ray diffraction
  • Release Date: 2022-11-30
1.8 Å34(2) 8D29|1|C, 8D29|1|R
612NR_3.0_38781.1
Exact match
3R9W|1|B (3R9W)
  • RNA301
  • X-ray diffraction
  • Release Date: 2011-06-22
2.1 Å34(1) 3R9W|1|B
613NR_3.0_46231.1
Exact match
Pyrococcus furiosus
3NMU|1|E+3NMU|1|K (3NMU)
  • RNA (34-MER), RNA (5'-R(*GP*AP*GP*CP*UP*[...]
  • X-ray diffraction
  • Release Date: 2011-05-25
2.7 Å34(2) 3NMU|1|E+3NMU|1|K, 3NMU|1|D+3NMU|1|I
614NR_3.0_47265.1
Exact match
synthetic construct
8D29|1|J (8D29)
  • RNA (34-MER)
  • X-ray diffraction
  • Release Date: 2022-11-30
1.8 Å34(1) 8D29|1|J
615NR_3.0_55907.2
Exact match
1HMH|1|E (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-ray diffraction
  • Release Date: 1995-12-07
2.6 Å34(2) 1HMH|1|E, 1HMH|1|C
616NR_3.0_56838.1
Exact match
synthetic construct
8D29|1|F (8D29)
  • RNA (34-MER)
  • X-ray diffraction
  • Release Date: 2022-11-30
1.8 Å34(1) 8D29|1|F
617NR_3.0_62367.1
Exact match
Escherichia coli
1MJI|1|D (1MJI)
  • 5S rRNA fragment
  • X-ray diffraction
  • Release Date: 2003-01-21
2.5 Å34(2) 1MJI|1|D, 1MJI|1|C
618NR_3.0_64004.1
Exact match
Desulfonema ishimotonii
8D1V|1|J+8D1V|1|N (8D1V)
  • CRISPR RNA (34-MER), SS target RNA (5'-R[...]
  • Electron microscopy
  • Release Date: 2022-11-02
2.8 Å34(1) 8D1V|1|J+8D1V|1|N
619NR_3.0_82681.1
Exact match
1HMH|1|A (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-ray diffraction
  • Release Date: 1995-12-07
2.6 Å34(1) 1HMH|1|A
620NR_3.0_90215.1
Exact match
1YLS|1|B (1YLS)
  • RNA Diels-Alder ribozyme
  • X-ray diffraction
  • Release Date: 2005-02-22
3.0 Å34(2) 1YLS|1|B, 1YLS|1|D
621NR_3.0_91105.1
Exact match
4OOG|1|D (4OOG)
  • 34-mer RNA
  • X-ray diffraction
  • Release Date: 2014-04-16
2.5 Å34(1) 4OOG|1|D
622NR_3.0_09715.1
Exact match
Thermus thermophilus
5NS3|1|C (5NS3)
  • double-stranded RNA, RNA (34-MER)
  • X-ray diffraction
  • Release Date: 2017-12-20
2.4 Å33(4) 5NS3|1|C, 5NS4|1|C, 5NS3|1|D, 5NS4|1|D
623NR_3.0_21756.2
Exact match
Candidatus Scalindua brodae
8GNA|1|C+8GNA|1|J (8GNA)
  • RNA (33-MER), RNA (37-MER), RNA (5'-R(P*[...]
  • Electron microscopy
  • Release Date: 2023-01-18
2.8 Å33(6) 8GNA|1|C+8GNA|1|J, 8D9G|1|C+8D9G|1|D, 7Y8T|1|D, 7X8A|1|C, 7Y8Y|1|D+7Y8Y|1|E, 8D9F|1|C
624NR_3.0_22747.1
Exact match
2OZB|1|C (2OZB)
  • RNA comprising the 5' Stem-Loop RNA of [...]
  • X-ray diffraction
  • Release Date: 2007-03-20
2.6 Å33(2) 2OZB|1|C, 2OZB|1|F
625NR_3.0_24522.1
Exact match
Foot-and-mouth disease virus
7DTE|1|F+7DTE|1|G (7DTE)
  • RNA (57-MER), RNA (33-MER)
  • Electron microscopy
  • Release Date: 2021-10-20
3.0 Å33(1) 7DTE|1|F+7DTE|1|G
626NR_3.0_31091.1
Exact match
4K50|1|B (4K50)
  • RNA (33-MER), RNA (5'-R(P*GP*CP*CP*CP*GP[...]
  • X-ray diffraction
  • Release Date: 2013-05-22
2.9 Å33(4) 4K50|1|B, 4K50|1|J, 4K50|1|N, 4K50|1|F
627NR_3.0_42653.1
Exact match
5T16|1|H (5T16)
  • RNA substrate analog
  • X-ray diffraction
  • Release Date: 2017-02-08
2.8 Å33(4) 5T16|1|H, 5T16|1|P, 5T16|1|O, 5T16|1|G
628NR_3.0_46564.1
Exact match
Bacillus thuringiensis
4ATO|1|G (4ATO)
  • TOXI
  • X-ray diffraction
  • Release Date: 2012-12-26
  • Standardized name: ToxI antitoxin
  • Source: Bacteria
  • Rfam: RF02519
2.2 Å33(1) 4ATO|1|G
629NR_3.0_48165.1
Exact match
synthetic construct
8D28|1|B (8D28)
  • RNA (33-MER)
  • X-ray diffraction
  • Release Date: 2022-11-30
1.4 Å33(12) 8D28|1|B, 8D28|1|A, 8D5L|1|D, 8D5L|1|C, 8D5L|1|B, 8D5L|1|A, 8D2B|1|A, 8D2B|1|B, 8D2A|1|B, 8D2A|1|A, 8D5O|1|A, 8D5O|1|B
630NR_3.0_56009.1
Exact match
synthetic construct
8GZR|1|C (8GZR)
  • RNA
  • Electron microscopy
  • Release Date: 2023-08-02
2.8 Å33(1) 8GZR|1|C
631NR_3.0_74421.1
Exact match
1F1T|1|A (1F1T)
  • MALACHITE GREEN APTAMER RNA
  • X-ray diffraction
  • Release Date: 2000-09-04
2.8 Å33(1) 1F1T|1|A
632NR_3.0_80276.3
Exact match
6E1S|1|A (6E1S)
  • PreQ1 riboswitch, RNA (33-MER), 33-mer R[...]
  • X-ray diffraction
  • Release Date: 2019-04-10
1.8 Å33(12) 6E1S|1|A, 6E1T|1|A, 6E1W|1|A, 6E1U|1|A, 7E9E|1|A, 6VUH|1|A, 6VUI|1|A, 7E9I|1|A, 6E1V|1|A, 3Q50|1|A, 3Q51|1|A, 3GCA|1|A
633NR_3.0_10702.1
Exact match
synthetic construct
8E74|1|R (8E74)
  • RNA (42-MER)
  • Electron microscopy
  • Release Date: 2023-03-22
2.9 Å32(1) 8E74|1|R
634NR_3.0_45428.1
Exact match
Saccharomyces cerevisiae
7OZQ|1|H (7OZQ)
  • RNA
  • X-ray diffraction
  • Release Date: 2021-10-27
1.9 Å32(4) 7OZQ|1|H, 7OZQ|1|E, 7OZQ|1|F, 7OZQ|1|G
635NR_3.0_51503.1
Exact match
Homo sapiens
4X4N|1|D (4X4N)
  • G70A tRNA minihelix, RNA (5'-D(P*CP*G)-3[...]
  • X-ray diffraction
  • Release Date: 2015-02-11
3.0 Å32(10) 4X4N|1|D, 4X4N|1|B, 4X4T|1|G, 4X4P|1|B, 4X4T|1|B, 4X4P|1|H, 4X4P|1|D, 4X4P|1|F, 4X4N|1|G, 4X4T|1|D
636NR_3.0_55306.1
Exact match
Homo sapiens
8E0F|1|D+8E0F|1|C (8E0F)
  • RNA(5-R(*CP*GP*UP*AP*GP*CP*UP*AP*UP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2022-10-26
2.7 Å32(2) 8E0F|1|D+8E0F|1|C, 6VFF|1|D+6VFF|1|C
637NR_3.0_66108.1
Exact match
2DRA|1|B (2DRA)
  • tRNA (32-MER), tRNA (33-MER), tRNA (34-M[...]
  • X-ray diffraction
  • Release Date: 2006-11-14
2.5 Å32(17) 2DRA|1|B, 2DVI|1|B, 2ZH6|1|B, 2DR8|1|B, 2DRB|1|B, 2DR9|1|B, 2ZH3|1|B, 2ZH2|1|B, 2ZH1|1|B, 2ZH4|1|B, 2ZH8|1|B, 2ZH7|1|B, 2DR7|1|B, 2ZH5|1|B, 2ZHA|1|B, 2ZH9|1|B, 2DR5|1|B
638NR_3.0_68262.1
Exact match
Pyrococcus furiosus
3X1L|1|I (3X1L)
  • RNA (32-MER)
  • X-ray diffraction
  • Release Date: 2015-05-13
2.1 Å32(1) 3X1L|1|I
639NR_3.0_69759.1
Exact match
synthetic construct
6AZ4|1|A (6AZ4)
  • RNA (32-MER), RNA (5'-R(*CP*AP*GP*CP*AP*[...]
  • X-ray diffraction
  • Release Date: 2018-02-21
3.0 Å32(1) 6AZ4|1|A
640NR_3.0_79481.1
Exact match
synthetic construct
4RBQ|1|A (4RBQ)
  • U-Helix RNA from Trypanosome editing, RN[...]
  • X-ray diffraction
  • Release Date: 2015-11-11
1.1 Å32(2) 4RBQ|1|A, 5DA6|1|A
641NR_3.0_80808.1
Exact match
Streptococcus thermophilus
6IFN|1|N (6IFN)
  • RNA (32-MER)
  • X-ray diffraction
  • Release Date: 2018-12-12
2.9 Å32(1) 6IFN|1|N
642NR_3.0_88832.1
Exact match
Lactococcus lactis subsp. lactis
6XN5|1|R (6XN5)
  • Crispr RNA
  • Electron microscopy
  • Release Date: 2022-01-12
3.0 Å32(1) 6XN5|1|R
643NR_3.0_95363.4
Exact match
3K1V|1|A (3K1V)
  • PreQ1 riboswitch
  • X-ray diffraction
  • Release Date: 2009-10-06
2.2 Å32(4) 3K1V|1|A, 3FU2|1|C, 3FU2|1|B, 3FU2|1|A
644NR_3.0_13447.1
Exact match
Rattus norvegicus
6H0R|1|A (6H0R)
  • SRS2 fragment of Rgs4 3' UTR, RNA (31-ME[...]
  • X-ray diffraction
  • Release Date: 2019-04-17
1.7 Å31(2) 6H0R|1|A, 6H0R|1|B
645NR_3.0_13614.1
Exact match
synthetic construct
6KWQ|1|B (6KWQ)
  • RNA (31-MER), RNA (5'-R(*UP*GP*UP*UP*CP*[...]
  • X-ray diffraction
  • Release Date: 2019-12-11
1.8 Å31(1) 6KWQ|1|B
646NR_3.0_34610.1
Exact match
Escherichia coli
364D|1|C+364D|1|B+364D|1|A (364D)
  • RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP[...]
  • X-ray diffraction
  • Release Date: 1998-01-02
3.0 Å31(1) 364D|1|C+364D|1|B+364D|1|A
647NR_3.0_49730.1
Exact match
Homo sapiens
4X4V|1|B (4X4V)
  • human MenBeta minihelix, Human MenBeta m[...]
  • X-ray diffraction
  • Release Date: 2015-02-11
2.6 Å31(4) 4X4V|1|B, 4X4V|1|D, 4X4U|1|B, 4X4U|1|D
648NR_3.0_57635.1
Exact match
Homo sapiens
8E4X|1|C+8E4X|1|D (8E4X)
  • RNA (5-R(*GP*CP*UP*CP*GP*CP*GP*AP*UP*GP*[...]
  • X-ray diffraction
  • Release Date: 2022-10-26
2.8 Å31(1) 8E4X|1|C+8E4X|1|D
649NR_3.0_89906.2
Exact match
5HC9|1|D (5HC9)
  • RNA (75-MER), RNA 75-mer, tRNAphe
  • X-ray diffraction
  • Release Date: 2016-04-27
  • Standardized name: tRNA
  • Source: Bacteria
  • Rfam: RF00005
2.9 Å31(5) 5HC9|1|D, 4WC2|1|B, 5HC9|1|C, 1VFG|1|D, 1VFG|1|C
650NR_3.0_92029.1
Exact match
Escherichia coli
6UGI|1|A (6UGI)
  • tRNA(Asp) acceptor stem/T stem-loop
  • X-ray diffraction
  • Release Date: 2020-01-01
1.8 Å31(2) 6UGI|1|A, 6UGJ|1|A
651NR_3.0_93701.1
Exact match
synthetic construct
5V3F|1|A (5V3F)
  • RNA (31-MER)
  • X-ray diffraction
  • Release Date: 2017-05-24
1.7 Å31(2) 5V3F|1|A, 5V3F|1|B
652NR_3.0_94729.10
Exact match
4NLF|1|A (4NLF)
  • 31-mer SRD RNA analog, 29-mer sarcin/ric[...]
  • X-ray diffraction
  • Release Date: 2014-11-19
1.0 Å31(45) 4NLF|1|A, 5D99|1|A, 6Y0Y|1|A, 1Q9A|1|A, 7QP2|1|A, 4NMG|1|A, 6ZYB|1|A, 3DW4|1|A, 3DW6|1|A, 7L3R|1|A, 4Y27|1|A, 7JJE|1|A, 3DVZ|1|A, 4NXH|1|A, 5NQI|1|A, 3S7C|1|A, 5MRX|1|A, 7QSH|1|A, 3DW5|1|A, 3DW7|1|A, 483D|1|A, 3S8U|1|A, 7JJD|1|A, 1MSY|1|A, 480D|1|A, 6Y0T|1|B, 6Y0T|1|A, 7M3V|1|A, 7JJF|1|A, 1JBR|1|D, 7EEN|1|A, 7EEN|1|B, 7EEM|1|A, 1JBT|1|C, 6ZXZ|1|B, 7EEN|1|D, 1JBT|1|D, 1JBS|1|D, 7EEN|1|C, 6ZXZ|1|A, 6ZXZ|1|C, 1JBS|1|C, 7EEO|1|A, 7EEO|1|B, 7UCR|1|A
653NR_3.0_12719.1
Exact match
4IFD|1|R (4IFD)
  • RNA (45-MER)
  • X-ray diffraction
  • Release Date: 2013-02-06
2.8 Å30(1) 4IFD|1|R
654NR_3.0_17339.1
Exact match
Escherichia coli
8FZA|1|A (8FZA)
  • PreQ1 Riboswitch (30-MER)
  • X-ray diffraction
  • Release Date: 2023-08-30
2.3 Å30(1) 8FZA|1|A
655NR_3.0_22327.1
Exact match
3SNP|1|D (3SNP)
  • ferritin H IRE RNA
  • X-ray diffraction
  • Release Date: 2011-07-27
2.8 Å30(2) 3SNP|1|D, 3SNP|1|C
656NR_3.0_83665.1
Exact match
Saccharomyces cerevisiae
5Y58|1|X (5Y58)
  • TLC1
  • X-ray diffraction
  • Release Date: 2017-12-20
2.8 Å30(3) 5Y58|1|X, 5Y58|1|Y, 5Y58|1|Z
657NR_3.0_83957.1
Exact match
Streptococcus parasanguinis
8I3Z|1|B+8I3Z|1|A (8I3Z)
  • RNA (30-MER), RNA (5'-R(*AP*GP*AP*GP*CP*[...]
  • X-ray diffraction
  • Release Date: 2023-03-22
1.7 Å30(3) 8I3Z|1|B+8I3Z|1|A, 8HB1|1|B+8HB1|1|A, 8HB3|1|B+8HB3|1|A
658NR_3.0_87323.1
Exact match
Streptococcus pyogenes
7S3H|1|R (7S3H)
  • Single-guide RNA
  • Electron microscopy
  • Release Date: 2022-04-20
2.5 Å30(1) 7S3H|1|R
659NR_3.0_02086.1
Exact match
3BBM|1|B+3BBM|1|C+3BBM|1|A (3BBM)
  • 29-mer Loop A and Loop B Ribozyme strand[...]
  • X-ray diffraction
  • Release Date: 2008-08-12
2.7 Å29(10) 3BBM|1|B+3BBM|1|C+3BBM|1|A, 3B5S|1|B+3B5S|1|C+3B5S|1|A, 3B5A|1|B+3B5A|1|C+3B5A|1|A, 3BBI|1|B+3BBI|1|C+3BBI|1|A, 3BBK|1|B+3BBK|1|C+3BBK|1|A, 3B91|1|B+3B91|1|C+3B91|1|A, 3B5F|1|B+3B5F|1|C+3B5F|1|A, 3B58|1|B+3B58|1|C+3B58|1|A, 4G6P|1|B+4G6P|1|C+4G6P|1|A, 4G6S|1|B+4G6S|1|C+4G6S|1|A
660NR_3.0_02804.1
Exact match
synthetic construct
8EHQ|1|R (8EHQ)
  • RNA (29-MER)
  • Electron microscopy
  • Release Date: 2023-02-01
3.0 Å29(1) 8EHQ|1|R
661NR_3.0_03525.1
Exact match
Escherichia coli
2BH2|1|D (2BH2)
  • 23S RIBOSOMAL RNA 1932-1968
  • X-ray diffraction
  • Release Date: 2005-03-30
2.2 Å29(2) 2BH2|1|D, 2BH2|1|C
662NR_3.0_23918.1
Exact match
Hepacivirus C
7KI3|1|C (7KI3)
  • HCV genotype 1a miR-122 site-1, miR-122
  • X-ray diffraction
  • Release Date: 2021-10-06
3.0 Å29(2) 7KI3|1|C, 7KI3|1|F+7KI3|1|E
663NR_3.0_51124.1
Exact match
Homo sapiens
6DU4|1|B (6DU4)
  • hp1x-RNA (29-MER)
  • X-ray diffraction
  • Release Date: 2018-09-26
1.7 Å29(1) 6DU4|1|B
664NR_3.0_55924.2
Exact match
1OOA|1|C (1OOA)
  • RNA aptamer
  • X-ray diffraction
  • Release Date: 2003-07-22
2.5 Å29(2) 1OOA|1|C, 1OOA|1|D
665NR_3.0_75875.1
Exact match
3SN2|1|B (3SN2)
  • transferrin receptor iron regulatory ele[...]
  • X-ray diffraction
  • Release Date: 2011-11-23
3.0 Å29(1) 3SN2|1|B
666NR_3.0_95171.1
Exact match
3MJA|1|B (3MJA)
  • RNA (29-MER), RNA (5'-R(P*UP*AP*AP*GP*AP[...]
  • X-ray diffraction
  • Release Date: 2010-05-19
2.8 Å29(3) 3MJA|1|B, 3B31|1|A, 3MJB|1|A
667NR_3.0_04400.1
Exact match
synthetic construct
6KWR|1|B (6KWR)
  • RNA (31-MER), RNA (5'-R(*UP*GP*UP*UP*CP*[...]
  • X-ray diffraction
  • Release Date: 2019-12-11
2.5 Å28(1) 6KWR|1|B
668NR_3.0_04796.1
Exact match
Escherichia coli
8FZA|1|B (8FZA)
  • PreQ1 Riboswitch (30-MER)
  • X-ray diffraction
  • Release Date: 2023-08-30
2.3 Å28(1) 8FZA|1|B
669NR_3.0_14193.1
Exact match
synthetic construct
6V9B|1|B+6V9B|1|D (6V9B)
  • RNA (28-MER)
  • X-ray diffraction
  • Release Date: 2020-05-20
2.4 Å28(2) 6V9B|1|B+6V9B|1|D, 6V9D|1|B+6V9D|1|E
670NR_3.0_14513.1
Exact match
Homo sapiens
3SIU|1|F (3SIU)
  • U4atac snRNA
  • X-ray diffraction
  • Release Date: 2011-08-10
2.6 Å28(2) 3SIU|1|F, 3SIU|1|C
671NR_3.0_18396.1
Exact match
synthetic construct
3ZC0|1|M (3ZC0)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP*GP*UP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2013-01-23
3.0 Å28(3) 3ZC0|1|M, 3ZC0|1|O, 3ZC0|1|N
672NR_3.0_18914.1
Exact match
Homo sapiens
6AAX|1|B (6AAX)
  • RNA (28-mer)
  • X-ray diffraction
  • Release Date: 2019-06-05
3.0 Å28(2) 6AAX|1|B, 6AAX|1|D
673NR_3.0_21041.1
Exact match
Homo sapiens
5MWI|1|A (5MWI)
  • RNA G(CUG)8C duplex
  • X-ray diffraction
  • Release Date: 2017-03-08
1.5 Å28(1) 5MWI|1|A
674NR_3.0_44743.1
Exact match
Homo sapiens
6AJK|1|B (6AJK)
  • RNA (28-MER)
  • X-ray diffraction
  • Release Date: 2019-06-05
3.0 Å28(1) 6AJK|1|B
675NR_3.0_50760.1
Exact match
Mus musculus
6TQB|1|B (6TQB)
  • RNA (5'-R(P*GP*GP*AP*AP*AP*UP*UP*AP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2020-05-27
1.6 Å28(1) 6TQB|1|B
676NR_3.0_52096.2
Exact match
synthetic construct
4TUW|1|C (4TUW)
  • HISTONE MRNA 3' STEM LOOP, RNA (26-MER)
  • X-ray diffraction
  • Release Date: 2014-07-23
2.9 Å28(3) 4TUW|1|C, 4TUW|1|D, 4TV0|1|B
677NR_3.0_52425.2
Exact match
7R97|1|C (7R97)
  • 28-MER, RNA10, RNA12, RNA (28-MER)
  • X-ray diffraction
  • Release Date: 2022-07-20
1.8 Å28(10) 7R97|1|C, 7R97|1|D, 2EZ6|1|D, 2EZ6|1|C, 4M30|1|D, 4M30|1|C, 2NUF|1|D, 2NUF|1|C, 4M2Z|1|C, 4M2Z|1|D
678NR_3.0_57646.1
Exact match
Saccharomyces cerevisiae
5M0J|1|E (5M0J)
  • ASH1 E3 (28 nt-loop)
  • X-ray diffraction
  • Release Date: 2017-01-18
2.8 Å28(1) 5M0J|1|E
679NR_3.0_68428.1
Exact match
1D4R|1|B+1D4R|1|A (1D4R)
  • 29-MER OF MODIFIED SRP RNA HELIX 6
  • X-ray diffraction
  • Release Date: 1999-12-02
2.0 Å28(2) 1D4R|1|B+1D4R|1|A, 1D4R|1|C
680NR_3.0_78625.1
Exact match
Saccharomyces cerevisiae
5M0J|1|F (5M0J)
  • ASH1 E3 (28 nt-loop)
  • X-ray diffraction
  • Release Date: 2017-01-18
2.8 Å28(1) 5M0J|1|F
681NR_3.0_86202.1
Exact match
Saccharomyces cerevisiae
5M0I|1|F (5M0I)
  • ASH1-E3 element, RNA (28-MER)
  • X-ray diffraction
  • Release Date: 2017-01-18
2.4 Å28(1) 5M0I|1|F
682NR_3.0_90603.1
Exact match
Saccharomyces cerevisiae
5M0I|1|E (5M0I)
  • ASH1-E3 element, RNA (28-MER)
  • X-ray diffraction
  • Release Date: 2017-01-18
2.4 Å28(1) 5M0I|1|E
683NR_3.0_17196.2
Exact match
Severe acute respiratory syndrome coronavirus 2
8GWE|1|J+8GWE|1|I (8GWE)
  • template, primer
  • Electron microscopy
  • Release Date: 2023-01-11
2.7 Å27(2) 8GWE|1|J+8GWE|1|I, 8GWB|1|J+8GWB|1|I
684NR_3.0_24791.1
Exact match
3GS5|1|A (3GS5)
  • RNA (25-MER)
  • X-ray diffraction
  • Release Date: 2009-04-21
2.8 Å27(1) 3GS5|1|A
685NR_3.0_30667.1
Exact match
1XOK|1|A (1XOK)
  • alfalfa mosaic virus RNA 3' UTR
  • X-ray diffraction
  • Release Date: 2005-01-04
3.0 Å27(1) 1XOK|1|A
686NR_3.0_32738.1
Exact match
Human immunodeficiency virus 1
6XH2|1|D (6XH2)
  • Trans-Activation Response RNA Element, T[...]
  • X-ray diffraction
  • Release Date: 2020-10-14
1.7 Å27(4) 6XH2|1|D, 6CMN|1|D, 6XH3|1|D, 6XH1|1|D
687NR_3.0_46784.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7CYQ|1|J+7CYQ|1|I (7CYQ)
  • Template, Primer
  • Electron microscopy
  • Release Date: 2020-12-09
2.8 Å27(1) 7CYQ|1|J+7CYQ|1|I
688NR_3.0_57955.2
Exact match
1Q96|1|A (1Q96)
  • Sarcin/Ricin 28S rRNA, SARCIN/RICIN LOOP[...]
  • X-ray diffraction
  • Release Date: 2003-11-25
1.8 Å27(7) 1Q96|1|A, 1Q96|1|B, 1Q96|1|C, 1Q93|1|C, 1Q93|1|A, 1Q93|1|B, 430D|1|A
689NR_3.0_04166.1
Exact match
Saccharomyces cerevisiae
6YMC|1|A (6YMC)
  • RNA (26-MER)
  • X-ray diffraction
  • Release Date: 2022-04-20
2.0 Å26(2) 6YMC|1|A, 6YMC|1|B
690NR_3.0_08420.1
Exact match
2A43|1|A (2A43)
  • RNA Pseudoknot
  • X-ray diffraction
  • Release Date: 2005-09-27
1.3 Å26(1) 2A43|1|A
691NR_3.0_11127.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7CXM|1|J+7CXM|1|I (7CXM)
  • RNA (26-MER), RNA (25-MER)
  • Electron microscopy
  • Release Date: 2020-11-04
2.9 Å26(1) 7CXM|1|J+7CXM|1|I
692NR_3.0_26264.1
Exact match
1JID|1|B (1JID)
  • HELIX 6 OF HUMAN SRP RNA
  • X-ray diffraction
  • Release Date: 2001-10-19
1.8 Å26(1) 1JID|1|B
693NR_3.0_26321.3
Exact match
4QOZ|1|A (4QOZ)
  • HISTONE MRNA STEM-LOOP
  • X-ray diffraction
  • Release Date: 2014-07-23
2.3 Å26(4) 4QOZ|1|A, 4L8R|1|A, 4QOZ|1|D, 4L8R|1|D
694NR_3.0_26836.2
Exact match
Haloarcula marismortui
4BW0|1|A (4BW0)
  • HMKT-7
  • X-ray diffraction
  • Release Date: 2013-11-06
2.3 Å26(9) 4BW0|1|A, 5FJ1|1|B, 5FJ1|1|E, 5FJ1|1|C, 5FJ1|1|A, 5FJ1|1|D, 5FJ1|1|F, 5FJ1|1|H, 5FJ1|1|G
695NR_3.0_36664.1
Exact match
Aromatoleum aromaticum
6H9H|1|E (6H9H)
  • crRNA
  • X-ray diffraction
  • Release Date: 2018-09-26
1.8 Å26(1) 6H9H|1|E
696NR_3.0_48282.1
Exact match
2RFK|1|E+2RFK|1|D+2RFK|1|F (2RFK)
  • guide RNA 2, guide RNA 1, target RNA
  • X-ray diffraction
  • Release Date: 2008-02-05
2.9 Å26(1) 2RFK|1|E+2RFK|1|D+2RFK|1|F
697NR_3.0_52698.1
Exact match
Homo sapiens
8DVU|1|B (8DVU)
  • OHSLR30
  • Electron microscopy
  • Release Date: 2022-11-16
2.9 Å26(2) 8DVU|1|B, 8DVS|1|B
698NR_3.0_60167.4
Exact match
3C3Z|1|A+3C3Z|1|B (3C3Z)
  • HIV-1 DIS(MAL) genomic RNA, 5'-R(*CP*UP*[...]
  • X-ray diffraction
  • Release Date: 2008-05-06
1.5 Å26(19) 3C3Z|1|A+3C3Z|1|B, 2OIY|1|A+2OIY|1|B, 462D|1|B+462D|1|A, 1NLC|1|B+1NLC|1|A, 3C44|1|A+3C44|1|B, 1O3Z|1|B+1O3Z|1|A, 3C7R|1|A+3C7R|1|B, 3C5D|1|A+3C5D|1|B, 2OJ0|1|A+2OJ0|1|B, 1Y73|1|B+1Y73|1|A, 1Y99|1|A+1Y99|1|B, 3DVV|1|A+3DVV|1|B, 1WVD|1|B+1WVD|1|A, 1Y6T|1|B+1Y6T|1|A, 2OIJ|1|A+2OIJ|1|B, 1Y95|1|B+1Y95|1|A, 3FAR|1|A+3FAR|1|B, 1Y6S|1|B+1Y6S|1|A, 2QEK|1|A+2QEK|1|B
699NR_3.0_67137.1
Exact match
Lachnospiraceae bacterium ND2006
6P7M|1|B (6P7M)
  • mature crRNA
  • Electron microscopy
  • Release Date: 2019-08-21
3.0 Å26(1) 6P7M|1|B
700NR_3.0_02858.1
Exact match
2QUX|1|F (2QUX)
  • RNA (25-MER)
  • X-ray diffraction
  • Release Date: 2007-12-18
2.4 Å25(6) 2QUX|1|F, 2QUX|1|I, 2QUX|1|C, 2QUX|1|R, 2QUX|1|O, 2QUX|1|L
701NR_3.0_08337.1
Exact match
Pariacoto virus
1F8V|1|R (1F8V)
  • RNA
  • X-ray diffraction
  • Release Date: 2000-12-06
3.0 Å25(1) 1F8V|1|R
702NR_3.0_20773.1
Exact match
Thermococcus onnurineus
6O7H|1|G+6O7H|1|H (6O7H)
  • RNA (25-MER), RNA (38-MER), RNA (40-MER)
  • Electron microscopy
  • Release Date: 2019-07-31
2.9 Å25(2) 6O7H|1|G+6O7H|1|H, 6MUU|1|G
703NR_3.0_34764.1
Exact match
Roseobacter sp.
6YL5|1|I (6YL5)
  • Chains: A,B,C,D,E,F,G,H,I,J,K,L
  • X-ray diffraction
  • Release Date: 2020-07-22
1.7 Å25(6) 6YL5|1|I, 6YL5|1|E, 6YL5|1|A, 6YL5|1|K, 6YL5|1|G, 6YL5|1|C
704NR_3.0_64498.1
Exact match
Saccharolobus solfataricus
7XPL|1|G+7XPL|1|H+7XPL|1|I+7XPL|1|J (7XPL)
  • BMG3 RNA strand A, BMG3 RNA strand B, RN[...]
  • X-ray diffraction
  • Release Date: 2022-10-05
2.2 Å25(1) 7XPL|1|G+7XPL|1|H+7XPL|1|I+7XPL|1|J
705NR_3.0_81333.1
Exact match
synthetic construct
3WBM|1|X+3WBM|1|Y (3WBM)
  • RNA (25-MER)
  • X-ray diffraction
  • Release Date: 2013-12-11
2.0 Å25(1) 3WBM|1|X+3WBM|1|Y
706NR_3.0_81641.1
Exact match
Drosophila melanogaster
6F4G|1|C (6F4G)
  • U2-SL4
  • X-ray diffraction
  • Release Date: 2018-06-20
1.9 Å25(2) 6F4G|1|C, 6F4G|1|F
707NR_3.0_82632.1
Exact match
Roseobacter sp.
6YML|1|A (6YML)
  • Chains: A,C,F,I,M,O, Chains: B,D,G,J,N,P[...]
  • X-ray diffraction
  • Release Date: 2020-07-22
2.2 Å25(28) 6YML|1|A, 6YMK|1|A, 6YMM|1|A, 6YMJ|1|M, 6YMJ|1|F, 6YMK|1|M, 6YMJ|1|A, 6YMM|1|C, 6YMK|1|O, 6YMK|1|C, 6YMI|1|M, 6YMI|1|F, 6YMI|1|A, 6YMK|1|F, 6YMK|1|I, 6YLB|1|M, 6YLB|1|I, 6YML|1|C, 6YLB|1|F, 6YMI|1|C, 6YLB|1|O, 6YMI|1|O, 6YMJ|1|C, 6YLB|1|C, 6YLB|1|A, 6YMI|1|I, 6YMJ|1|I, 6YMJ|1|O
708NR_3.0_08924.1
Exact match
Methanococcus maripaludis
4Z7K|1|C (4Z7K)
  • RNA/DNA Hybrid (31-MER)
  • X-ray diffraction
  • Release Date: 2016-04-13
3.0 Å24(1) 4Z7K|1|C
709NR_3.0_21052.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7DOK|1|T+7DOK|1|P (7DOK)
  • RNA (5'-R(P*CP*CP*CP*UP*AP*UP*AP*AP*CP*U[...]
  • Electron microscopy
  • Release Date: 2021-12-15
2.7 Å24(1) 7DOK|1|T+7DOK|1|P
710NR_3.0_29415.1
Exact match
Homo sapiens
6BSG|1|R (6BSG)
  • RNA (25-MER)
  • X-ray diffraction
  • Release Date: 2018-01-03
2.4 Å24(3) 6BSG|1|R, 6BSH|1|R, 6BSJ|1|R
711NR_3.0_30596.1
Exact match
3A6P|1|E+3A6P|1|D (3A6P)
  • pre-microRNA
  • X-ray diffraction
  • Release Date: 2009-12-08
2.9 Å24(2) 3A6P|1|E+3A6P|1|D, 3A6P|1|J+3A6P|1|I
712NR_3.0_50588.1
Exact match
Pyrococcus furiosus
3NVI|1|F (3NVI)
  • RNA (5'-R(*CP*UP*CP*UP*GP*AP*CP*CP*GP*AP[...]
  • X-ray diffraction
  • Release Date: 2011-07-20
2.7 Å24(2) 3NVI|1|F, 3NVI|1|E
713NR_3.0_52870.1
Exact match
synthetic construct
5JC7|1|X+5JC7|1|Y (5JC7)
  • RNA (5'-R(P*GP*GP*AP*CP*GP*UP*CP*AP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2016-06-01
2.8 Å24(1) 5JC7|1|X+5JC7|1|Y
714NR_3.0_63923.1
Exact match
synthetic construct
7Q81|1|B+7Q81|1|C+7Q81|1|A (7Q81)
  • RNA 2, RNA 3, RNA 1, RNA1
  • X-ray diffraction
  • Release Date: 2022-03-23
2.9 Å24(3) 7Q81|1|B+7Q81|1|C+7Q81|1|A, 7Q7X|1|B+7Q7X|1|C+7Q7X|1|A, 7Q7Y|1|B+7Q7Y|1|C+7Q7Y|1|A
715NR_3.0_65028.2
Exact match
359D|1|B+359D|1|A (359D)
  • 5'-R(*GP*CP*CP*GP*AP*AP*AP*CP*UP*CP*GP*U[...]
  • X-ray diffraction
  • Release Date: 1997-11-07
2.9 Å24(6) 359D|1|B+359D|1|A, 301D|1|B+301D|1|A, 299D|1|B+299D|1|A, 300D|1|B+300D|1|A, 1NYI|1|B+1NYI|1|A, 1Q29|1|B+1Q29|1|A
716NR_3.0_67726.2
Exact match
synthetic construct
5F9F|1|F (5F9F)
  • RNA (5'-R(*GP*AP*AP*UP*AP*UP*AP*AP*UP*AP[...]
  • X-ray diffraction
  • Release Date: 2016-01-13
2.6 Å24(6) 5F9F|1|F, 5F9F|1|L, 5F9F|1|H, 5F9F|1|B, 5F9F|1|J, 5F9F|1|D
717NR_3.0_73563.1
Exact match
Homo sapiens
8ID2|1|C (8ID2)
  • RNA (5'-R(P*GP*GP*GP*GP*AP*CP*UP*GP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2023-05-17
1.8 Å24(3) 8ID2|1|C, 8ID2|1|D, 7P0V|1|B
718NR_3.0_86436.1
Exact match
2PN3|1|A+2PN3|1|B (2PN3)
  • 5'-R(*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*C[...]
  • X-ray diffraction
  • Release Date: 2008-04-01
2.9 Å24(5) 2PN3|1|A+2PN3|1|B, 2PN4|1|A+2PN4|1|B, 2PN4|1|C+2PN4|1|D, 2NOK|1|C+2NOK|1|D, 2NOK|1|A+2NOK|1|B
719NR_3.0_89332.1
Exact match
Homo sapiens
1A9N|1|Q (1A9N)
  • RNA (5'-R(*CP*CP*UP*GP*GP*UP*AP*UP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 1998-09-23
2.4 Å24(2) 1A9N|1|Q, 1A9N|1|R
720NR_3.0_89699.1
Exact match
synthetic construct
7ED5|1|J+7ED5|1|I (7ED5)
  • RNA (5'-R(P*CP*CP*CP*CP*AP*UP*AP*AP*CP*U[...]
  • Electron microscopy
  • Release Date: 2022-02-16
3.0 Å24(1) 7ED5|1|J+7ED5|1|I
721NR_3.0_89953.1
Exact match
synthetic construct
6RTI|1|X (6RTI)
  • Aptamer A9g, RNA (43-MER)
  • X-ray diffraction
  • Release Date: 2020-06-10
2.2 Å24(1) 6RTI|1|X
722NR_3.0_90908.1
Exact match
Geobacter sulfurreducens PCA
8IN8|1|I (8IN8)
  • RNA (5'-R(P*AP*UP*AP*AP*UP*GP*GP*UP*UP*U[...]
  • Electron microscopy
  • Release Date: 2023-07-05
3.0 Å24(1) 8IN8|1|I
723NR_3.0_92997.1
Exact match
synthetic construct
7Q82|1|C+7Q82|1|B+7Q82|1|A (7Q82)
  • RNA 3, RNA 2, RNA 1
  • X-ray diffraction
  • Release Date: 2022-03-23
3.0 Å24(1) 7Q82|1|C+7Q82|1|B+7Q82|1|A
724NR_3.0_94767.1
Exact match
synthetic construct
6O5F|1|D+6O5F|1|C (6O5F)
  • RNA (5'-R(P*CP*AP*AP*GP*GP*UP*CP*AP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2019-07-24
2.5 Å24(1) 6O5F|1|D+6O5F|1|C
725NR_3.0_02378.1
Exact match
synthetic construct
4P43|1|B+4P43|1|A (4P43)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*UP*C[...]
  • X-ray diffraction
  • Release Date: 2016-05-04
2.0 Å23(2) 4P43|1|B+4P43|1|A, 7EDN|1|A
726NR_3.0_21529.1
Exact match
synthetic construct
6OZO|1|C+6OZO|1|D (6OZO)
  • DNA/RNA (5'-R(*CP*GP*GP*UP*AP*AP*CP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2019-09-04
2.2 Å23(1) 6OZO|1|C+6OZO|1|D
727NR_3.0_21945.1
Exact match
3TS2|1|U (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 2011-11-16
2.0 Å23(1) 3TS2|1|U
728NR_3.0_23180.1
Exact match
1HYS|1|E (1HYS)
  • 5'-R(*UP*CP*AP*GP*CP*CP*AP*CP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2001-03-26
3.0 Å23(1) 1HYS|1|E
729NR_3.0_23264.1
Exact match
synthetic construct
7MKT|1|A (7MKT)
  • RNA (5'-R(*GP*UP*GP*UP*GP*UP*GP*UP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2022-11-02
2.0 Å23(1) 7MKT|1|A
730NR_3.0_32675.1
Exact match
3TS2|1|V (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 2011-11-16
2.0 Å23(1) 3TS2|1|V
731NR_3.0_36231.1
Exact match
2ANN|1|B (2ANN)
  • 5'-R(*CP*GP*CP*GP*CP*GP*GP*AP*UP*CP*AP*G[...]
  • X-ray diffraction
  • Release Date: 2006-10-24
2.3 Å23(2) 2ANN|1|B, 2ANR|1|B
732NR_3.0_41768.1
Exact match
Homo sapiens
7VFT|1|A (7VFT)
  • RNA (5'-R(*GP*GP*GP*CP*CP*AP*GP*CP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2022-06-15
1.5 Å23(1) 7VFT|1|A
733NR_3.0_45605.1
Exact match
Homo sapiens
5ED2|1|F+5ED2|1|E (5ED2)
  • RNA (5'-R(P*CP*AP*GP*AP*GP*CP*CP*CP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2016-04-13
3.0 Å23(2) 5ED2|1|F+5ED2|1|E, 5ED2|1|C+5ED2|1|B
734NR_3.0_54107.1
Exact match
Saccharomyces cerevisiae
5ED1|1|C+5ED1|1|B (5ED1)
  • RNA (5'-R(*GP*AP*CP*UP*GP*AP*AP*CP*GP*AP[...]
  • X-ray diffraction
  • Release Date: 2016-04-13
2.8 Å23(2) 5ED1|1|C+5ED1|1|B, 5HP2|1|C+5HP2|1|B
735NR_3.0_68957.1
Exact match
2PJP|1|B (2PJP)
  • SECIS RNA
  • X-ray diffraction
  • Release Date: 2007-10-30
2.3 Å23(1) 2PJP|1|B
736NR_3.0_78706.1
Exact match
1ZCI|1|A+1ZCI|1|B (1ZCI)
  • 5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2006-01-31
1.7 Å23(15) 1ZCI|1|A+1ZCI|1|B, 1ZCI|1|C+1ZCI|1|D, 2FD0|1|A+2FD0|1|B, 2B8S|1|A+2B8S|1|B, 2FCZ|1|A+2FCZ|1|B, 2FCZ|1|C+2FCZ|1|D, 2FCY|1|A+2FCY|1|B, 2B8R|1|A+2B8R|1|B, 1Y3S|1|A+1Y3S|1|B, 2FCX|1|A+2FCX|1|B, 1Y3O|1|A+1Y3O|1|B, 1YXP|1|A+1YXP|1|B, 1XPE|1|A+1XPE|1|B, 1XPF|1|A+1XPF|1|B, 1XP7|1|A+1XP7|1|B
737NR_3.0_01689.1
Exact match
synthetic construct
6KYV|1|G (6KYV)
  • RNA (5'-R(*GP*GP*UP*AP*GP*AP*CP*GP*CP*UP[...]
  • X-ray diffraction
  • Release Date: 2020-09-23
3.0 Å22(6) 6KYV|1|G, 6KYV|1|C, 6KYV|1|E, 6KYV|1|A, 6KYV|1|K, 6KYV|1|I
738NR_3.0_01901.1
Exact match
Homo sapiens
7KFN|1|B+7KFN|1|C (7KFN)
  • RNA (5'-R(*GP*CP*UP*CP*GP*CP*GP*AP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 2021-06-16
2.5 Å22(2) 7KFN|1|B+7KFN|1|C, 6D06|1|B+6D06|1|C
739NR_3.0_04792.1
Exact match
Human immunodeficiency virus 1
7KJV|1|C+7KJV|1|D (7KJV)
  • HIV-1 viral RNA fragment, tRNA lysine 3 [...]
  • Electron microscopy
  • Release Date: 2021-03-17
2.8 Å22(2) 7KJV|1|C+7KJV|1|D, 7KJW|1|C+7KJW|1|D
740NR_3.0_04852.2
Exact match
2UWM|1|D (2UWM)
  • 5'-R(*GP*GP*CP*GP*UP*UP*GP*CP*CP*GP*GP*U[...]
  • X-ray diffraction
  • Release Date: 2007-05-08
2.3 Å22(7) 2UWM|1|D, 2UWM|1|C, 2PLY|1|C, 2PLY|1|E, 1WSU|1|E, 1WSU|1|F, 1WSU|1|G
741NR_3.0_09579.1
Exact match
Saccharomyces
5C5W|1|A (5C5W)
  • RNA (5'-R(P*CP*CP*UP*GP*AP*GP*UP*UP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2015-10-14
1.3 Å22(1) 5C5W|1|A
742NR_3.0_14870.1
Exact match
3BOY|1|D (3BOY)
  • 5'-R(*UP*UP*UP*AP*GP*UP*UP*UP*UP*UP*AP*G[...]
  • X-ray diffraction
  • Release Date: 2008-01-15
1.7 Å22(1) 3BOY|1|D
743NR_3.0_18709.1
Exact match
Homo sapiens
7QI4|1|Aw (7QI4)
  • A/A-tRNA, mRNA
  • Electron microscopy
  • Release Date: 2022-07-13
2.2 Å22(1) 7QI4|1|Aw
744NR_3.0_25813.1
Exact match
3FTF|1|C+3FTF|1|D (3FTF)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-ray diffraction
  • Release Date: 2009-03-24
2.8 Å22(1) 3FTF|1|C+3FTF|1|D
745NR_3.0_25893.1
Exact match
Tetrahymena thermophila
4ERD|1|C+4ERD|1|D (4ERD)
  • 5'-R(P*GP*GP*UP*CP*GP*AP*CP*AP*UP*CP*UP*[...]
  • X-ray diffraction
  • Release Date: 2012-06-20
2.6 Å22(1) 4ERD|1|C+4ERD|1|D
746NR_3.0_31561.1
Exact match
synthetic construct
4P3T|1|A+4P3T|1|B (4P3T)
  • 5'-D(*UP*UP*GP*CP*GP*UP*CP*CP*CP*GP*(5BU[...]
  • X-ray diffraction
  • Release Date: 2016-05-04
1.6 Å22(1) 4P3T|1|A+4P3T|1|B
747NR_3.0_35088.1
Exact match
3LOA|1|B+3LOA|1|A (3LOA)
  • 5'-R(*GP*GP*GP*(5BU)P*GP*GP*UP*GP*AP*AP*[...]
  • X-ray diffraction
  • Release Date: 2010-08-04
2.3 Å22(1) 3LOA|1|B+3LOA|1|A
748NR_3.0_38099.1
Exact match
3BNR|1|C+3BNR|1|D (3BNR)
  • A site of human mitochondrial ribosome, [...]
  • X-ray diffraction
  • Release Date: 2008-06-24
2.1 Å22(6) 3BNR|1|C+3BNR|1|D, 3BNR|1|A+3BNR|1|B, 3BNS|1|C+3BNS|1|D, 3BNS|1|A+3BNS|1|B, 3BNQ|1|C+3BNQ|1|D, 3BNQ|1|A+3BNQ|1|B
749NR_3.0_48359.1
Exact match
synthetic construct
5UZ6|1|A (5UZ6)
  • RNA (25-MER), RNA (5'-D(*(RG))-R(P*CP*AP[...]
  • X-ray diffraction
  • Release Date: 2018-02-21
2.1 Å22(9) 5UZ6|1|A, 5UZ6|1|C, 5UZ6|1|E, 6BMD|1|C, 6BMD|1|A, 6BMD|1|E, 5V9Z|1|A, 5UX3|1|A, 5V0O|1|A
750NR_3.0_48589.1
Exact match
2O3V|1|A+2O3V|1|B (2O3V)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP[...]
  • X-ray diffraction
  • Release Date: 2007-11-06
2.8 Å22(1) 2O3V|1|A+2O3V|1|B
751NR_3.0_52030.1
Exact match
Aromatoleum aromaticum
6H9H|1|D (6H9H)
  • crRNA
  • X-ray diffraction
  • Release Date: 2018-09-26
1.8 Å22(3) 6H9H|1|D, 6H9I|1|C, 6H9I|1|E
752NR_3.0_52761.1
Exact match
3TD0|1|B+3TD0|1|A (3TD0)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP[...]
  • X-ray diffraction
  • Release Date: 2011-12-07
1.6 Å22(1) 3TD0|1|B+3TD0|1|A
753NR_3.0_53856.1
Exact match
synthetic construct
5JBG|1|X (5JBG)
  • RNA (5'-R(*GPPP*GP*AP*GP*CP*GP*UP*GP*CP*[...]
  • X-ray diffraction
  • Release Date: 2016-06-01
2.0 Å22(1) 5JBG|1|X
754NR_3.0_54657.1
Exact match
2O3Y|1|A+2O3Y|1|B (2O3Y)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2007-11-06
2.7 Å22(4) 2O3Y|1|A+2O3Y|1|B, 2G5K|1|A+2G5K|1|B, 2FQN|1|A+2FQN|1|B, 2O3W|1|A+2O3W|1|B
755NR_3.0_55295.1
Exact match
3FTE|1|C+3FTE|1|D (3FTE)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-ray diffraction
  • Release Date: 2009-03-24
3.0 Å22(1) 3FTE|1|C+3FTE|1|D
756NR_3.0_56099.1
Exact match
Drosophila melanogaster
6F4H|1|B (6F4H)
  • U1-SL2
  • X-ray diffraction
  • Release Date: 2018-06-20
2.0 Å22(2) 6F4H|1|B, 6F4H|1|F
757NR_3.0_59799.1
Exact match
2F8S|1|C+2F8S|1|D (2F8S)
  • 5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*AP*UP*[...]
  • X-ray diffraction
  • Release Date: 2006-10-31
3.0 Å22(1) 2F8S|1|C+2F8S|1|D
758NR_3.0_64766.1
Exact match
Drosophila melanogaster
6F4H|1|D (6F4H)
  • U1-SL2
  • X-ray diffraction
  • Release Date: 2018-06-20
2.0 Å22(1) 6F4H|1|D
759NR_3.0_70696.1
Exact match
synthetic construct
6L0Y|1|A (6L0Y)
  • RNA (5'-R(*GP*GP*UP*AP*GP*AP*CP*GP*CP*UP[...]
  • X-ray diffraction
  • Release Date: 2020-09-30
3.0 Å22(2) 6L0Y|1|A, 6L0Y|1|B
760NR_3.0_74199.1
Exact match
1NTA|1|A+1NTA|1|B (1NTA)
  • 5'-R(*GP*GP*AP*UP*CP*GP*CP*AP*UP*UP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2003-05-13
2.9 Å22(2) 1NTA|1|A+1NTA|1|B, 1NTB|1|A+1NTB|1|B
761NR_3.0_77275.1
Exact match
Leishmania
4K31|1|B+4K31|1|C (4K31)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2013-07-31
1.4 Å22(1) 4K31|1|B+4K31|1|C
762NR_3.0_80055.1
Exact match
1RLG|1|D (1RLG)
  • 25-MER
  • X-ray diffraction
  • Release Date: 2004-06-01
2.7 Å22(2) 1RLG|1|D, 1RLG|1|C
763NR_3.0_81112.1
Exact match
synthetic construct
6E7L|1|A (6E7L)
  • RNA (5'-R(*GP*GP*GP*CP*UP*GP*CP*AP*CP*UP[...]
  • X-ray diffraction
  • Release Date: 2019-07-31
2.6 Å22(1) 6E7L|1|A
764NR_3.0_86272.1
Exact match
3MEI|1|A+3MEI|1|B (3MEI)
  • RNA (5'-R(*CP*CP*GP*CP*CP*GP*CP*GP*CP*CP[...]
  • X-ray diffraction
  • Release Date: 2011-01-26
2.0 Å22(1) 3MEI|1|A+3MEI|1|B
765NR_3.0_86590.1
Exact match
synthetic construct
7PLI|1|C (7PLI)
  • RNA (5'-D(*(POP))-R(P*GP*GP*AP*CP*AP*UP*[...]
  • X-ray diffraction
  • Release Date: 2022-09-07
2.5 Å22(5) 7PLI|1|C, 7PLI|1|D, 7PLI|1|L, 7PLI|1|K, 7PLI|1|H
766NR_3.0_86801.1
Exact match
synthetic construct
6G3B|1|C (6G3B)
  • RNA (5'-R(P*GP*UP*AP*GP*GP*AP*CP*CP*AP*U[...]
  • X-ray diffraction
  • Release Date: 2019-04-10
1.8 Å22(1) 6G3B|1|C
767NR_3.0_93599.1
Exact match
5UDZ|1|W (5UDZ)
  • RNA (5'-R(*GP*GP*GP*GP*UP*AP*GP*UP*GP*AP[...]
  • X-ray diffraction
  • Release Date: 2017-03-22
2.0 Å22(4) 5UDZ|1|W, 5UDZ|1|V, 3TS0|1|V, 3TS0|1|U
768NR_3.0_95948.1
Exact match
synthetic construct
5VCI|1|A+5VCI|1|B (5VCI)
  • RNA (5'-R(*CP*UP*GP*CP*UP*GP*GP*CP*UP*AP[...]
  • X-ray diffraction
  • Release Date: 2018-02-21
2.6 Å22(6) 5VCI|1|A+5VCI|1|B, 5VGW|1|A+5VGW|1|B, 6U8F|1|A+6U8F|1|B, 5VCF|1|A+5VCF|1|B, 6U7Z|1|A+6U7Z|1|B, 6U7Y|1|A+6U7Y|1|B
769NR_3.0_07169.1
Exact match
synthetic construct
4P3U|1|B+4P3U|1|A (4P3U)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*(5BU[...]
  • X-ray diffraction
  • Release Date: 2016-05-04
3.0 Å21(1) 4P3U|1|B+4P3U|1|A
770NR_3.0_15094.1
Exact match
synthetic construct
6IA2|1|A+6IA2|1|B (6IA2)
  • RNA (5'-R(*AP*GP*AP*GP*AP*AP*CP*CP*CP*GP[...]
  • X-ray diffraction
  • Release Date: 2019-03-27
2.3 Å21(1) 6IA2|1|A+6IA2|1|B
771NR_3.0_17495.1
Exact match
3SSF|1|A (3SSF)
  • 5'-R(*UP*AP*AP*AP*AP*GP*AP*AP*AP*AP*GP*G[...]
  • X-ray diffraction
  • Release Date: 2012-02-08
1.6 Å21(1) 3SSF|1|A
772NR_3.0_17943.1
Exact match
synthetic construct
7PLI|1|G (7PLI)
  • RNA (5'-D(*(POP))-R(P*GP*GP*AP*CP*AP*UP*[...]
  • X-ray diffraction
  • Release Date: 2022-09-07
2.5 Å21(1) 7PLI|1|G
773NR_3.0_21191.1
Exact match
3BNT|1|A (3BNT)
  • A site of human mitochondrial ribosome
  • X-ray diffraction
  • Release Date: 2008-06-24
2.3 Å21(1) 3BNT|1|A
774NR_3.0_21658.1
Exact match
2ZKO|1|C+2ZKO|1|D (2ZKO)
  • RNA (5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2008-10-14
1.7 Å21(2) 2ZKO|1|C+2ZKO|1|D, 6ZLC|1|C+6ZLC|1|D
775NR_3.0_24009.1
Exact match
synthetic construct
5ID6|1|G (5ID6)
  • RNA (5'-R(P*AP*AP*UP*UP*UP*CP*UP*AP*CP*U[...]
  • X-ray diffraction
  • Release Date: 2016-04-27
2.4 Å21(1) 5ID6|1|G
776NR_3.0_26059.1
Exact match
synthetic construct
4P3U|1|C+4P3U|1|D (4P3U)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*(5BU[...]
  • X-ray diffraction
  • Release Date: 2016-05-04
3.0 Å21(1) 4P3U|1|C+4P3U|1|D
777NR_3.0_30433.1
Exact match
Homo sapiens
5EW4|1|B+5EW4|1|A (5EW4)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*CP*CP*CP*CP[...]
  • X-ray diffraction
  • Release Date: 2016-02-24
1.5 Å21(2) 5EW4|1|B+5EW4|1|A, 5EW7|1|B+5EW7|1|A
778NR_3.0_30485.1
Exact match
Homo sapiens
7OB9|1|R (7OB9)
  • RNA
  • Electron microscopy
  • Release Date: 2021-12-08
2.7 Å21(1) 7OB9|1|R
779NR_3.0_36712.2
Exact match
1ZL3|1|B (1ZL3)
  • 5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*UP*(FHU)P*[...]
  • X-ray diffraction
  • Release Date: 2005-08-09
2.8 Å21(5) 1ZL3|1|B, 2AB4|1|B, 1ZE2|1|C, 1ZE2|1|D, 1K8W|1|B
780NR_3.0_41922.1
Exact match
4KTG|1|B (4KTG)
  • 5'-R(P*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*[...]
  • X-ray diffraction
  • Release Date: 2014-05-21
1.9 Å21(2) 4KTG|1|B, 4KTG|1|E
781NR_3.0_45159.1
Exact match
4J50|1|A+4J50|1|B (4J50)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*UP*GP*CP[...]
  • X-ray diffraction
  • Release Date: 2013-02-20
1.7 Å21(3) 4J50|1|A+4J50|1|B, 3SYW|1|A+3SYW|1|B, 4YN6|1|A+4YN6|1|B
782NR_3.0_46403.1
Exact match
3BNN|1|C+3BNN|1|D (3BNN)
  • A site of human ribosome, A site of huma[...]
  • X-ray diffraction
  • Release Date: 2008-06-24
2.0 Å21(5) 3BNN|1|C+3BNN|1|D, 3BNN|1|A+3BNN|1|B, 3BNO|1|A+3BNO|1|B, 3BNO|1|C+3BNO|1|D, 3BNP|1|A+3BNP|1|B
783NR_3.0_47854.1
Exact match
Homo sapiens
7SXP|1|A (7SXP)
  • NRAS mRNA
  • X-ray diffraction
  • Release Date: 2023-05-31
2.9 Å21(1) 7SXP|1|A
784NR_3.0_51791.1
Exact match
3DH3|1|F+3DH3|1|E (3DH3)
  • stem loop fragment of E. Coli 23S RNA
  • X-ray diffraction
  • Release Date: 2009-04-28
3.0 Å21(2) 3DH3|1|F+3DH3|1|E, 3DH3|1|G+3DH3|1|H
785NR_3.0_52295.1
Exact match
Escherichia coli
2ET8|1|A+2ET8|1|B (2ET8)
  • EUBACTERIAL A-SITE, 5'-R(*CP*GP*CP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2005-12-13
2.5 Å21(3) 2ET8|1|A+2ET8|1|B, 1O9M|1|A+1O9M|1|B, 2F4U|1|A+2F4U|1|B
786NR_3.0_58991.1
Exact match
Mus musculus
5F5H|1|D (5F5H)
  • RNA (5'-R(P*CP*CP*AP*CP*AP*CP*CP*GP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2016-04-06
2.2 Å21(1) 5F5H|1|D
787NR_3.0_66424.1
Exact match
Vibrio phage ICP1_2011_A
7WKP|1|B (7WKP)
  • 3' stem loop crRNA
  • X-ray diffraction
  • Release Date: 2023-04-26
2.0 Å21(1) 7WKP|1|B
788NR_3.0_67439.2
Exact match
4PQU|1|T (4PQU)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2014-06-18
2.5 Å21(4) 4PQU|1|T, 4PQU|1|E, 4PUO|1|T, 4PUO|1|E
789NR_3.0_67574.1
Exact match
5F8N|1|B+5F8N|1|C (5F8N)
  • RNA (5'-R(P*GP*GP*GP*AP*GP*AP*UP*GP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2016-06-22
2.5 Å21(5) 5F8N|1|B+5F8N|1|C, 4K4W|1|B+4K4W|1|C, 4K4W|1|F+4K4W|1|G, 5F8M|1|B+5F8M|1|C, 5F8L|1|B+5F8L|1|C
790NR_3.0_70509.2
Exact match
Homo sapiens
7OOP|1|P (7OOP)
  • RNA
  • Electron microscopy
  • Release Date: 2021-10-06
2.9 Å21(3) 7OOP|1|P, 7OPD|1|P, 7OPC|1|P
791NR_3.0_71199.4
Exact match
5Z1I|1|A (5Z1I)
  • 5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2018-05-30
1.9 Å21(35) 5Z1I|1|A, 2PWT|1|A+2PWT|1|B, 5ZEG|1|A+5ZEG|1|B+5ZEG|1|C, 6JBF|1|A+6JBF|1|B, 3TD1|1|B+3TD1|1|A, 4K32|1|A+4K32|1|B, 5ZEI|1|A+5ZEI|1|B, 3BNL|1|A+3BNL|1|B, 7EDL|1|A+7EDL|1|B, 6JBF|1|C+6JBF|1|D, 4P3S|1|B+4P3S|1|A, 2ET5|1|A+2ET5|1|B, 4PDQ|1|A+4PDQ|1|B, 4GPY|1|A+4GPY|1|B, 7EDM|1|A+7EDM|1|B, 4GPW|1|A+4GPW|1|B, 1MWL|1|A+1MWL|1|B, 2ET4|1|A+2ET4|1|B, 4GPX|1|A+4GPX|1|B, 2ESJ|1|A+2ESJ|1|B, 5Z1H|1|B+5Z1H|1|A, 2ESI|1|A+2ESI|1|B, 4F8V|1|A+4F8V|1|B, 3WRU|1|A+3WRU|1|B, 4F8U|1|A+4F8U|1|B, 3S4P|1|A+3S4P|1|B, 4P20|1|A+4P20|1|B, 1LC4|1|A+1LC4|1|B, 2ET3|1|A+2ET3|1|B, 5Z71|1|B+5Z71|1|A, 2BE0|1|A+2BE0|1|B, 2BEE|1|A+2BEE|1|B, 1J7T|1|A+1J7T|1|B, 1YRJ|1|A+1YRJ|1|B, 2F4T|1|B+2F4T|1|A
792NR_3.0_72697.1
Exact match
1T0E|1|A+1T0E|1|C (1T0E)
  • 5'-R(*GP*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*C[...]
  • X-ray diffraction
  • Release Date: 2004-06-15
1.7 Å21(1) 1T0E|1|A+1T0E|1|C
793NR_3.0_82951.1
Exact match
2O3X|1|A+2O3X|1|B (2O3X)
  • 5'-R(P*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*[...]
  • X-ray diffraction
  • Release Date: 2007-11-06
2.9 Å21(2) 2O3X|1|A+2O3X|1|B, 2F4S|1|A+2F4S|1|B
794NR_3.0_86416.1
Exact match
synthetic construct
8FFI|1|C (8FFI)
  • guide RNA
  • Electron microscopy
  • Release Date: 2023-08-23
2.7 Å21(8) 8FFI|1|C, 8FFI|1|G, 8FFI|1|O, 8FFI|1|J, 8SPO|1|G, 8SPO|1|C, 8SPO|1|J, 8SPO|1|O
795NR_3.0_89230.1
Exact match
Mus musculus
5F5H|1|C (5F5H)
  • RNA (5'-R(P*CP*CP*AP*CP*AP*CP*CP*GP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2016-04-06
2.2 Å21(1) 5F5H|1|C
796NR_3.0_93859.1
Exact match
4J39|1|B (4J39)
  • 5'-R(P*CP*AP*GP*CP*AP*GP*CP*AP*GP*CP*CP*[...]
  • X-ray diffraction
  • Release Date: 2014-02-05
1.7 Å21(2) 4J39|1|B, 4J5V|1|B
797NR_3.0_99953.1
Exact match
1FEU|1|C+1FEU|1|B (1FEU)
  • 21 NT FRAGMENT OF 5S RRNA, 19 NT FRAGMEN[...]
  • X-ray diffraction
  • Release Date: 2001-06-25
2.3 Å21(2) 1FEU|1|C+1FEU|1|B, 1FEU|1|F+1FEU|1|E
798NR_3.0_04414.1
Exact match
synthetic construct
6TW1|1|V+6TW1|1|M (6TW1)
  • vRNA, mRNA
  • Electron microscopy
  • Release Date: 2020-04-15
2.7 Å20(2) 6TW1|1|V+6TW1|1|M, 6T0R|1|V
799NR_3.0_15508.1
Exact match
3TRZ|1|U (3TRZ)
  • RNA (5'-R(*GP*GP*GP*CP*AP*GP*GP*GP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 2011-11-16
2.9 Å20(6) 3TRZ|1|U, 3TRZ|1|X, 3TRZ|1|W, 3TRZ|1|V, 3TRZ|1|Y, 3TRZ|1|Z
800NR_3.0_16758.1
Exact match
Mus musculus
5F5F|1|B (5F5F)
  • RNA (5'-R(P*UP*GP*AP*CP*UP*GP*CP*GP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2016-04-06
3.0 Å20(3) 5F5F|1|B, 5F5F|1|D, 5F5F|1|H
801NR_3.0_17622.2
Exact match
Maribacter polysiphoniae
8OZE|1|A (8OZE)
  • RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*A[...]
  • Electron microscopy
  • Release Date: 2023-08-16
2.9 Å20(2) 8OZE|1|A, 8OZE|1|N
802NR_3.0_24985.1
Exact match
Mus musculus
6TQA|1|G (6TQA)
  • RNA (5'-R(P*GP*GP*UP*GP*CP*CP*UP*AP*AP*U[...]
  • X-ray diffraction
  • Release Date: 2020-05-27
2.4 Å20(4) 6TQA|1|G, 6TQA|1|E, 6TQA|1|F, 6TQA|1|H
803NR_3.0_25361.2
Exact match
4E48|1|A+4E48|1|B (4E48)
  • 5'-R(P*GP*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*[...]
  • X-ray diffraction
  • Release Date: 2012-07-11
2.5 Å20(3) 4E48|1|A+4E48|1|B, 4JNX|1|B+4JNX|1|G, 4E48|1|D
804NR_3.0_25585.3
Exact match
synthetic construct
4Z4D|1|B+4Z4D|1|D (4Z4D)
  • RNA (5'-R(P*UP*UP*CP*AP*CP*AP*UP*UP*GP*C[...]
  • X-ray diffraction
  • Release Date: 2015-09-23
1.6 Å20(11) 4Z4D|1|B+4Z4D|1|D, 4Z4E|1|B+4Z4E|1|D, 4W5O|1|B+4W5O|1|D, 4Z4C|1|B+4Z4C|1|D, 4Z4H|1|B+4Z4H|1|D, 6CBD|1|B+6CBD|1|C, 4Z4I|1|B+4Z4I|1|D, 4Z4G|1|B+4Z4G|1|D, 4W5T|1|B+4W5T|1|D, 4Z4F|1|B+4Z4F|1|D, 4W5R|1|B+4W5R|1|D
805NR_3.0_39506.1
Exact match
Mus musculus
5F5F|1|F (5F5F)
  • RNA (5'-R(P*UP*GP*AP*CP*UP*GP*CP*GP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2016-04-06
3.0 Å20(1) 5F5F|1|F
806NR_3.0_40086.1
Exact match
4JGN|1|E (4JGN)
  • 5'-R(P*UP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*[...]
  • X-ray diffraction
  • Release Date: 2014-03-05
1.9 Å20(2) 4JGN|1|E, 4JK0|1|B
807NR_3.0_41649.1
Exact match
6SQN|1|Y (6SQN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-ray diffraction
  • Release Date: 2020-05-13
2.1 Å20(9) 6SQN|1|Y, 6SQN|1|X, 6SQN|1|Z, 6SQQ|1|YYY, 6SQQ|1|XXX, 6SQQ|1|ZZZ, 1URN|1|P, 1URN|1|Q, 1URN|1|R
808NR_3.0_42560.1
Exact match
2ZI0|1|C+2ZI0|1|D (2ZI0)
  • RNA (5'-D(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2008-07-22
2.8 Å20(1) 2ZI0|1|C+2ZI0|1|D
809NR_3.0_53294.1
Exact match
1EC6|1|D (1EC6)
  • 20-MER RNA HAIRPIN
  • X-ray diffraction
  • Release Date: 2000-02-21
2.4 Å20(1) 1EC6|1|D
810NR_3.0_70550.1
Exact match
361D|1|B (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-ray diffraction
  • Release Date: 1998-07-01
3.0 Å20(1) 361D|1|B
811NR_3.0_73328.1
Exact match
4PWD|1|T (4PWD)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2014-06-18
3.0 Å20(2) 4PWD|1|T, 4PWD|1|E
812NR_3.0_73526.1
Exact match
361D|1|A (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-ray diffraction
  • Release Date: 1998-07-01
3.0 Å20(1) 361D|1|A
813NR_3.0_78931.1
Exact match
4KNQ|1|B (4KNQ)
  • 5'-R(P*CP*CP*GP*CP*CP*GP*CP*CP*GP*CP*CP*[...]
  • X-ray diffraction
  • Release Date: 2014-05-14
1.8 Å20(1) 4KNQ|1|B
814NR_3.0_79785.1
Exact match
Homo sapiens
6VRD|1|B (6VRD)
  • RNA (5'-R(*UP*GP*GP*CP*GP*AP*GP*UP*GP*GP[...]
  • X-ray diffraction
  • Release Date: 2021-02-10
1.3 Å20(1) 6VRD|1|B
815NR_3.0_83775.1
Exact match
Hepacivirus C
3TZR|1|A+3TZR|1|B (3TZR)
  • 5'-R(*CP*GP*AP*GP*GP*AP*AP*CP*UP*AP*CP*U[...]
  • X-ray diffraction
  • Release Date: 2012-03-21
2.2 Å20(1) 3TZR|1|A+3TZR|1|B
816NR_3.0_86334.1
Exact match
4LGT|1|E (4LGT)
  • stem-loop of 23S rRNA
  • X-ray diffraction
  • Release Date: 2013-11-20
1.3 Å20(2) 4LGT|1|E, 4LGT|1|F
817NR_3.0_88912.1
Exact match
Foot-and-mouth disease virus
7C2K|1|F+7C2K|1|G (7C2K)
  • RNA (29-MER), RNA (5'-R(*UP*GP*UP*UP*CP*[...]
  • Electron microscopy
  • Release Date: 2020-06-03
2.9 Å20(1) 7C2K|1|F+7C2K|1|G
818NR_3.0_94113.1
Exact match
1EC6|1|C (1EC6)
  • 20-MER RNA HAIRPIN
  • X-ray diffraction
  • Release Date: 2000-02-21
2.4 Å20(1) 1EC6|1|C
819NR_3.0_95559.1
Exact match
1R9F|1|C (1R9F)
  • 5'-R(*UP*CP*GP*AP*AP*GP*UP*AP*UP*UP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2004-01-27
1.9 Å20(4) 1R9F|1|C, 6BJG|1|C, 6BJH|1|C, 6BJV|1|C
820NR_3.0_98374.1
Exact match
2I82|1|F (2I82)
  • 5'-R(*GP*AP*GP*GP*GP*GP*AP*UP*UP*GP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2006-11-21
2.1 Å20(4) 2I82|1|F, 2I82|1|E, 2I82|1|G, 2I82|1|H
821NR_3.0_99773.1
Exact match
1R9F|1|B (1R9F)
  • 5'-R(*CP*GP*UP*AP*CP*GP*CP*GP*GP*AP*AP*U[...]
  • X-ray diffraction
  • Release Date: 2004-01-27
1.9 Å20(4) 1R9F|1|B, 6BJG|1|D, 6BJH|1|D, 6BJV|1|D
822NR_3.0_01008.1
Exact match
synthetic construct
8J62|1|X (8J62)
  • RNA (5'-R(*CP*GP*GP*UP*UP*GP*AP*UP*UP*GP[...]
  • Electron microscopy
  • Release Date: 2023-07-19
2.5 Å19(2) 8J62|1|X, 8J62|1|Y
823NR_3.0_01597.2
Exact match
synthetic construct
7NQ4|1|C (7NQ4)
  • RNA (5'-R(*AP*GP*CP*AP*CP*GP*GP*CP*UP*(N[...]
  • X-ray diffraction
  • Release Date: 2021-08-11
2.9 Å19(3) 7NQ4|1|C, 1Q2R|1|E, 1Q2R|1|F
824NR_3.0_08340.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7N0D|1|I+7N0D|1|L+7N0D|1|J (7N0D)
  • RNA (5'-R(*GP*GP*GP*GP*AP*UP*GP*UP*GP*AP[...]
  • Electron microscopy
  • Release Date: 2021-07-28
2.5 Å19(2) 7N0D|1|I+7N0D|1|L+7N0D|1|J, 7N0D|1|T+7N0D|1|K+7N0D|1|P
825NR_3.0_14136.1
Exact match
1DFU|1|M+1DFU|1|N (1DFU)
  • 5S RRNA
  • X-ray diffraction
  • Release Date: 1999-12-02
1.8 Å19(1) 1DFU|1|M+1DFU|1|N
826NR_3.0_14992.1
Exact match
Thermus thermophilus
5XPA|1|D (5XPA)
  • RNA (5'-R(P*AP*UP*AP*CP*AP*AP*CP*CP*GP*U[...]
  • X-ray diffraction
  • Release Date: 2018-04-18
2.9 Å19(1) 5XPA|1|D
827NR_3.0_16825.1
Exact match
1F27|1|A (1F27)
  • RNA (5'-R(*AP*CP*CP*GP*UP*CP*AP*GP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2000-06-12
1.3 Å19(1) 1F27|1|A
828NR_3.0_19645.1
Exact match
4QI2|1|G (4QI2)
  • RNA (5'-R(*AP*CP*AP*UP*GP*UP*UP*UP*UP*CP[...]
  • X-ray diffraction
  • Release Date: 2014-07-16
3.0 Å19(4) 4QI2|1|G, 4QI2|1|F, 4QI2|1|E, 4QI2|1|H
829NR_3.0_24846.1
Exact match
Cypovirus 1
6TY9|1|T+6TY9|1|N (6TY9)
  • Template RNA (5'-R(P*AP*AP*AP*AP*AP*AP*A[...]
  • Electron microscopy
  • Release Date: 2019-11-20
2.9 Å19(1) 6TY9|1|T+6TY9|1|N
830NR_3.0_30317.1
Exact match
synthetic construct
4RWN|1|B+4RWN|1|C (4RWN)
  • RNA (5'-R(*GP*GP*CP*UP*UP*UP*UP*GP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2015-05-20
2.0 Å19(4) 4RWN|1|B+4RWN|1|C, 4S3N|1|B+4S3N|1|C, 4RWP|1|B+4RWP|1|C, 4RWO|1|B+4RWO|1|C
831NR_3.0_33669.1
Exact match
4PY5|1|B (4PY5)
  • 5'-R(*GP*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2014-07-30
2.1 Å19(1) 4PY5|1|B
832NR_3.0_33790.1
Exact match
4K4U|1|B+4K4U|1|C+4K4U|1|D (4K4U)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2013-05-22
2.9 Å19(2) 4K4U|1|B+4K4U|1|C+4K4U|1|D, 4K4U|1|F+4K4U|1|G+4K4U|1|H
833NR_3.0_37848.1
Exact match
Homo sapiens
6HTU|1|D+6HTU|1|F (6HTU)
  • RNA (19-MER)
  • X-ray diffraction
  • Release Date: 2018-11-21
2.9 Å19(2) 6HTU|1|D+6HTU|1|F, 6HU6|1|A+6HU6|1|E
834NR_3.0_42626.1
Exact match
Escherichia coli
7OFZ|1|C (7OFZ)
  • RNA (5'-R(P*CP*CP*CP*CP*CP*CP*CP*CP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2021-10-27
2.6 Å19(1) 7OFZ|1|C
835NR_3.0_43251.1
Exact match
4AY2|1|C (4AY2)
  • 5'-R-PPP(GP*GP*CP*GP*CP*GP*GP*CP*UP*UP*C[...]
  • X-ray diffraction
  • Release Date: 2012-10-03
2.8 Å19(1) 4AY2|1|C
836NR_3.0_48564.1
Exact match
synthetic construct
6SX2|1|C+6SX2|1|D (6SX2)
  • RNA (5'-R(*GP*GP*UP*AP*AP*CP*UP*GP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2020-10-07
1.9 Å19(2) 6SX2|1|C+6SX2|1|D, 6SX0|1|C+6SX0|1|D
837NR_3.0_51076.1
Exact match
1QC0|1|C+1QC0|1|D (1QC0)
  • 5'-R(*GP*CP*AP*CP*CP*GP*UP*UP*GP*GP*UP*A[...]
  • X-ray diffraction
  • Release Date: 1999-11-11
1.6 Å19(1) 1QC0|1|C+1QC0|1|D
838NR_3.0_55642.1
Exact match
4KQ0|1|B+4KQ0|1|E (4KQ0)
  • 5'-R(P*GP*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*[...]
  • X-ray diffraction
  • Release Date: 2014-05-14
2.1 Å19(1) 4KQ0|1|B+4KQ0|1|E
839NR_3.0_62516.1
Exact match
3SJ2|1|A+3SJ2|1|B (3SJ2)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*GP*GP*CP[...]
  • X-ray diffraction
  • Release Date: 2011-08-03
1.4 Å19(1) 3SJ2|1|A+3SJ2|1|B
840NR_3.0_64208.1
Exact match
Haloarcula marismortui
5G4U|1|I+5G4U|1|J (5G4U)
  • HMKT-7
  • X-ray diffraction
  • Release Date: 2016-09-28
2.7 Å19(5) 5G4U|1|I+5G4U|1|J, 5G4U|1|A+5G4U|1|B, 5G4V|1|A+5G4V|1|B, 5G4V|1|E+5G4V|1|F, 5G4U|1|E+5G4U|1|F
841NR_3.0_66896.1
Exact match
Escherichia coli
5NDI|1|B (5NDI)
  • RNA (5'-R(*UP*UP*UP*GP*CP*AP*GP*GP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2017-05-31
2.6 Å19(4) 5NDI|1|B, 5NDI|1|A, 5NDI|1|C, 5NDI|1|D
842NR_3.0_70790.1
Exact match
4E5C|1|A+4E5C|1|B (4E5C)
  • 5'-R(P*GP*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*[...]
  • X-ray diffraction
  • Release Date: 2012-07-11
1.7 Å19(1) 4E5C|1|A+4E5C|1|B
843NR_3.0_79830.1
Exact match
Clostridium perfringens SM101
7EAG|1|C+7EAG|1|D+7EAG|1|E+7EAG|1|F+ 7EAG|1|A+7EAG|1|B (7EAG)
  • RNA (5'-R(*GP*UP*CP*UP*AP*UP*GP*AP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2021-06-02
2.5 Å19(1) 7EAG|1|C+7EAG|1|D+7EAG|1|E+7EAG|1|F+ 7EAG|1|A+7EAG|1|B
844NR_3.0_82438.1
Exact match
Homo sapiens
8AF0|1|C+8AF0|1|D (8AF0)
  • RNA (5'-R(*GP*CP*CP*CP*GP*CP*CP*UP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2022-09-14
2.4 Å19(1) 8AF0|1|C+8AF0|1|D
845NR_3.0_86744.1
Exact match
3SZX|1|A+3SZX|1|B (3SZX)
  • RNA (5'-R(P*UP*UP*GP*GP*GP*CP*CP*UP*GP*C[...]
  • X-ray diffraction
  • Release Date: 2012-04-25
2.2 Å19(1) 3SZX|1|A+3SZX|1|B
846NR_3.0_87252.1
Exact match
2Y8W|1|B (2Y8W)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2011-05-18
1.8 Å19(1) 2Y8W|1|B
847NR_3.0_88157.3
Exact match
Haloarcula marismortui
4CS1|1|A (4CS1)
  • 5'-(*GP*GP*CP*GP*AP*AP*GP*AP*AP*CP*CP*GP[...]
  • X-ray diffraction
  • Release Date: 2014-11-19
2.0 Å19(18) 4CS1|1|A, 6Q8U|1|A+6Q8U|1|B, 7EFG|1|A, 4C40|1|A, 5FJ0|1|C, 5FJ0|1|A+5FJ0|1|B, 7F8Z|1|I+7F8Z|1|J, 7F8Z|1|G+7F8Z|1|H, 7F8Z|1|A+7F8Z|1|B, 7F8Z|1|E+7F8Z|1|F, 7F8Z|1|C+7F8Z|1|D, 7EI9|1|A+7EI9|1|B, 7EFI|1|A, 7EFH|1|A, 7EIA|1|G+7EIA|1|H, 7EIA|1|A+7EIA|1|B, 7EIA|1|C+7EIA|1|D, 7EIA|1|E+7EIA|1|F
848NR_3.0_97675.1
Exact match
Homo sapiens
6N4O|1|C+6N4O|1|D (6N4O)
  • RNA (5'-R(P*UP*GP*GP*AP*GP*UP*GP*UP*GP*A[...]
  • X-ray diffraction
  • Release Date: 2019-05-08
2.9 Å19(1) 6N4O|1|C+6N4O|1|D
849NR_3.0_98705.4
Exact match
2P7E|1|D+2P7E|1|C+2P7E|1|P (2P7E)
  • 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2007-05-22
2.1 Å19(17) 2P7E|1|D+2P7E|1|C+2P7E|1|P, 2NPY|1|D+2NPY|1|C+2NPY|1|A+2NPY|1|B, 1ZFT|1|D+1ZFT|1|C+1ZFT|1|A+1ZFT|1|B, 2P7F|1|D+2P7F|1|C+2P7F|1|A+2P7F|1|B, 1ZFV|1|D+1ZFV|1|C+1ZFV|1|A+1ZFV|1|B, 2OUE|1|D+2OUE|1|C+2OUE|1|A+2OUE|1|B, 2P7D|1|D+2P7D|1|C+2P7D|1|P, 2D2L|1|D+2D2L|1|C+2D2L|1|A+2D2L|1|B, 2FGP|1|D+2FGP|1|C+2FGP|1|A+2FGP|1|B, 1X9C|1|D+1X9C|1|C+1X9C|1|A+1X9C|1|B, 1ZFX|1|D+1ZFX|1|C+1ZFX|1|A+1ZFX|1|B, 2BCZ|1|D+2BCZ|1|C+2BCZ|1|A+2BCZ|1|B, 2D2K|1|D+2D2K|1|C+2D2K|1|A+2D2K|1|B, 2BCY|1|D+2BCY|1|C+2BCY|1|A+2BCY|1|B, 4G6R|1|D+4G6R|1|C+4G6R|1|A+4G6R|1|B, 3GS8|1|D+3GS8|1|C+3GS8|1|A+3GS8|1|B, 3GS1|1|D+3GS1|1|C+3GS1|1|A+3GS1|1|B
850NR_3.0_98769.1
Exact match
synthetic construct
8H0I|1|X (8H0I)
  • RNA (5'-R(*CP*GP*GP*UP*UP*GP*AP*UP*CP*GP[...]
  • Electron microscopy
  • Release Date: 2023-07-19
2.8 Å19(2) 8H0I|1|X, 8H0I|1|Y
851NR_3.0_99291.1
Exact match
2QKB|1|C (2QKB)
  • 5'-R(*GP*GP*AP*GP*UP*GP*CP*GP*AP*CP*AP*C[...]
  • X-ray diffraction
  • Release Date: 2007-11-13
2.4 Å19(1) 2QKB|1|C
852NR_3.0_00536.1
Exact match
4GHL|1|E (4GHL)
  • short palindromic RNA AGACAGCAUAUGCUGUCU
  • X-ray diffraction
  • Release Date: 2012-11-28
2.0 Å18(2) 4GHL|1|E, 4GHL|1|F
853NR_3.0_01810.1
Exact match
3KS8|1|E+3KS8|1|F (3KS8)
  • 5'-R(*AP*GP*AP*AP*GP*GP*AP*GP*GP*GP*AP*G[...]
  • X-ray diffraction
  • Release Date: 2010-01-12
2.4 Å18(1) 3KS8|1|E+3KS8|1|F
854NR_3.0_05919.1
Exact match
Rhodobacter sphaeroides
6D9L|1|C (6D9L)
  • RNA (5'-R(P*UP*UP*AP*CP*UP*GP*CP*GP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2018-07-25
2.6 Å18(2) 6D9L|1|C, 6D9L|1|H
855NR_3.0_06402.1
Exact match
Pseudomonas aeruginosa
4AL5|1|B (4AL5)
  • 5'-R(*UP*UP*CP*AP*CP*UP*GP*CP*CP*GP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2012-06-13
2.0 Å18(2) 4AL5|1|B, 4AL7|1|B
856NR_3.0_07714.1
Exact match
synthetic construct
6LSF|1|C+6LSF|1|B (6LSF)
  • RNA (5'-R(*UP*GP*UP*UP*CP*GP*AP*CP*GP*AP[...]
  • X-ray diffraction
  • Release Date: 2020-04-29
2.2 Å18(1) 6LSF|1|C+6LSF|1|B
857NR_3.0_12111.2
Exact match
Rhodobacter sphaeroides
6D8A|1|C (6D8A)
  • RNA (5'-R(P*UP*UP*AP*CP*UP*GP*CP*AP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2018-07-25
2.3 Å18(12) 6D8A|1|C, 6D92|1|C, 6D92|1|H, 6D8P|1|E, 6D8P|1|C, 6D8A|1|H, 6D9K|1|H, 6D9K|1|C, 6D95|1|B, 6D95|1|H, 6D8F|1|C, 6D8F|1|H
858NR_3.0_13250.1
Exact match
4QIK|1|C+4QIK|1|D (4QIK)
  • 5'-R(*AP*C*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 2014-07-16
1.9 Å18(1) 4QIK|1|C+4QIK|1|D
859NR_3.0_13603.1
Exact match
Tribolium castaneum
7KQN|1|E (7KQN)
  • RNA (5'-R(*CP*AP*AP*AP*GP*AP*AP*AP*UP*CP[...]
  • X-ray diffraction
  • Release Date: 2022-03-23
2.0 Å18(2) 7KQN|1|E, 7KQN|1|B
860NR_3.0_21087.1
Exact match
Sulfolobus acidocaldarius DSM 639
8HKU|1|AETN (8HKU)
  • E-site tRNA
  • Electron microscopy
  • Release Date: 2023-08-16
2.7 Å18(1) 8HKU|1|AETN
861NR_3.0_21738.1
Exact match
Influenza B virus
6SZV|1|R+6SZV|1|M (6SZV)
  • 3' vRNA, Capped mRNA
  • Electron microscopy
  • Release Date: 2020-04-15
2.5 Å18(1) 6SZV|1|R+6SZV|1|M
862NR_3.0_24738.1
Exact match
2Y9H|1|H (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2011-05-18
2.5 Å18(2) 2Y9H|1|H, 2Y9H|1|D
863NR_3.0_25125.1
Exact match
3GM7|1|G+3GM7|1|H (3GM7)
  • 5'-R(*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2009-05-26
1.6 Å18(2) 3GM7|1|G+3GM7|1|H, 1ZEV|1|A+1ZEV|1|B
864NR_3.0_27182.1
Exact match
4M59|1|D (4M59)
  • psaJ RNA
  • X-ray diffraction
  • Release Date: 2013-10-30
2.5 Å18(2) 4M59|1|D, 4OE1|1|D
865NR_3.0_30288.1
Exact match
4IG8|1|B+4IG8|1|C (4IG8)
  • RNA (5'-R(*GP*GP*CP*UP*UP*UP*UP*GP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2013-01-16
2.7 Å18(1) 4IG8|1|B+4IG8|1|C
866NR_3.0_33059.1
Exact match
Homo sapiens
4X4U|1|G (4X4U)
  • human MenBeta minihelix
  • X-ray diffraction
  • Release Date: 2015-02-11
2.7 Å18(1) 4X4U|1|G
867NR_3.0_38877.1
Exact match
1KFO|1|A (1KFO)
  • 5'-R(*GP*AP*AP*UP*GP*CP*CP*UP*GP*CP*GP*A[...]
  • X-ray diffraction
  • Release Date: 2001-12-07
1.6 Å18(1) 1KFO|1|A
868NR_3.0_43992.1
Exact match
synthetic construct
5AWH|1|C (5AWH)
  • RNA (5'-D(P*UP*UP*AP*CP*AP*AP*CP*CP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2016-07-06
2.0 Å18(2) 5AWH|1|C, 5AWH|1|E
869NR_3.0_46586.1
Exact match
2Y9H|1|J (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2011-05-18
2.5 Å18(2) 2Y9H|1|J, 2Y9H|1|L
870NR_3.0_51674.1
Exact match
3BT7|1|D (3BT7)
  • RNA (5'-D(P*GP*CP*UP*GP*UP*GP*(5MU)P*UP*[...]
  • X-ray diffraction
  • Release Date: 2008-04-29
2.4 Å18(2) 3BT7|1|D, 3BT7|1|C
871NR_3.0_52453.4
Exact match
3OL9|1|B+3OL9|1|F+3OL9|1|C+3OL9|1|G+ 3OL9|1|D+3OL9|1|H (3OL9)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2010-12-22
2.3 Å18(10) 3OL9|1|B+3OL9|1|F+3OL9|1|C+3OL9|1|G+ 3OL9|1|D+3OL9|1|H, 3OL9|1|J+3OL9|1|N+3OL9|1|K+3OL9|1|O+ 3OL9|1|L+3OL9|1|P, 3OLB|1|J+3OLB|1|N+3OLB|1|K+3OLB|1|O+ 3OLB|1|L+3OLB|1|P, 3OLB|1|B+3OLB|1|F+3OLB|1|C+3OLB|1|G+ 3OLB|1|D+3OLB|1|H, 3OL6|1|B+3OL6|1|F+3OL6|1|C+3OL6|1|G+ 3OL6|1|D+3OL6|1|H, 3OL6|1|J+3OL6|1|N+3OL6|1|K+3OL6|1|O+ 3OL6|1|L+3OL6|1|P, 3OL8|1|B+3OL8|1|F+3OL8|1|C+3OL8|1|G+ 3OL8|1|D+3OL8|1|H, 3OL7|1|J+3OL7|1|N+3OL7|1|K+3OL7|1|O+ 3OL7|1|L+3OL7|1|P, 3OL7|1|B+3OL7|1|F+3OL7|1|C+3OL7|1|G+ 3OL7|1|D+3OL7|1|H, 3OL8|1|J+3OL8|1|N+3OL8|1|K+3OL8|1|O+ 3OL8|1|L+3OL8|1|P
872NR_3.0_53005.1
Exact match
synthetic construct
5NXT|1|U (5NXT)
  • RNA (5'-R(*UP*GP*UP*UP*CP*UP*CP*UP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2017-11-29
1.4 Å18(1) 5NXT|1|U
873NR_3.0_54156.1
Exact match
Homo sapiens
5EME|1|A (5EME)
  • RNA (5'-R(*GP*CP*AP*GP*CP*AP*GP*C)-3')
  • X-ray diffraction
  • Release Date: 2016-01-13
1.2 Å18(1) 5EME|1|A
874NR_3.0_54314.1
Exact match
Thermus thermophilus
5XPG|1|G (5XPG)
  • RNA (5'-R(P*UP*AP*CP*AP*AP*CP*CP*UP*AP*C[...]
  • X-ray diffraction
  • Release Date: 2018-04-18
2.8 Å18(2) 5XPG|1|G, 5XOW|1|G
875NR_3.0_63269.1
Exact match
Haloarcula marismortui
6Q8V|1|A (6Q8V)
  • RNA (5'-R(*GP*GP*CP*GP*AP*AP*GP*(6MZ)P*A[...]
  • X-ray diffraction
  • Release Date: 2019-07-03
2.1 Å18(1) 6Q8V|1|A
876NR_3.0_72322.1
Exact match
2Y9H|1|F (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2011-05-18
2.5 Å18(2) 2Y9H|1|F, 2Y9H|1|B
877NR_3.0_72335.1
Exact match
5MSF|1|R (5MSF)
  • 5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*UP*CP*AP*C[...]
  • X-ray diffraction
  • Release Date: 1998-11-11
2.8 Å18(2) 5MSF|1|R, 5MSF|1|S
878NR_3.0_73487.1
Exact match
2QK9|1|B (2QK9)
  • 5'-R(*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*CP*U[...]
  • X-ray diffraction
  • Release Date: 2007-11-13
2.6 Å18(1) 2QK9|1|B
879NR_3.0_78183.1
Exact match
2Y8Y|1|B (2Y8Y)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2011-05-18
1.4 Å18(1) 2Y8Y|1|B
880NR_3.0_83036.1
Exact match
synthetic construct
4W5N|1|B (4W5N)
  • RNA (5'-R(P*UP*UP*CP*AP*CP*AP*UP*UP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2014-11-12
2.9 Å18(1) 4W5N|1|B
881NR_3.0_98794.1
Exact match
Influenza B virus
8BE0|1|M+8BE0|1|R (8BE0)
  • mRNA, 3' vRNA
  • Electron microscopy
  • Release Date: 2022-12-28
2.3 Å18(3) 8BE0|1|M+8BE0|1|R, 7R1F|1|M+7R1F|1|R, 8BDR|1|M+8BDR|1|R
882NR_3.0_99929.1
Exact match
synthetic construct
7UND|1|P (7UND)
  • RNA
  • Electron microscopy
  • Release Date: 2022-10-19
3.0 Å18(1) 7UND|1|P
883NR_3.0_04268.1
Exact match
Panicum mosaic virus
4V99|1|C2 (4V99)
  • 5'-R(P*UP*UP*AP*AP*UP*AP*UP*UP*UP*UP*UP*[...]
  • X-ray diffraction
  • Release Date: 2014-07-09
2.9 Å17(120) 4V99|1|C2, 4V99|1|Ec, 4V99|1|FD, 4V99|1|Ac, 4V99|1|AX, 4V99|1|GX, 4V99|1|FI, 4V99|1|Bh, 4V99|1|AN, 4V99|1|F7, 4V99|1|CS, 4V99|1|Ch, 4V99|1|AS, 4V99|1|Am, 4V99|1|DS, 4V99|1|Dc, 4V99|1|Jw, 4V99|1|Eh, 4V99|1|Bw, 4V99|1|Fw, 4V99|1|HS, 4V99|1|HX, 4V99|1|B7, 4V99|1|E7, 4V99|1|Aw, 4V99|1|FS, 4V99|1|Bc, 4V99|1|Bm, 4V99|1|ED, 4V99|1|EN, 4V99|1|Ic, 4V99|1|BN, 4V99|1|Em, 4V99|1|AI, 4V99|1|Er, 4V99|1|JD, 4V99|1|G7, 4V99|1|G2, 4V99|1|Iw, 4V99|1|EX, 4V99|1|HI, 4V99|1|Jh, 4V99|1|Jr, 4V99|1|B2, 4V99|1|D2, 4V99|1|DD, 4V99|1|BX, 4V99|1|Ah, 4V99|1|EI, 4V99|1|Gr, 4V99|1|Ir, 4V99|1|ES, 4V99|1|Br, 4V99|1|Cw, 4V99|1|I2, 4V99|1|C7, 4V99|1|D7, 4V99|1|Hr, 4V99|1|GS, 4V99|1|I7, 4V99|1|BI, 4V99|1|Fh, 4V99|1|Hc, 4V99|1|Dw, 4V99|1|Gc, 4V99|1|BS, 4V99|1|Jc, 4V99|1|Dm, 4V99|1|Ew, 4V99|1|Ar, 4V99|1|Cr, 4V99|1|CN, 4V99|1|IX, 4V99|1|IN, 4V99|1|J7, 4V99|1|E2, 4V99|1|DI, 4V99|1|Jm, 4V99|1|DN, 4V99|1|Cc, 4V99|1|BD, 4V99|1|FX, 4V99|1|DX, 4V99|1|AD, 4V99|1|Ih, 4V99|1|A2, 4V99|1|JX, 4V99|1|HD, 4V99|1|JN, 4V99|1|CI, 4V99|1|Fr, 4V99|1|CX, 4V99|1|CD, 4V99|1|Cm, 4V99|1|HN, 4V99|1|H7, 4V99|1|II, 4V99|1|H2, 4V99|1|Im, 4V99|1|Fm, 4V99|1|F2, 4V99|1|Fc, 4V99|1|GI, 4V99|1|A7, 4V99|1|Gh, 4V99|1|ID, 4V99|1|Hm, 4V99|1|Hh, 4V99|1|GN, 4V99|1|JI, 4V99|1|Dr, 4V99|1|FN, 4V99|1|Hw, 4V99|1|Gw, 4V99|1|J2, 4V99|1|GD, 4V99|1|Dh, 4V99|1|JS, 4V99|1|IS, 4V99|1|Gm
884NR_3.0_05271.1
Exact match
SFTS virus AH12
8AS7|1|P+8AS7|1|T+8AS7|1|G (8AS7)
  • RNA (5'-R(*AP*CP*AP*CP*AP*GP*AP*GP*AP*CP[...]
  • Electron microscopy
  • Release Date: 2023-01-18
2.6 Å17(2) 8AS7|1|P+8AS7|1|T+8AS7|1|G, 8ASD|1|P
885NR_3.0_09443.2
Exact match
4K4S|1|B+4K4S|1|F+4K4S|1|C+4K4S|1|G+ 4K4S|1|D+4K4S|1|H (4K4S)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2013-05-22
2.4 Å17(3) 4K4S|1|B+4K4S|1|F+4K4S|1|C+4K4S|1|G+ 4K4S|1|D+4K4S|1|H, 4K4T|1|F+4K4T|1|G+4K4T|1|H, 4K4T|1|B+4K4T|1|C+4K4T|1|D
886NR_3.0_10920.1
Exact match
Homo sapiens
4ZLD|1|B (4ZLD)
  • RNA (5'-R(*UP*AP*AP*CP*UP*UP*CP*UP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2015-08-19
1.6 Å17(1) 4ZLD|1|B
887NR_3.0_15533.1
Exact match
2Y9H|1|N (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2011-05-18
2.5 Å17(2) 2Y9H|1|N, 2Y9H|1|P
888NR_3.0_18317.1
Exact match
SFTS virus AH12
8ASD|1|T+8ASD|1|G (8ASD)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*GP*AP*UP*C[...]
  • Electron microscopy
  • Release Date: 2023-01-18
2.6 Å17(1) 8ASD|1|T+8ASD|1|G
889NR_3.0_26846.1
Exact match
1JBR|1|C+1JBR|1|F (1JBR)
  • 5'-R(*GP*CP*GP*CP*UP*CP*CP*UP*CP*AP*GP*U[...]
  • X-ray diffraction
  • Release Date: 2001-10-26
2.2 Å17(1) 1JBR|1|C+1JBR|1|F
890NR_3.0_29353.1
Exact match
4QQB|1|P (4QQB)
  • msl2 mRNA
  • X-ray diffraction
  • Release Date: 2014-09-03
2.8 Å17(2) 4QQB|1|P, 4QQB|1|C
891NR_3.0_29537.1
Exact match
synthetic construct
6BHJ|1|E (6BHJ)
  • 38-MER RNA-DNA Aptamer
  • X-ray diffraction
  • Release Date: 2018-10-31
2.8 Å17(2) 6BHJ|1|E, 6BHJ|1|F
892NR_3.0_31263.1
Exact match
4ILL|1|R (4ILL)
  • RNA (5'-R(*GP*CP*UP*AP*AP*UP*CP*UP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2013-03-20
2.5 Å17(2) 4ILL|1|R, 4ILL|1|C
893NR_3.0_33835.1
Exact match
Escherichia coli
2JLT|1|A (2JLT)
  • R06, TAR
  • X-ray diffraction
  • Release Date: 2009-08-18
2.9 Å17(1) 2JLT|1|A
894NR_3.0_41718.1
Exact match
4KYY|1|A+4KYY|1|B (4KYY)
  • RNA 17-mer
  • X-ray diffraction
  • Release Date: 2013-06-12
2.4 Å17(1) 4KYY|1|A+4KYY|1|B
895NR_3.0_43622.1
Exact match
Homo sapiens
1E7K|1|C (1E7K)
  • RNA (5'-R(*GP*CP*CP*AP*AP*UP*GP*AP*GP*GP[...]
  • X-ray diffraction
  • Release Date: 2001-02-19
2.9 Å17(2) 1E7K|1|C, 1E7K|1|D
896NR_3.0_43901.1
Exact match
1R3E|1|D+1R3E|1|E (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*UP*CP*GP*AP*UP*C[...]
  • X-ray diffraction
  • Release Date: 2003-11-04
2.1 Å17(1) 1R3E|1|D+1R3E|1|E
897NR_3.0_53904.1
Exact match
Influenza A virus
7QTL|1|M+7QTL|1|R (7QTL)
  • mRNA, 3' vRNA
  • Electron microscopy
  • Release Date: 2022-12-28
2.5 Å17(1) 7QTL|1|M+7QTL|1|R
898NR_3.0_54661.1
Exact match
2GJW|1|I+2GJW|1|J+2GJW|1|L (2GJW)
  • 5'-R(*GP*CP*GP*AP*CP*CP*GP*AP*CP*CP*AP*([...]
  • X-ray diffraction
  • Release Date: 2006-09-12
2.9 Å17(2) 2GJW|1|I+2GJW|1|J+2GJW|1|L, 2GJW|1|E+2GJW|1|F+2GJW|1|H
899NR_3.0_69209.1
Exact match
La Crosse orthobunyavirus
7ORN|1|H+7ORN|1|T (7ORN)
  • RNA (5'-R(P*AP*CP*GP*AP*GP*UP*GP*UP*CP*G[...]
  • Electron microscopy
  • Release Date: 2022-02-16
2.8 Å17(2) 7ORN|1|H+7ORN|1|T, 7ORO|1|H+7ORO|1|S
900NR_3.0_73746.1
Exact match
2OE5|1|B+2OE5|1|A (2OE5)
  • RNA (5'-R(*GP*GP*UP*AP*CP*UP*AP*AP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2007-02-13
1.5 Å17(1) 2OE5|1|B+2OE5|1|A
901NR_3.0_73803.1
Exact match
synthetic construct
5VOE|1|A (5VOE)
  • Aptamer 11F7t (36-MER), DNA/RNA (36-MER)
  • X-ray diffraction
  • Release Date: 2018-06-20
2.0 Å17(2) 5VOE|1|A, 5VOF|1|A
902NR_3.0_75945.1
Exact match
2OE8|1|B+2OE8|1|A (2OE8)
  • RNA (5'-R(*CP*GP*GP*UP*AP*CP*UP*AP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2007-02-13
1.8 Å17(2) 2OE8|1|B+2OE8|1|A, 2OE6|1|B+2OE6|1|A
903NR_3.0_81896.1
Exact match
3GLP|1|B+3GLP|1|A (3GLP)
  • 5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'
  • X-ray diffraction
  • Release Date: 2009-05-26
1.2 Å17(3) 3GLP|1|B+3GLP|1|A, 3GLP|1|C+3GLP|1|D, 3GLP|1|E
904NR_3.0_91124.3
Exact match
Gloeobacter violaceus
6HC5|1|A (6HC5)
  • RNA (5'-R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP[...]
  • X-ray diffraction
  • Release Date: 2019-02-20
1.4 Å17(9) 6HC5|1|A, 5NEP|1|A, 6HBX|1|A, 6HBT|1|A, 5NEX|1|A, 5NEO|1|A, 5NEQ|1|A, 5NEF|1|A, 5NOM|1|A
905NR_3.0_91810.1
Exact match
Escherichia coli
7OG0|1|E (7OG0)
  • RNA (5'-R(P*CP*CP*CP*CP*CP*CP*CP*CP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2021-10-27
2.6 Å17(2) 7OG0|1|E, 7OG0|1|D
906NR_3.0_95596.1
Exact match
Bacillus subtilis subsp. subtilis str. 168
8H1B|1|C (8H1B)
  • RNA (5'-R(*AP*CP*GP*GP*AP*CP*UP*UP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 2023-01-25
1.6 Å17(4) 8H1B|1|C, 8H1B|1|D, 8H0S|1|Y, 8H0S|1|X
907NR_3.0_02070.1
Exact match
Senecavirus A
5CNR|1|A+5CNR|1|B (5CNR)
  • RNA (5'-R(*GP*UP*CP*UP*AP*CP*CP*CP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2016-03-09
2.6 Å16(2) 5CNR|1|A+5CNR|1|B, 5CNR|1|E+5CNR|1|F
908NR_3.0_06970.1
Exact match
4GG4|1|H (4GG4)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*AP*UP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2012-10-03
2.5 Å16(1) 4GG4|1|H
909NR_3.0_12687.1
Exact match
synthetic construct
4RBZ|1|A (4RBZ)
  • 5'-R(*CP*GP*CP*GP*(A2M)P*(ADS)P*UP*UP*AP[...]
  • X-ray diffraction
  • Release Date: 2015-09-16
1.2 Å16(1) 4RBZ|1|A
910NR_3.0_13485.1
Exact match
1U1Y|1|R (1U1Y)
  • 5'-R(*CP*CP*GP*GP*(2PR)P*GP*GP*AP*UP*CP*[...]
  • X-ray diffraction
  • Release Date: 2004-12-07
2.9 Å16(2) 1U1Y|1|R, 1U1Y|1|S
911NR_3.0_19377.2
Exact match
Influenza A virus
5M3H|1|V+5M3H|1|R (5M3H)
  • RNA 5'-pAGUAGUAACAAGAGGG, RNA (5'-R(*UP*[...]
  • X-ray diffraction
  • Release Date: 2016-12-21
2.5 Å16(4) 5M3H|1|V+5M3H|1|R, 6FHH|1|V+6FHH|1|R, 6FHI|1|V+6FHI|1|R, 6EVK|1|V+6EVK|1|R
912NR_3.0_22464.1
Exact match
1R3E|1|C (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*(FHU)P*CP*GP*AP*[...]
  • X-ray diffraction
  • Release Date: 2003-11-04
2.1 Å16(1) 1R3E|1|C
913NR_3.0_27657.1
Exact match
Pseudomonas aeruginosa
5VJ9|1|C (5VJ9)
  • RNA (5'-R(*GP*CP*GP*GP*GP*GP*AP*CP*GP*AP[...]
  • X-ray diffraction
  • Release Date: 2017-06-28
1.6 Å16(8) 5VJ9|1|C, 5VJ9|1|D, 5VJ9|1|B, 5VJ9|1|A, 5VJB|1|D, 5VJB|1|A, 5VJB|1|C, 5VJB|1|B
914NR_3.0_29002.1
Exact match
unidentified influenza virus
4WSB|1|V+4WSB|1|R (4WSB)
  • Influenza A polymerase vRNA promoter 5' [...]
  • X-ray diffraction
  • Release Date: 2014-11-19
2.7 Å16(1) 4WSB|1|V+4WSB|1|R
915NR_3.0_29649.1
Exact match
3ND3|1|A (3ND3)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2011-09-21
1.4 Å16(1) 3ND3|1|A
916NR_3.0_30553.1
Exact match
Homo sapiens
7MQA|1|L0 (7MQA)
  • 5'ETS rRNA
  • Electron microscopy
  • Release Date: 2021-09-22
  • Standardized name: miR-663
  • Source: Eukarya
  • Rfam: RF00957
2.7 Å16(1) 7MQA|1|L0
917NR_3.0_32676.1
Exact match
2F8K|1|B (2F8K)
  • 5'-R(*UP*AP*AP*UP*CP*UP*UP*UP*GP*AP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2006-01-24
2.0 Å16(1) 2F8K|1|B
918NR_3.0_33763.1
Exact match
3D0M|1|X (3D0M)
  • RNA (5'-R(*GP*UP*GP*GP*UP*CP*UP*GP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 2008-09-09
2.0 Å16(1) 3D0M|1|X
919NR_3.0_35629.1
Exact match
2O5I|1|Y (2O5I)
  • 5'-R(P*GP*AP*GP*UP*CP*UP*GP*CP*GP*GP*CP*[...]
  • X-ray diffraction
  • Release Date: 2007-07-03
2.5 Å16(6) 2O5I|1|Y, 2O5J|1|H, 2O5I|1|H, 2O5J|1|Y, 2PPB|1|Y, 2PPB|1|H
920NR_3.0_37454.1
Exact match
synthetic construct
5XWG|1|A (5XWG)
  • RNA (5'-R(P*CP*GP*CP*UP*(5BU)P*CP*GP*AP*[...]
  • X-ray diffraction
  • Release Date: 2017-10-11
3.0 Å16(1) 5XWG|1|A
921NR_3.0_38607.1
Exact match
Saccharomyces cerevisiae
7A9W|1|B (7A9W)
  • RNA (5'-R(*AP*UP*AP*AP*AP*AP*UP*AP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2021-04-07
2.6 Å16(1) 7A9W|1|B
922NR_3.0_40155.1
Exact match
La Crosse orthobunyavirus
5AMR|1|B+5AMR|1|C (5AMR)
  • RNA
  • X-ray diffraction
  • Release Date: 2015-06-03
2.6 Å16(2) 5AMR|1|B+5AMR|1|C, 5AMQ|1|B+5AMQ|1|c
923NR_3.0_43274.1
Exact match
Senecavirus A
4P97|1|A+4P97|1|B (4P97)
  • RNA (5'-R(*CP*GP*UP*CP*UP*AP*CP*CP*CP*AP[...]
  • X-ray diffraction
  • Release Date: 2015-03-04
1.9 Å16(2) 4P97|1|A+4P97|1|B, 4P97|1|C+4P97|1|D
924NR_3.0_43598.1
Exact match
synthetic construct
5KVJ|1|A+5KVJ|1|B (5KVJ)
  • RNA (5'-R(P*CP*CP*AP*UP*CP*CP*UP*CP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2016-08-03
2.3 Å16(1) 5KVJ|1|A+5KVJ|1|B
925NR_3.0_47141.1
Exact match
synthetic construct
4RC0|1|A (4RC0)
  • 5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*(A2M)P*(2S[...]
  • X-ray diffraction
  • Release Date: 2015-09-16
1.1 Å16(1) 4RC0|1|A
926NR_3.0_48635.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7DFG|1|T+7DFG|1|P (7DFG)
  • RNA (5'-R(P*CP*CP*CP*UP*AP*UP*AP*AP*CP*U[...]
  • Electron microscopy
  • Release Date: 2021-11-17
2.7 Å16(1) 7DFG|1|T+7DFG|1|P
927NR_3.0_49195.1
Exact match
synthetic construct
6LSE|1|C+6LSE|1|B (6LSE)
  • RNA (5'-R(*UP*GP*UP*UP*CP*GP*AP*CP*GP*AP[...]
  • X-ray diffraction
  • Release Date: 2020-04-29
2.3 Å16(1) 6LSE|1|C+6LSE|1|B
928NR_3.0_51266.3
Exact match
2C4Q|1|R (2C4Q)
  • RNA (5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 2005-11-07
2.4 Å16(30) 2C4Q|1|R, 2C4Y|1|R, 2C4Q|1|S, 2BU1|1|R, 2C4Y|1|S, 2C4Z|1|S, 2C4Z|1|R, 2C51|1|R, 2BU1|1|S, 2C50|1|R, 2C51|1|S, 2C50|1|S, 1ZDH|1|R, 1ZDH|1|S, 2IZ9|1|R, 2IZ9|1|S, 2BQ5|1|R, 2BNY|1|R, 2BQ5|1|S, 2BNY|1|S, 1AQ4|1|R, 1AQ3|1|R, 1AQ3|1|S, 1AQ4|1|S, 2IZM|1|R, 2IZM|1|S, 1ZDI|1|R, 1ZDK|1|R, 1ZDK|1|S, 1ZDI|1|S
929NR_3.0_58318.1
Exact match
406D|1|A+406D|1|E (406D)
  • RNA (5'-R(*CP*AP*CP*CP*GP*GP*AP*UP*GP*GP[...]
  • X-ray diffraction
  • Release Date: 1999-02-05
1.8 Å16(1) 406D|1|A+406D|1|E
930NR_3.0_61892.1
Exact match
4QIL|1|C (4QIL)
  • 5'-R(*CP*UP*CP*CP*CP*UP*UP*CP*UP*GP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2014-07-16
2.9 Å16(2) 4QIL|1|C, 4QIL|1|D
931NR_3.0_72694.2
Exact match
Candida albicans SC5314
7PZY|1|10 (7PZY)
  • Mixture of endogenous E-tRNAs, Mixture o[...]
  • Electron microscopy
  • Release Date: 2022-05-18
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.3 Å16(3) 7PZY|1|10, 7Q0R|1|10, 7Q0P|1|10
932NR_3.0_74336.1
Exact match
1ZBH|1|F (1ZBH)
  • 5'-R(*CP*CP*GP*GP*CP*UP*CP*UP*UP*UP*UP*C[...]
  • X-ray diffraction
  • Release Date: 2006-09-26
3.0 Å16(2) 1ZBH|1|F, 1ZBH|1|E
933NR_3.0_75931.1
Exact match
Bacillus subtilis
5ZW4|1|D (5ZW4)
  • RNA (5'-R(*CP*CP*UP*GP*CP*UP*UP*UP*GP*CP[...]
  • X-ray diffraction
  • Release Date: 2018-07-11
1.7 Å16(1) 5ZW4|1|D
934NR_3.0_81203.2
Exact match
4K4Z|1|N+4K4Z|1|O+4K4Z|1|P (4K4Z)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2013-05-22
2.2 Å16(8) 4K4Z|1|N+4K4Z|1|O+4K4Z|1|P, 4K4Z|1|B+4K4Z|1|C+4K4Z|1|D, 4K4X|1|J+4K4X|1|K+4K4X|1|L, 4K4Z|1|J+4K4Z|1|K+4K4Z|1|L, 4K4X|1|B+4K4X|1|C+4K4X|1|D, 4K4Z|1|F+4K4Z|1|G+4K4Z|1|H, 4K4X|1|F+4K4X|1|G+4K4X|1|H, 4K4X|1|N+4K4X|1|O+4K4X|1|P
935NR_3.0_82939.1
Exact match
3ND4|1|A (3ND4)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*CP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2011-09-21
1.5 Å16(1) 3ND4|1|A
936NR_3.0_83745.1
Exact match
5T3K|1|A+5T3K|1|B (5T3K)
  • 5'-R(*GP*GP*UP*GP*GP*UP*GP*(MTU)P*AP*GP*[...]
  • X-ray diffraction
  • Release Date: 2017-07-05
2.1 Å16(4) 5T3K|1|A+5T3K|1|B, 5T3K|1|C+5T3K|1|D, 1T0D|1|C+1T0D|1|D, 1T0D|1|A+1T0D|1|B
937NR_3.0_84151.1
Exact match
synthetic construct
7UNC|1|P (7UNC)
  • RNA
  • Electron microscopy
  • Release Date: 2022-10-19
3.0 Å16(1) 7UNC|1|P
938NR_3.0_89129.1
Exact match
1Z7F|1|B+1Z7F|1|C (1Z7F)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*U[...]
  • X-ray diffraction
  • Release Date: 2005-10-18
2.1 Å16(1) 1Z7F|1|B+1Z7F|1|C
939NR_3.0_90823.1
Exact match
Escherichia coli
5D0B|1|F (5D0B)
  • RNA (5'-D(*GP*CP*AP*GP*AP*CP*UP*(56B)P*U[...]
  • X-ray diffraction
  • Release Date: 2016-09-28
2.6 Å16(1) 5D0B|1|F
940NR_3.0_95734.1
Exact match
Thermus thermophilus
4B3R|1|Z+4B3R|1|W (4B3R)
  • 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*U[...]
  • X-ray diffraction
  • Release Date: 2013-08-07
3.0 Å16(3) 4B3R|1|Z+4B3R|1|W, 4B3M|1|Z+4B3M|1|W, 4B3T|1|Z+4B3T|1|W
941NR_3.0_97023.1
Exact match
synthetic construct
7NKX|1|P (7NKX)
  • RNA
  • Electron microscopy
  • Release Date: 2021-08-25
2.9 Å16(1) 7NKX|1|P
942NR_3.0_07779.1
Exact match
1NUV|1|A+1NUV|1|B (1NUV)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2003-08-19
1.8 Å15(5) 1NUV|1|A+1NUV|1|B, 1NUV|1|G+1NUV|1|H, 429D|1|A+429D|1|B, 1NUJ|1|A+1NUJ|1|B, 1NUJ|1|G+1NUJ|1|H
943NR_3.0_09201.1
Exact match
synthetic construct
8E2A|1|B (8E2A)
  • RNA hairpin D-U7
  • Electron microscopy
  • Release Date: 2023-03-01
2.8 Å15(1) 8E2A|1|B
944NR_3.0_10487.1
Exact match
4NFQ|1|A (4NFQ)
  • RNA 5'-R(*GP*CP*AP*GP*AP*(A5M)P*UP*UP*AP[...]
  • X-ray diffraction
  • Release Date: 2014-07-02
1.7 Å15(7) 4NFQ|1|A, 4NFQ|1|B+4NFQ|1|C, 4NFO|1|A, 4NFP|1|B+4NFP|1|C, 4NFP|1|A, 4NFO|1|B+4NFO|1|C, 1YZD|1|C
945NR_3.0_13312.1
Exact match
synthetic construct
5Y6Z|1|B+5Y6Z|1|C (5Y6Z)
  • Template RNA (33-MER), Product RNA (14-M[...]
  • X-ray diffraction
  • Release Date: 2017-12-27
2.5 Å15(2) 5Y6Z|1|B+5Y6Z|1|C, 5Y6Z|1|F+5Y6Z|1|G
946NR_3.0_19387.1
Exact match
synthetic construct
5W0O|1|C+5W0O|1|D (5W0O)
  • double-stranded RNA
  • X-ray diffraction
  • Release Date: 2017-06-28
2.5 Å15(1) 5W0O|1|C+5W0O|1|D
947NR_3.0_29253.1
Exact match
synthetic construct
6BGB|1|A+6BGB|1|B (6BGB)
  • (5'-R(*GP*CP*AP*GP*(A7C)P*CP*UP*UP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2017-12-06
1.7 Å15(2) 6BGB|1|A+6BGB|1|B, 6BGB|1|C
948NR_3.0_33125.1
Exact match
4NH6|1|B (4NH6)
  • 5'-R(P*UP*UP*UP*GP*CP*GP*AP*AP*UP*UP*CP*[...]
  • X-ray diffraction
  • Release Date: 2014-03-05
2.6 Å15(1) 4NH6|1|B
949NR_3.0_33604.1
Exact match
1ZZ5|1|A+1ZZ5|1|C+1ZZ5|1|B+1ZZ5|1|D (1ZZ5)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2005-09-20
3.0 Å15(2) 1ZZ5|1|A+1ZZ5|1|C+1ZZ5|1|B+1ZZ5|1|D, 2A04|1|A+2A04|1|C+2A04|1|B+2A04|1|D
950NR_3.0_38795.1
Exact match
1YZD|1|A+1YZD|1|B (1YZD)
  • RNA 5'-R(*GP*CP*AP*GP*AP*(A5M)P*UP*UP*AP[...]
  • X-ray diffraction
  • Release Date: 2005-10-18
2.4 Å15(1) 1YZD|1|A+1YZD|1|B
951NR_3.0_41012.1
Exact match
synthetic construct
7NHC|1|D+7NHC|1|E (7NHC)
  • RNA (5'-R(P*AP*GP*UP*AP*GP*AP*AP*AP*CP*A[...]
  • Electron microscopy
  • Release Date: 2021-12-01
2.9 Å15(2) 7NHC|1|D+7NHC|1|E, 7NHA|1|D+7NHA|1|E
952NR_3.0_43988.1
Exact match
Homo sapiens
5EMF|1|A (5EMF)
  • RNA (5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3')
  • X-ray diffraction
  • Release Date: 2016-01-13
1.1 Å15(1) 5EMF|1|A
953NR_3.0_45442.1
Exact match
397D|1|A+397D|1|B (397D)
  • RNA (5'-R(*GP*GP*CP*CP*AP*GP*AP*UP*CP*UP[...]
  • X-ray diffraction
  • Release Date: 1998-09-11
1.3 Å15(1) 397D|1|A+397D|1|B
954NR_3.0_51779.4
Exact match
1Z7F|1|A (1Z7F)
  • DNA/RNA (5'-R(*GP*CP*AP*GP*A)-D(P*(A5M))[...]
  • X-ray diffraction
  • Release Date: 2005-10-18
2.1 Å15(6) 1Z7F|1|A, 1Z79|1|C, 1Z79|1|A+1Z79|1|B, 1YRM|1|C, 1YRM|1|A+1YRM|1|B, 405D|1|A+405D|1|B
955NR_3.0_53157.1
Exact match
1CSL|1|B+1CSL|1|A (1CSL)
  • 5'-R(*UP*CP*UP*GP*AP*CP*GP*GP*UP*AP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2000-02-14
1.6 Å15(1) 1CSL|1|B+1CSL|1|A
956NR_3.0_56975.1
Exact match
synthetic construct
5CKI|1|D (5CKI)
  • RNA (5'-R(P*GP*CP*AP*CP*UP*AP*GP*AP*UP*C[...]
  • X-ray diffraction
  • Release Date: 2016-01-13
3.0 Å15(2) 5CKI|1|D, 5CKK|1|D
957NR_3.0_61090.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7DOI|1|T+7DOI|1|P (7DOI)
  • RNA (5'-R(P*CP*CP*UP*AP*UP*AP*AP*CP*UP*U[...]
  • Electron microscopy
  • Release Date: 2021-12-15
2.6 Å15(1) 7DOI|1|T+7DOI|1|P
958NR_3.0_62747.1
Exact match
Flock House virus
4FTB|1|R (4FTB)
  • Flock House virus genomic RNA
  • X-ray diffraction
  • Release Date: 2012-08-01
2.7 Å15(1) 4FTB|1|R
959NR_3.0_65600.1
Exact match
Pseudomonas aeruginosa
2XLK|1|C (2XLK)
  • 5'-R(*CP*UP*GP*CP*CP*GP*UP*AP*UP*AP*GP*G[...]
  • X-ray diffraction
  • Release Date: 2010-09-22
1.8 Å15(5) 2XLK|1|C, 2XLK|1|D, 2XLI|1|B, 2XLJ|1|B, 4AL6|1|B
960NR_3.0_68126.1
Exact match
2H1M|1|A+2H1M|1|B (2H1M)
  • 5'-R(*GP*CP*AP*(XUG)P*AP*GP*UP*UP*AP*AP*[...]
  • X-ray diffraction
  • Release Date: 2006-07-18
2.9 Å15(2) 2H1M|1|A+2H1M|1|B, 420D|1|A+420D|1|B
961NR_3.0_73551.1
Exact match
1SDS|1|D (1SDS)
  • box H/ACA sRNA
  • X-ray diffraction
  • Release Date: 2004-05-18
1.8 Å15(3) 1SDS|1|D, 1SDS|1|E, 1SDS|1|F
962NR_3.0_75028.1
Exact match
Escherichia virus MS2
2IZN|1|R (2IZN)
  • 5'-R(*AP*CP*AP*UP*CP*GP*CP*GP*AP*UP *UP*[...]
  • X-ray diffraction
  • Release Date: 2006-07-27
2.6 Å15(2) 2IZN|1|R, 2IZN|1|S
963NR_3.0_76733.1
Exact match
3DD2|1|B (3DD2)
  • RNA (26-MER)
  • X-ray diffraction
  • Release Date: 2008-11-11
1.9 Å15(1) 3DD2|1|B
964NR_3.0_77294.1
Exact match
Gloeobacter violaceus
5NDH|1|A (5NDH)
  • RNA (5'-R(*GP*(CBV)P*GP*GP*GP*GP*AP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2017-05-31
1.8 Å15(4) 5NDH|1|A, 5NDH|1|B, 5NDH|1|D, 5NDH|1|C
965NR_3.0_80680.1
Exact match
3R1D|1|E (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2011-06-01
1.5 Å15(1) 3R1D|1|E
966NR_3.0_80882.1
Exact match
Homo sapiens
4Z31|1|E (4Z31)
  • RNA (5'-R(*A)-D(P*UP*GP*UP*UP*CP*UP*GP*U[...]
  • X-ray diffraction
  • Release Date: 2015-10-14
2.5 Å15(2) 4Z31|1|E, 4Z31|1|F
967NR_3.0_82754.1
Exact match
Pseudorabies virus Ea
6XRQ|1|B (6XRQ)
  • RNA (5' GP*GP*CP*UP*CP*GP*GP*CP*GP*GP*CP[...]
  • X-ray diffraction
  • Release Date: 2021-07-28
1.2 Å15(1) 6XRQ|1|B
968NR_3.0_87784.1
Exact match
1ZX7|1|C+1ZX7|1|E+1ZX7|1|D+1ZX7|1|F (1ZX7)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2005-09-20
2.2 Å15(2) 1ZX7|1|C+1ZX7|1|E+1ZX7|1|D+1ZX7|1|F, 1ZX7|1|A+1ZX7|1|G+1ZX7|1|B+1ZX7|1|H
969NR_3.0_93219.1
Exact match
2AZ0|1|C+2AZ0|1|D (2AZ0)
  • 5'-R(*GP*CP*AP*(5BU)P*GP*GP*AP*CP*GP*CP*[...]
  • X-ray diffraction
  • Release Date: 2005-10-11
2.6 Å15(2) 2AZ0|1|C+2AZ0|1|D, 2AZ2|1|C+2AZ2|1|D
970NR_3.0_98916.1
Exact match
3CZW|1|X (3CZW)
  • RNA (5'-R(*G*UP*GP*GP*UP*CP*UP*GP*AP*UP*[...]
  • X-ray diffraction
  • Release Date: 2008-09-09
1.4 Å15(1) 3CZW|1|X
971NR_3.0_00747.1
Exact match
4H5P|1|F (4H5P)
  • 28-mer poly(U) RNA
  • X-ray diffraction
  • Release Date: 2012-11-07
2.2 Å14(2) 4H5P|1|F, 4H5P|1|E
972NR_3.0_00896.1
Exact match
2BX2|1|R (2BX2)
  • RNA (5'-R(*UP*UP*UP*AP*CP*AP*GP*UP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 2005-10-14
2.9 Å14(1) 2BX2|1|R
973NR_3.0_07071.1
Exact match
Suid alphaherpesvirus 1
6JJH|1|B (6JJH)
  • RNA (5'-R(*GP*GP*CP*UP*CP*GP*GP*CP*GP*GP[...]
  • X-ray diffraction
  • Release Date: 2020-02-26
1.7 Å14(1) 6JJH|1|B
974NR_3.0_08676.1
Exact match
Giardia lamblia ATCC 50803
7PWG|1|w (7PWG)
  • E-site tRNA
  • Electron microscopy
  • Release Date: 2022-04-20
  • Standardized name: tRNA
  • Source: Eukarya
  • Rfam: RF00005
2.8 Å14(1) 7PWG|1|w
975NR_3.0_09827.1
Exact match
3AVY|1|T+3AVY|1|G (3AVY)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*UP*UP*UP*AP[...]
  • X-ray diffraction
  • Release Date: 2012-01-18
2.6 Å14(1) 3AVY|1|T+3AVY|1|G
976NR_3.0_13358.1
Exact match
Thermus thermophilus
1N32|1|Y+1N32|1|Z (1N32)
  • ANTICODON STEM-LOOP OF LEU-2 TRANSFER RN[...]
  • X-ray diffraction
  • Release Date: 2002-11-29
3.0 Å14(1) 1N32|1|Y+1N32|1|Z
977NR_3.0_13685.1
Exact match
unidentified
4PMW|1|D (4PMW)
  • U-U-U-U-U-U-U-U-U-U-U-U-U-U
  • X-ray diffraction
  • Release Date: 2014-07-30
3.0 Å14(2) 4PMW|1|D, 4PMW|1|C
978NR_3.0_14145.1
Exact match
Influenza B virus
4WRT|1|V+4WRT|1|R (4WRT)
  • Influenza virus polymerase vRNA promoter[...]
  • X-ray diffraction
  • Release Date: 2014-11-19
2.7 Å14(8) 4WRT|1|V+4WRT|1|R, 6QCW|1|V+6QCW|1|R+6QCW|1|M, 7R0E|1|V+7R0E|1|R+7R0E|1|M, 6T0N|1|V+6T0N|1|R, 6SZV|1|V, 8BEK|1|V+8BEK|1|R+8BEK|1|M, 7QTL|1|V, 7R1F|1|V
979NR_3.0_19413.1
Exact match
2I91|1|F+2I91|1|E (2I91)
  • 5'-R(*C*GP*GP*UP*AP*GP*GP*CP*UP*UP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2006-10-17
2.7 Å14(2) 2I91|1|F+2I91|1|E, 2I91|1|D+2I91|1|C
980NR_3.0_20306.1
Exact match
synthetic construct
4ZLR|1|C (4ZLR)
  • RNA (5'-R(*UP*UP*GP*UP*UP*GP*UP*UP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2015-11-11
2.3 Å14(1) 4ZLR|1|C
981NR_3.0_24974.1
Exact match
1DUQ|1|B+1DUQ|1|A (1DUQ)
  • THE REV BINDING ELEMENT
  • X-ray diffraction
  • Release Date: 2000-05-16
2.1 Å14(4) 1DUQ|1|B+1DUQ|1|A, 1DUQ|1|D+1DUQ|1|C, 1DUQ|1|F+1DUQ|1|E, 1DUQ|1|H+1DUQ|1|G
982NR_3.0_31286.1
Exact match
6MSF|1|R (6MSF)
  • RNA (5'-R(*CP*CP*AP*CP*AP*GP*UP*CP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 1998-07-08
2.8 Å14(1) 6MSF|1|R
983NR_3.0_33534.2
Exact match
Pseudomonas virus phi6
7BKP|1|X+7BKP|1|Z (7BKP)
  • RNA (5'-R(P*CP*AP*AP*GP*CP*CP*GP*AP*GP*G[...]
  • Electron microscopy
  • Release Date: 2021-11-17
2.8 Å14(1) 7BKP|1|X+7BKP|1|Z
984NR_3.0_39003.1
Exact match
1MHK|1|L+1MHK|1|S (1MHK)
  • RNA 14-mer BCh12, RNA 12-mer BCh12
  • X-ray diffraction
  • Release Date: 2002-09-06
2.5 Å14(1) 1MHK|1|L+1MHK|1|S
985NR_3.0_40560.1
Exact match
3OIN|1|C (3OIN)
  • 5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*AP*CP*GP*C[...]
  • X-ray diffraction
  • Release Date: 2010-12-01
1.9 Å14(3) 3OIN|1|C, 3OIJ|1|D, 3OIJ|1|C
986NR_3.0_42126.1
Exact match
2B3J|1|E (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-ray diffraction
  • Release Date: 2006-01-24
2.0 Å14(3) 2B3J|1|E, 2B3J|1|F, 2B3J|1|H
987NR_3.0_46866.1
Exact match
synthetic construct
4BWM|1|G (4BWM)
  • 5'-R(*AP*AP*AP*GP*GP*GP*CP*GP*CP*CP*GP*U[...]
  • X-ray diffraction
  • Release Date: 2013-09-18
1.8 Å14(1) 4BWM|1|G
988NR_3.0_51826.1
Exact match
1RNA|1|A+1RNA|1|B (1RNA)
  • RNA (5'-R(*UP*UP*AP*UP*AP*UP*AP*UP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 1991-04-15
2.3 Å14(1) 1RNA|1|A+1RNA|1|B
989NR_3.0_53884.1
Exact match
3O7V|1|A (3O7V)
  • RNA (5'-R(*GP*CP*GP*AP*AP*UP*AP*UP*UP*CP[...]
  • X-ray diffraction
  • Release Date: 2011-01-12
2.1 Å14(3) 3O7V|1|A, 3O3I|1|A, 3O6E|1|A
990NR_3.0_55576.1
Exact match
Pseudorabies virus Ea
6XRQ|1|A (6XRQ)
  • RNA (5' GP*GP*CP*UP*CP*GP*GP*CP*GP*GP*CP[...]
  • X-ray diffraction
  • Release Date: 2021-07-28
1.2 Å14(1) 6XRQ|1|A
991NR_3.0_55785.1
Exact match
4M59|1|C (4M59)
  • psaJ RNA
  • X-ray diffraction
  • Release Date: 2013-10-30
2.5 Å14(2) 4M59|1|C, 4OE1|1|C
992NR_3.0_56203.1
Exact match
synthetic construct
5I4A|1|D (5I4A)
  • RNA (5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP[...]
  • X-ray diffraction
  • Release Date: 2016-03-30
2.0 Å14(2) 5I4A|1|D, 5I4A|1|B
993NR_3.0_56893.1
Exact match
3P59|1|E+3P59|1|A+3P59|1|C+3P59|1|G+ 3P59|1|B+3P59|1|D+3P59|1|F+3P59|1|H (3P59)
  • RNA (5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2011-04-06
2.2 Å14(1) 3P59|1|E+3P59|1|A+3P59|1|C+3P59|1|G+ 3P59|1|B+3P59|1|D+3P59|1|F+3P59|1|H
994NR_3.0_57733.1
Exact match
4H8K|1|C (4H8K)
  • RNA (5'-R(*CP*GP*AP*CP*AP*CP*CP*UP*GP*AP[...]
  • X-ray diffraction
  • Release Date: 2013-09-25
2.3 Å14(1) 4H8K|1|C
995NR_3.0_58168.1
Exact match
synthetic construct
6AR5|1|B (6AR5)
  • RNA
  • X-ray diffraction
  • Release Date: 2017-11-29
2.4 Å14(1) 6AR5|1|B
996NR_3.0_60411.1
Exact match
7MSF|1|R (7MSF)
  • 5'-R(*UP*CP*GP*CP*CP*AP*AP*CP*AP*GP*GP*C[...]
  • X-ray diffraction
  • Release Date: 1998-11-11
2.8 Å14(2) 7MSF|1|R, 7MSF|1|S
997NR_3.0_61400.1
Exact match
synthetic construct
8A40|1|P (8A40)
  • RNA
  • Electron microscopy
  • Release Date: 2023-08-23
3.0 Å14(1) 8A40|1|P
998NR_3.0_67601.1
Exact match
Bacteroides uniformis
7MJV|1|E (7MJV)
  • RNA (5'-R(P*AP*GP*GP*AP*CP*UP*GP*AP*AP*([...]
  • X-ray diffraction
  • Release Date: 2021-09-15
2.2 Å14(1) 7MJV|1|E
999NR_3.0_73553.1
Exact match
Severe acute respiratory syndrome-related coronavirus
7BV2|1|T+7BV2|1|P (7BV2)
  • Templete, Primer
  • Electron microscopy
  • Release Date: 2020-04-22
2.5 Å14(1) 7BV2|1|T+7BV2|1|P
1000NR_3.0_73713.1
Exact match
Homo sapiens
4Z31|1|C+4Z31|1|D (4Z31)
  • RNA (5'-R(*A)-D(P*UP*GP*UP*UP*CP*UP*GP*U[...]
  • X-ray diffraction
  • Release Date: 2015-10-14
2.5 Å14(1) 4Z31|1|C+4Z31|1|D
1001NR_3.0_78685.1
Exact match
4NH5|1|B (4NH5)
  • 5'-R(P*UP*UP*GP*CP*GP*AP*AP*UP*UP*CP*GP*[...]
  • X-ray diffraction
  • Release Date: 2014-03-05
2.6 Å14(1) 4NH5|1|B
1002NR_3.0_79448.1
Exact match
Giardia lamblia ATCC 50803
7PWO|1|w2 (7PWO)
  • E-site tRNA
  • Electron microscopy
  • Release Date: 2022-04-20
2.8 Å14(1) 7PWO|1|w2
1003NR_3.0_82338.1
Exact match
synthetic construct
6YYT|1|P+6YYT|1|Q+6YYT|1|U+6YYT|1|T (6YYT)
  • RNA product
  • Electron microscopy
  • Release Date: 2020-05-13
2.9 Å14(1) 6YYT|1|P+6YYT|1|Q+6YYT|1|U+6YYT|1|T
1004NR_3.0_83502.1
Exact match
Solanum lycopersicum
7QIZ|1|aA+7QIZ|1|bA (7QIZ)
  • tRNA, mRNA, tRNA_1
  • Electron microscopy
  • Release Date: 2022-08-03
2.4 Å14(2) 7QIZ|1|aA+7QIZ|1|bA, 7QIY|1|Q+7QIY|1|R
1005NR_3.0_88847.1
Exact match
Homo sapiens
4F3T|1|R (4F3T)
  • RNA (5'-R(P*UP*AP*AP*AP*GP*UP*GP*CP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2012-05-30
2.3 Å14(1) 4F3T|1|R
1006NR_3.0_90819.1
Exact match
413D|1|A (413D)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*UP*CP*GP*GP[...]
  • X-ray diffraction
  • Release Date: 1998-07-10
1.8 Å14(1) 413D|1|A
1007NR_3.0_91365.1
Exact match
Thermus thermophilus
4C8Z|1|C (4C8Z)
  • R1 REPEAT RNA CLEAVAGE PRODUCT
  • X-ray diffraction
  • Release Date: 2013-11-06
2.5 Å14(1) 4C8Z|1|C
1008NR_3.0_99000.1
Exact match
synthetic construct
6OZR|1|C+6OZR|1|D (6OZR)
  • DNA/RNA (5'-R(P*CP*GP*GP*UP*AP*AP*CP*CP*[...]
  • X-ray diffraction
  • Release Date: 2019-09-04
2.2 Å14(7) 6OZR|1|C+6OZR|1|D, 6OZJ|1|C+6OZJ|1|D, 6OZQ|1|C+6OZQ|1|D, 6OZN|1|C+6OZN|1|D, 6OZM|1|C+6OZM|1|D, 6OZL|1|D+6OZL|1|C, 6OZK|1|C+6OZK|1|D
1009NR_3.0_99184.1
Exact match
433D|1|A+433D|1|B (433D)
  • 5'-R(*GP*GP*UP*AP*UP*UP*GP*CP*GP*GP*UP*A[...]
  • X-ray diffraction
  • Release Date: 1998-12-04
2.1 Å14(1) 433D|1|A+433D|1|B
1010NR_3.0_04560.1
Exact match
Influenza B virus
8BF5|1|M+8BF5|1|R (8BF5)
  • mRNA, 3' vRNA
  • Electron microscopy
  • Release Date: 2022-12-28
3.0 Å13(1) 8BF5|1|M+8BF5|1|R
1011NR_3.0_08416.1
Exact match
1QBP|1|A+1QBP|1|B (1QBP)
  • 5'-R(*UP*GP*(CBV)P*(CBV)P*AP*GP*UP*UP*CP[...]
  • X-ray diffraction
  • Release Date: 1999-11-26
2.1 Å13(3) 1QBP|1|A+1QBP|1|B, 1QBP|1|C+1QBP|1|D, 1QBP|1|E+1QBP|1|F
1012NR_3.0_10796.1
Exact match
1BR3|1|A (1BR3)
  • RNA (5'-R(*GP*GP*AP*CP*AP*GP*AP*UP*GP*GP[...]
  • X-ray diffraction
  • Release Date: 1999-02-23
3.0 Å13(1) 1BR3|1|A
1013NR_3.0_12093.1
Exact match
1TFW|1|G+1TFW|1|J (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-ray diffraction
  • Release Date: 2004-08-10
2.2 Å13(1) 1TFW|1|G+1TFW|1|J
1014NR_3.0_12115.1
Exact match
Schizosaccharomyces pombe
6NY5|1|C (6NY5)
  • RNA (5'-R(P*UP*UP*AP*AP*UP*AP*AP*CP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2019-07-03
3.0 Å13(1) 6NY5|1|C
1015NR_3.0_14518.1
Exact match
1FUF|1|A+1FUF|1|B (1FUF)
  • (5'-R(*GP*GP*UP*AP*UP*UP*UP*CP*GP*GP*UP*[...]
  • X-ray diffraction
  • Release Date: 2001-11-09
1.7 Å13(2) 1FUF|1|A+1FUF|1|B, 1IK5|1|A+1IK5|1|B
1016NR_3.0_15462.1
Exact match
4NGG|1|B (4NGG)
  • 5'-R(*AP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*U[...]
  • X-ray diffraction
  • Release Date: 2014-03-05
2.6 Å13(1) 4NGG|1|B
1017NR_3.0_16044.1
Exact match
1I9X|1|A+1I9X|1|B (1I9X)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*GP*UP*AP*GP*U[...]
  • X-ray diffraction
  • Release Date: 2001-09-05
2.2 Å13(1) 1I9X|1|A+1I9X|1|B
1018NR_3.0_17852.1
Exact match
3CGR|1|B+3CGR|1|A (3CGR)
  • RNA (5'-R(*CP*GP*CP*AP*CP*UP*AP*AP*CP*CP[...]
  • X-ray diffraction
  • Release Date: 2008-07-01
2.1 Å13(1) 3CGR|1|B+3CGR|1|A
1019NR_3.0_19209.1
Exact match
synthetic construct
5JAJ|1|X+5JAJ|1|Y (5JAJ)
  • RNA (5'-R(P*GP*GP*UP*AP*CP*GP*UP*AP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2016-06-01
1.5 Å13(2) 5JAJ|1|X+5JAJ|1|Y, 5JB2|1|X+5JB2|1|Y
1020NR_3.0_22223.1
Exact match
3CGP|1|B+3CGP|1|A (3CGP)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*AP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2008-07-01
1.6 Å13(2) 3CGP|1|B+3CGP|1|A, 3CGQ|1|B+3CGQ|1|A
1021NR_3.0_26209.1
Exact match
Caenorhabditis elegans
6FQL|1|B (6FQL)
  • RNA (5'-R(*UP*GP*CP*AP*UP*UP*UP*AP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 2018-05-09
2.4 Å13(1) 6FQL|1|B
1022NR_3.0_26402.1
Exact match
2NUG|1|E+2NUG|1|F+2NUG|1|C+2NUG|1|D (2NUG)
  • 5'-R(P*AP*GP*UP*GP*GP*CP*CP*UP*UP*GP*C)-[...]
  • X-ray diffraction
  • Release Date: 2007-11-20
1.7 Å13(1) 2NUG|1|E+2NUG|1|F+2NUG|1|C+2NUG|1|D
1023NR_3.0_31084.1
Exact match
4K4V|1|B (4K4V)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2013-05-22
2.6 Å13(2) 4K4V|1|B, 4K4V|1|F
1024NR_3.0_31288.1
Exact match
4C8Y|1|C (4C8Y)
  • R1 REPEAT RNA SUBSTRATE MIMIC
  • X-ray diffraction
  • Release Date: 2013-11-06
1.8 Å13(1) 4C8Y|1|C
1025NR_3.0_31445.1
Exact match
synthetic construct
7Y2B|1|S (7Y2B)
  • RNA (5'-R(P*UP*UP*CP*UP*GP*CP*UP*GP*CP*U[...]
  • X-ray diffraction
  • Release Date: 2023-05-31
1.9 Å13(2) 7Y2B|1|S, 7Y2P|1|A+7Y2P|1|B
1026NR_3.0_33731.1
Exact match
synthetic construct
7QTN|1|B+7QTN|1|A (7QTN)
  • RNA (5'-R(*GP*GP*UP*AP*CP*UP*GP*CP*GP*(X[...]
  • X-ray diffraction
  • Release Date: 2023-01-25
1.2 Å13(1) 7QTN|1|B+7QTN|1|A
1027NR_3.0_43130.1
Exact match
Influenza B virus
7Z42|1|V (7Z42)
  • RNA (5'-R(P*AP*GP*UP*AP*GP*UP*AP*AP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2022-05-18
2.4 Å13(2) 7Z42|1|V, 7Z42|1|H
1028NR_3.0_46216.1
Exact match
3CGS|1|B+3CGS|1|A (3CGS)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*GP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2008-07-01
1.7 Å13(1) 3CGS|1|B+3CGS|1|A
1029NR_3.0_49890.1
Exact match
1NUV|1|E+1NUV|1|F (1NUV)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2003-08-19
1.8 Å13(5) 1NUV|1|E+1NUV|1|F, 1NUV|1|C+1NUV|1|D, 1NUJ|1|C+1NUJ|1|D, 1NUJ|1|E+1NUJ|1|F, 429D|1|C+429D|1|D
1030NR_3.0_50652.1
Exact match
synthetic construct
4RBY|1|A (4RBY)
  • 5'-R(*CP*GP*CP*(2SG)P*AP*AP*UP*UP*AP*GP*[...]
  • X-ray diffraction
  • Release Date: 2015-09-16
1.2 Å13(1) 4RBY|1|A
1031NR_3.0_51980.1
Exact match
3AVX|1|T+3AVX|1|G (3AVX)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*GP*GP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2012-01-18
2.4 Å13(1) 3AVX|1|T+3AVX|1|G
1032NR_3.0_56235.1
Exact match
4O41|1|C+4O41|1|D (4O41)
  • AMIDE LINKED RNA
  • X-ray diffraction
  • Release Date: 2014-07-09
1.2 Å13(2) 4O41|1|C+4O41|1|D, 4O41|1|B+4O41|1|A
1033NR_3.0_61988.1
Exact match
3OG8|1|C+3OG8|1|D (3OG8)
  • RNA (5'-R(*(GTP)P*GP*CP*GP*CP*GP*CP*GP*C[...]
  • X-ray diffraction
  • Release Date: 2010-11-03
2.4 Å13(2) 3OG8|1|C+3OG8|1|D, 3LRN|1|C+3LRN|1|D
1034NR_3.0_65598.1
Exact match
1TFW|1|H+1TFW|1|E (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-ray diffraction
  • Release Date: 2004-08-10
2.2 Å13(2) 1TFW|1|H+1TFW|1|E, 1TFW|1|I+1TFW|1|F
1035NR_3.0_66418.1
Exact match
Caenorhabditis elegans
6FQ3|1|B (6FQ3)
  • RNA (5'-R(*GP*GP*AP*GP*UP*CP*CP*AP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2018-05-09
1.9 Å13(1) 6FQ3|1|B
1036NR_3.0_69774.1
Exact match
Homo sapiens
5H1K|1|C+5H1K|1|D (5H1K)
  • U4 snRNA (5'-R(*GP*CP*AP*AP*UP*UP*UP*UP*[...]
  • X-ray diffraction
  • Release Date: 2016-11-23
1.9 Å13(1) 5H1K|1|C+5H1K|1|D
1037NR_3.0_73378.1
Exact match
4NH3|1|B (4NH3)
  • 5'-R(P*UP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*[...]
  • X-ray diffraction
  • Release Date: 2014-03-05
2.6 Å13(1) 4NH3|1|B
1038NR_3.0_95407.1
Exact match
3R1D|1|A+3R1D|1|B (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2011-06-01
1.5 Å13(2) 3R1D|1|A+3R1D|1|B, 3R1D|1|C+3R1D|1|D
1039NR_3.0_95458.1
Exact match
HIV whole-genome vector AA1305#18
7OL0|1|P (7OL0)
  • RNA
  • Electron microscopy
  • Release Date: 2021-07-14
3.0 Å13(1) 7OL0|1|P
1040NR_3.0_96380.1
Exact match
Escherichia coli
2IX1|1|B (2IX1)
  • 5'-D(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP *AP*[...]
  • X-ray diffraction
  • Release Date: 2006-10-05
2.7 Å13(1) 2IX1|1|B
1041NR_3.0_96977.1
Exact match
3MQK|1|D+3MQK|1|E (3MQK)
  • RNA (5'-R(P*GP*UP*UP*CP*GP*AP*UP*CP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2010-12-29
2.8 Å13(1) 3MQK|1|D+3MQK|1|E
1042NR_3.0_97545.1
Exact match
Saccharomyces cerevisiae
7A9X|1|B (7A9X)
  • RNA (5'-R(P*AP*AP*AP*UP*AP*AP*CP*AP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-04-07
2.5 Å13(1) 7A9X|1|B
1043NR_3.0_98573.1
Exact match
synthetic construct
4Z0C|1|C (4Z0C)
  • DNA (5'-R(P*AP*CP*GP*GP*AP*AP*AP*GP*AP*C[...]
  • X-ray diffraction
  • Release Date: 2015-10-07
2.3 Å13(2) 4Z0C|1|C, 4Z0C|1|B
1044NR_3.0_00518.1
Exact match
synthetic construct
5I9G|1|A (5I9G)
  • RNA (5'-R(*GP*GP*G*GP*UP*UP*UP*UP*CP*CP*[...]
  • X-ray diffraction
  • Release Date: 2016-04-27
2.3 Å12(1) 5I9G|1|A
1045NR_3.0_02622.1
Exact match
4GHA|1|I+4GHA|1|J (4GHA)
  • RNA (5'-R(*CP*UP*AP*GP*AP*CP*GP*UP*CP*UP[...]
  • X-ray diffraction
  • Release Date: 2012-08-22
2.5 Å12(3) 4GHA|1|I+4GHA|1|J, 4LG2|1|E+4LG2|1|F, 4LG2|1|I+4LG2|1|J
1046NR_3.0_02841.1
Exact match
synthetic construct
7ECN|1|A+7ECN|1|B (7ECN)
  • RNA (5'-R(*GP*GP*GP*CP*CP*CP*GP*GP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2022-03-16
1.6 Å12(4) 7ECN|1|A+7ECN|1|B, 7ECN|1|C+7ECN|1|D, 7ECM|1|A+7ECM|1|B, 7ECM|1|C+7ECM|1|D
1047NR_3.0_04435.1
Exact match
Schizosaccharomyces pombe
6YYM|1|B (6YYM)
  • RNA (5'-R(*GP*CP*UP*UP*UP*UP*UP*GP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2020-12-23
2.6 Å12(1) 6YYM|1|B
1048NR_3.0_05805.1
Exact match
synthetic construct
7ECP|1|A+7ECP|1|B (7ECP)
  • RNA (5'-R(*GP*GP*GP*CP*CP*CP*GP*GP*UP*CP[...]
  • X-ray diffraction
  • Release Date: 2022-03-16
2.9 Å12(2) 7ECP|1|A+7ECP|1|B, 7ECP|1|C+7ECP|1|D
1049NR_3.0_06457.1
Exact match
422D|1|A+422D|1|B (422D)
  • 5'-R(*GP*AP*UP*CP*AP*CP*UP*UP*CP*GP*GP*U[...]
  • X-ray diffraction
  • Release Date: 2003-06-03
2.6 Å12(1) 422D|1|A+422D|1|B
1050NR_3.0_09952.1
Exact match
1B7F|1|Q (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 1999-05-03
2.6 Å12(1) 1B7F|1|Q
1051NR_3.0_11791.1
Exact match
3BSU|1|D (3BSU)
  • RNA (5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 2008-03-25
2.1 Å12(6) 3BSU|1|D, 3BSU|1|I, 4WKJ|1|A, 4WKJ|1|C, 4WKJ|1|G, 4WKJ|1|D
1052NR_3.0_12608.1
Exact match
Aquifex aeolicus
3R2D|1|R+3R2D|1|S (3R2D)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2011-06-22
2.2 Å12(1) 3R2D|1|R+3R2D|1|S
1053NR_3.0_15746.1
Exact match
Satellite tobacco mosaic virus
7M50|1|e+7M50|1|P (7M50)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.3 Å12(1) 7M50|1|e+7M50|1|P
1054NR_3.0_17580.1
Exact match
4JRT|1|A+4JRT|1|B (4JRT)
  • RNA (5'-R(P*GP*GP*GP*UP*GP*GP*UP*GP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2013-06-05
2.6 Å12(1) 4JRT|1|A+4JRT|1|B
1055NR_3.0_17726.3
Exact match
6XUS|1|A (6XUS)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2021-02-03
1.1 Å12(4) 6XUS|1|A, 6XUR|1|A, 2Q1R|1|A, 157D|1|A+157D|1|B
1056NR_3.0_17854.1
Exact match
synthetic construct
5ZKJ|1|C (5ZKJ)
  • RNA (5'-R(P*CP*GP*GP*GP*AP*UP*GP*UP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2019-04-03
2.8 Å12(2) 5ZKJ|1|C, 5ZKJ|1|E
1057NR_3.0_19715.1
Exact match
255D|1|A (255D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*CP*GP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 1995-02-07
2.0 Å12(1) 255D|1|A
1058NR_3.0_20758.2
Exact match
synthetic construct
5F8J|1|B+5F8J|1|C (5F8J)
  • RNA (35-MER), RNA (5'-R(*UP*GP*UP*UP*CP*[...]
  • X-ray diffraction
  • Release Date: 2016-06-22
2.7 Å12(5) 5F8J|1|B+5F8J|1|C, 5F8G|1|B+5F8G|1|C, 5F8H|1|B+5F8H|1|C, 7W9S|1|B+7W9S|1|C, 5F8I|1|B+5F8I|1|C
1059NR_3.0_22527.1
Exact match
synthetic construct
7R9F|1|B (7R9F)
  • RNA (5'-R(*UP*AP*AP*UP*CP*GP*GP*GP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å12(1) 7R9F|1|B
1060NR_3.0_24161.1
Exact match
Spodoptera frugiperda
4KXT|1|B (4KXT)
  • RNA
  • X-ray diffraction
  • Release Date: 2013-07-31
2.3 Å12(1) 4KXT|1|B
1061NR_3.0_24746.1
Exact match
1YYW|1|I+1YYW|1|J (1YYW)
  • 5'-R(*AP*AP*AP*UP*AP*UP*AP*UP*AP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2005-11-22
2.8 Å12(4) 1YYW|1|I+1YYW|1|J, 1YYW|1|E+1YYW|1|F, 1YYW|1|G+1YYW|1|H, 1YYW|1|K+1YYW|1|L
1062NR_3.0_25771.1
Exact match
Escherichia coli
5D0A|1|F (5D0A)
  • RNA (5'-R(*G*CP*AP*GP*AP*CP*UP*GP*UP*AP*[...]
  • X-ray diffraction
  • Release Date: 2016-09-28
2.1 Å12(3) 5D0A|1|F, 5D0A|1|E, 5T8Y|1|X
1063NR_3.0_26629.3
Exact match
3HK2|1|F (3HK2)
  • RNA (5'-R(*UP*AP*UP*AP*CP*AP*A*CP*UP*CP*[...]
  • X-ray diffraction
  • Release Date: 2009-10-06
2.8 Å12(4) 3HK2|1|F, 3HK2|1|D, 3F73|1|Y, 3F73|1|H
1064NR_3.0_28532.1
Exact match
2ATW|1|B (2ATW)
  • ribosomal RNA (5'- AGAACUCAAUAG -3')
  • X-ray diffraction
  • Release Date: 2005-10-11
2.3 Å12(2) 2ATW|1|B, 2ATW|1|D
1065NR_3.0_29032.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7B3D|1|T+7B3D|1|P (7B3D)
  • RNA (5'-R(P*UP*GP*CP*AP*CP*UP*GP*CP*GP*U[...]
  • Electron microscopy
  • Release Date: 2020-12-23
2.8 Å12(1) 7B3D|1|T+7B3D|1|P
1066NR_3.0_30196.1
Exact match
Tetrahymena thermophila
5C9H|1|C+5C9H|1|D (5C9H)
  • RNA (5'-R(P*UP*CP*AP*UP*UP*CP*AP*GP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2015-10-14
3.0 Å12(1) 5C9H|1|C+5C9H|1|D
1067NR_3.0_31728.1
Exact match
Bacteroides uniformis
7MJW|1|G (7MJW)
  • RNA (5'-R(*GP*GP*AP*CP*UP*GP*AP*AP*(MIA)[...]
  • X-ray diffraction
  • Release Date: 2021-09-15
1.4 Å12(4) 7MJW|1|G, 7MJW|1|M, 7MJX|1|M, 7MJX|1|D
1068NR_3.0_31876.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7DFH|1|T+7DFH|1|P (7DFH)
  • RNA (5'-R(P*CP*CP*CP*CP*CP*AP*CP*AP*UP*A[...]
  • Electron microscopy
  • Release Date: 2021-11-17
3.0 Å12(1) 7DFH|1|T+7DFH|1|P
1069NR_3.0_33458.1
Exact match
Homo sapiens
3MIJ|1|A (3MIJ)
  • RNA (5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP[...]
  • X-ray diffraction
  • Release Date: 2011-02-16
2.6 Å12(1) 3MIJ|1|A
1070NR_3.0_34288.1
Exact match
3QJL|1|R (3QJL)
  • RNA (5'-R(*GP*UP*UP*AP*CP*AP*AP*UP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2012-02-08
2.7 Å12(2) 3QJL|1|R, 3QJL|1|X
1071NR_3.0_34353.1
Exact match
3QJJ|1|R (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-ray diffraction
  • Release Date: 2012-02-08
2.8 Å12(1) 3QJJ|1|R
1072NR_3.0_35969.1
Exact match
4NGC|1|B (4NGC)
  • 5'-R(*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2014-03-05
2.1 Å12(1) 4NGC|1|B
1073NR_3.0_36012.1
Exact match
synthetic construct
7ECO|1|E+7ECO|1|F (7ECO)
  • RNA (5'-R(*GP*GP*GP*UP*CP*CP*GP*GP*UP*CP[...]
  • X-ray diffraction
  • Release Date: 2022-03-16
1.8 Å12(3) 7ECO|1|E+7ECO|1|F, 7ECO|1|A+7ECO|1|B, 7ECO|1|C+7ECO|1|D
1074NR_3.0_36371.1
Exact match
283D|1|A (283D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*GP*GP[...]
  • X-ray diffraction
  • Release Date: 1996-09-30
2.3 Å12(1) 283D|1|A
1075NR_3.0_37706.1
Exact match
synthetic construct
6OZP|1|C+6OZP|1|D (6OZP)
  • RNA (5'-R(P*UP*AP*UP*GP*CP*AP*UP*GP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2019-09-04
2.0 Å12(2) 6OZP|1|C+6OZP|1|D, 6OZS|1|C+6OZS|1|D
1076NR_3.0_47933.1
Exact match
4NGD|1|B (4NGD)
  • 5'-R(*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2014-03-05
2.0 Å12(2) 4NGD|1|B, 4NGB|1|B
1077NR_3.0_49362.3
Exact match
280D|1|A+280D|1|B (280D)
  • RNA (5'-R(*GP*GP*CP*GP*CP*UP*UP*GP*CP*GP[...]
  • X-ray diffraction
  • Release Date: 1996-09-30
2.4 Å12(2) 280D|1|A+280D|1|B, 280D|1|C+280D|1|D
1078NR_3.0_51487.1
Exact match
4L8H|1|R (4L8H)
  • RNA HAIRPIN, 5'-R(*AP*UP*GP*CP*AP*UP*GP*[...]
  • X-ray diffraction
  • Release Date: 2013-10-02
2.4 Å12(8) 4L8H|1|R, 2BS1|1|R, 2BS1|1|S, 2BS0|1|R, 1ZSE|1|R, 2BS0|1|S, 2B2D|1|R, 2B2D|1|S
1079NR_3.0_55371.1
Exact match
3AVW|1|T+3AVW|1|G (3AVW)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-ray diffraction
  • Release Date: 2012-01-18
2.6 Å12(1) 3AVW|1|T+3AVW|1|G
1080NR_3.0_55496.1
Exact match
205D|1|A+205D|1|B (205D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*UP*GP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 1995-09-15
2.6 Å12(1) 205D|1|A+205D|1|B
1081NR_3.0_56560.1
Exact match
3QJJ|1|Q (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-ray diffraction
  • Release Date: 2012-02-08
2.8 Å12(1) 3QJJ|1|Q
1082NR_3.0_57417.1
Exact match
3HO1|1|Y (3HO1)
  • 5'-R(P*CP*CP*UP*AP*CP*UP*AP*CP*CP*UP*CP*[...]
  • X-ray diffraction
  • Release Date: 2009-10-06
2.6 Å12(1) 3HO1|1|Y
1083NR_3.0_58198.1
Exact match
2R1S|1|A+2R1S|1|B (2R1S)
  • RNA (5'-R(*GP*CP*GP*UP*UP*(5BU)P*GP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2007-09-25
1.4 Å12(4) 2R1S|1|A+2R1S|1|B, 2R22|1|A+2R22|1|B, 2R21|1|A+2R21|1|B, 2R20|1|A+2R20|1|B
1084NR_3.0_59092.1
Exact match
Severe acute respiratory syndrome-related coronavirus
7AAP|1|T+7AAP|1|P (7AAP)
  • RNA (5'-R(P*UP*UP*CP*AP*UP*AP*AP*CP*UP*U[...]
  • Electron microscopy
  • Release Date: 2020-09-23
2.5 Å12(1) 7AAP|1|T+7AAP|1|P
1085NR_3.0_61964.1
Exact match
1B7F|1|P (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 1999-05-03
2.6 Å12(1) 1B7F|1|P
1086NR_3.0_62241.1
Exact match
Influenza B virus (B/Acre/117701/2012)
8BE0|1|V (8BE0)
  • 5' vRNA
  • Electron microscopy
  • Release Date: 2022-12-28
2.3 Å12(3) 8BE0|1|V, 8BDR|1|V, 8BF5|1|V
1087NR_3.0_63943.1
Exact match
Escherichia coli
354D|1|A+354D|1|B (354D)
  • RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 1997-11-26
1.5 Å12(1) 354D|1|A+354D|1|B
1088NR_3.0_64649.1
Exact match
2PY9|1|F (2PY9)
  • 12-mer C-rich strand of human telomeric [...]
  • X-ray diffraction
  • Release Date: 2007-06-12
2.6 Å12(2) 2PY9|1|F, 2PY9|1|E
1089NR_3.0_65401.1
Exact match
3IEV|1|D (3IEV)
  • 5'-R(P*AP*UP*CP*AP*CP*CP*UP*CP*CP*UP*UP*[...]
  • X-ray diffraction
  • Release Date: 2009-08-25
1.9 Å12(1) 3IEV|1|D
1090NR_3.0_65987.1
Exact match
synthetic construct
7XD9|1|B+7XD9|1|C (7XD9)
  • RNA (30-mer), RNA (9-mer)
  • X-ray diffraction
  • Release Date: 2022-12-21
2.6 Å12(12) 7XD9|1|B+7XD9|1|C, 7XD9|1|H+7XD9|1|I, 7XD9|1|E+7XD9|1|F, 7XD9|1|N+7XD9|1|O, 7XD9|1|Q+7XD9|1|R, 7XD9|1|K+7XD9|1|L, 7XD8|1|B+7XD8|1|C, 7XD8|1|E+7XD8|1|F, 7XD8|1|N+7XD8|1|O, 7XD8|1|H+7XD8|1|I, 7XD8|1|K+7XD8|1|L, 7XD8|1|Q+7XD8|1|R
1091NR_3.0_65991.1
Exact match
synthetic construct
7QUA|1|A (7QUA)
  • RNA (5'-R(*CP*GP*CP*GP*(XAN)P*AP*UP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2023-01-25
1.0 Å12(1) 7QUA|1|A
1092NR_3.0_67797.1
Exact match
synthetic construct
7R9G|1|B (7R9G)
  • RNA (5'-R(*AP*AP*AP*UP*CP*GP*GP*GP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.4 Å12(1) 7R9G|1|B
1093NR_3.0_72830.1
Exact match
synthetic construct
5E3H|1|B+5E3H|1|C (5E3H)
  • RNA (5'-R(*CP*GP*AP*CP*GP*CP*UP*AP*GP*CP[...]
  • X-ray diffraction
  • Release Date: 2015-11-18
2.7 Å12(2) 5E3H|1|B+5E3H|1|C, 6GPG|1|B+6GPG|1|C
1094NR_3.0_79282.1
Exact match
3FTM|1|D+3FTM|1|C (3FTM)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2009-02-24
2.7 Å12(2) 3FTM|1|D+3FTM|1|C, 3FTM|1|B+3FTM|1|A
1095NR_3.0_81475.1
Exact match
1SDR|1|A+1SDR|1|B (1SDR)
  • RNA (5'-R(*UP*AP*AP*GP*GP*AP*GP*GP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 1995-02-27
2.6 Å12(2) 1SDR|1|A+1SDR|1|B, 1SDR|1|C+1SDR|1|D
1096NR_3.0_82818.1
Exact match
4KRF|1|R (4KRF)
  • RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2013-06-19
2.1 Å12(1) 4KRF|1|R
1097NR_3.0_83188.1
Exact match
Homo sapiens
6OON|1|B (6OON)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2019-07-31
1.9 Å12(1) 6OON|1|B
1098NR_3.0_85316.1
Exact match
Lassa mammarenavirus
7OJN|1|D (7OJN)
  • 5' RNA
  • Electron microscopy
  • Release Date: 2021-12-01
2.9 Å12(1) 7OJN|1|D
1099NR_3.0_85514.1
Exact match
1YYK|1|C+1YYK|1|D (1YYK)
  • 5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2005-11-22
2.5 Å12(4) 1YYK|1|C+1YYK|1|D, 1YYK|1|E+1YYK|1|F, 1YYO|1|E+1YYO|1|F, 1YYO|1|C+1YYO|1|D
1100NR_3.0_88374.1
Exact match
Thermus thermophilus
4C9D|1|D (4C9D)
  • R3 REPEAT RNA CLEAVAGE PRODUCT
  • X-ray diffraction
  • Release Date: 2013-11-06
3.0 Å12(2) 4C9D|1|D, 4C9D|1|C
1101NR_3.0_93523.1
Exact match
1ZBI|1|C (1ZBI)
  • 5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP*UP*C[...]
  • X-ray diffraction
  • Release Date: 2005-07-12
1.9 Å12(2) 1ZBI|1|C, 1ZBL|1|C
1102NR_3.0_96160.1
Exact match
3CJZ|1|A+3CJZ|1|B (3CJZ)
  • RNA (5'-R(*GP*GP*AP*CP*GP*(M2G)P*AP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2008-10-14
1.8 Å12(1) 3CJZ|1|A+3CJZ|1|B
1103NR_3.0_98689.1
Exact match
Nicotiana tabacum
8AUV|1|B (8AUV)
  • mRNA
  • Electron microscopy
  • Release Date: 2023-06-07
2.4 Å12(1) 8AUV|1|B
1104NR_3.0_99060.1
Exact match
353D|1|A+353D|1|B (353D)
  • RNA (5'-R(*AP*UP*CP*CP*CP*CP*CP*GP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 1997-11-10
2.4 Å12(1) 353D|1|A+353D|1|B
1105NR_3.0_01949.5
Exact match
synthetic construct
5UED|1|A+5UED|1|B (5UED)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*GP*AP*CP[...]
  • X-ray diffraction
  • Release Date: 2017-07-05
1.5 Å11(20) 5UED|1|A+5UED|1|B, 6C8J|1|A+6C8J|1|B, 7KUP|1|A+7KUP|1|B, 7KUK|1|A+7KUK|1|B, 7KUM|1|A+7KUM|1|B, 8SWG|1|A+8SWG|1|B, 7KUL|1|A+7KUL|1|B, 6C8D|1|A+6C8D|1|B, 6C8I|1|A+6C8I|1|B, 5UEE|1|A+5UEE|1|B, 6C8L|1|A+6C8L|1|B, 6C8E|1|A+6C8E|1|B, 6U8U|1|A+6U8U|1|B, 5UEF|1|A+5UEF|1|B, 7KUO|1|A+7KUO|1|B, 6C8K|1|A+6C8K|1|B, 6CAB|1|A+6CAB|1|B, 6OWL|1|A, 5UEG|1|A+5UEG|1|B, 5UEG|1|C+5UEG|1|D
1106NR_3.0_02486.1
Exact match
Satellite tobacco mosaic virus
5BKN|1|e (5BKN)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
3.0 Å11(1) 5BKN|1|e
1107NR_3.0_03986.1
Exact match
1KD5|1|A+1KD5|1|B (1KD5)
  • 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2003-03-04
1.6 Å11(2) 1KD5|1|A+1KD5|1|B, 1KD3|1|A+1KD3|1|B
1108NR_3.0_05217.5
Exact match
Brassica oleracea
8HIM|1|P (8HIM)
  • RNA (5'-R(*UP*AP*UP*AP*UP*GP*CP*AP*UP*AP[...]
  • Electron microscopy
  • Release Date: 2023-03-22
2.8 Å11(1) 8HIM|1|P
1109NR_3.0_07342.1
Exact match
Thermococcus kodakarensis
6WYB|1|B (6WYB)
  • RNA strand
  • X-ray diffraction
  • Release Date: 2020-08-19
2.5 Å11(1) 6WYB|1|B
1110NR_3.0_07832.1
Exact match
3IBK|1|A (3IBK)
  • RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*G[...]
  • X-ray diffraction
  • Release Date: 2010-05-12
2.2 Å11(1) 3IBK|1|A
1111NR_3.0_08637.1
Exact match
synthetic construct
5BZ1|1|B (5BZ1)
  • RNA (5'-R(*UP*GP*UP*AP*UP*UP*UP*GP*UP*A)[...]
  • X-ray diffraction
  • Release Date: 2015-09-23
2.2 Å11(1) 5BZ1|1|B
1112NR_3.0_08929.1
Exact match
synthetic construct
5LTA|1|E (5LTA)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2017-01-25
2.6 Å11(1) 5LTA|1|E
1113NR_3.0_09810.1
Exact match
4JRD|1|B (4JRD)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2013-06-05
1.0 Å11(4) 4JRD|1|B, 4JRD|1|A, 5VXQ|1|B, 5VXQ|1|A
1114NR_3.0_09965.1
Exact match
synthetic construct
7UU5|1|M+7UU5|1|N (7UU5)
  • RNA (5'-R(P*UP*AP*AP*CP*GP*CP*UP*GP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2023-01-11
2.9 Å11(1) 7UU5|1|M+7UU5|1|N
1115NR_3.0_11198.1
Exact match
1BMV|1|M (1BMV)
  • RNA (5'-R(*GP*GP*UP*CP*AP*AP*AP*AP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 1989-10-09
3.0 Å11(1) 1BMV|1|M
1116NR_3.0_13543.1
Exact match
synthetic construct
5WZK|1|B (5WZK)
  • RNA (5'-R(*GP*GP*AP*AP*UP*UP*GP*AP*CP*GP[...]
  • X-ray diffraction
  • Release Date: 2017-09-27
2.8 Å11(1) 5WZK|1|B
1117NR_3.0_16232.3
Exact match
synthetic construct
5L00|1|A+5L00|1|B (5L00)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-ray diffraction
  • Release Date: 2016-12-07
1.3 Å11(13) 5L00|1|A+5L00|1|B, 5L00|1|C+5L00|1|D, 5KRG|1|C+5KRG|1|D, 5KRG|1|A+5KRG|1|B, 7U87|1|A+7U87|1|B, 6U6J|1|A+6U6J|1|B, 6C8O|1|A+6C8O|1|B, 5V0H|1|A+5V0H|1|B, 7U89|1|A+7U89|1|B, 6C8N|1|A+6C8N|1|B, 7U8A|1|A+7U8A|1|B, 6C8M|1|A+6C8M|1|B, 7U88|1|A+7U88|1|B
1118NR_3.0_16377.1
Exact match
synthetic construct
5JCF|1|Y+5JCF|1|X (5JCF)
  • RNA (5'-R(P*AP*GP*GP*UP*AP*CP*GP*UP*AP*C[...]
  • X-ray diffraction
  • Release Date: 2016-06-01
2.6 Å11(1) 5JCF|1|Y+5JCF|1|X
1119NR_3.0_16594.1
Exact match
Haloarcula marismortui
5G4T|1|A+5G4T|1|B (5G4T)
  • HMKT-7
  • X-ray diffraction
  • Release Date: 2016-09-28
2.8 Å11(1) 5G4T|1|A+5G4T|1|B
1120NR_3.0_20366.1
Exact match
1QCU|1|C+1QCU|1|D (1QCU)
  • 5'-R(P*CP*CP*CP*CP*CP*CP*CP*CP*CP*CP*C)-[...]
  • X-ray diffraction
  • Release Date: 1999-11-11
1.2 Å11(1) 1QCU|1|C+1QCU|1|D
1121NR_3.0_22038.1
Exact match
7BAH|1|C+7BAH|1|D (7BAH)
  • 5'-R(*(GDP)P*AP*CP*GP*CP*UP*AP*GP*CP*GP*[...]
  • X-ray diffraction
  • Release Date: 2022-01-12
1.9 Å11(2) 7BAH|1|C+7BAH|1|D, 3NCU|1|C+3NCU|1|D
1122NR_3.0_22308.1
Exact match
La Crosse orthobunyavirus
7ORO|1|T+7ORO|1|P (7ORO)
  • RNA (5'-R(P*GP*GP*UP*AP*GP*UP*AP*CP*AP*C[...]
  • Electron microscopy
  • Release Date: 2022-02-16
2.9 Å11(1) 7ORO|1|T+7ORO|1|P
1123NR_3.0_23784.1
Exact match
1QCU|1|A+1QCU|1|B (1QCU)
  • 5'-R(P*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*G)-[...]
  • X-ray diffraction
  • Release Date: 1999-11-11
1.2 Å11(1) 1QCU|1|A+1QCU|1|B
1124NR_3.0_24132.2
Exact match
4NIA|1|c (4NIA)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2014-09-10
1.8 Å11(32) 4NIA|1|c, 4NIA|1|W, 4NIA|1|a, 4NIA|1|S+4NIA|1|h, 4NIA|1|Y+4NIA|1|n, 4NIA|1|R+4NIA|1|g, 4NIA|1|d, 4NIA|1|b, 4NIA|1|T+4NIA|1|i, 4NIA|1|V, 4NIA|1|U, 4NIA|1|P+4NIA|1|e, 4NIA|1|Q, 4NIA|1|X+4NIA|1|m, 4NIA|1|Z, 1A34|1|B+1A34|1|C, 4OQ9|1|U, 4OQ9|1|T+4OQ9|1|i, 4OQ9|1|R+4OQ9|1|g, 4OQ9|1|c, 4OQ9|1|Q, 4OQ9|1|S+4OQ9|1|h, 4OQ9|1|W, 4OQ9|1|Y+4OQ9|1|n, 4OQ9|1|a, 4OQ9|1|d, 4OQ9|1|V, 4OQ9|1|P+4OQ9|1|e, 4OQ9|1|X+4OQ9|1|m, 4OQ9|1|Z, 4OQ9|1|b, 4OQ8|1|B+4OQ8|1|C
1125NR_3.0_28506.1
Exact match
Caenorhabditis elegans
3V6Y|1|B (3V6Y)
  • RNA (5'-R(*UP*AP*CP*UP*GP*UP*GP*CP*CP*AP[...]
  • X-ray diffraction
  • Release Date: 2012-01-04
2.5 Å11(1) 3V6Y|1|B
1126NR_3.0_31135.1
Exact match
synthetic construct
5AOR|1|C (5AOR)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP)-[...]
  • X-ray diffraction
  • Release Date: 2015-11-18
2.1 Å11(2) 5AOR|1|C, 5AOR|1|D
1127NR_3.0_32544.1
Exact match
1LNT|1|A+1LNT|1|B (1LNT)
  • 5'-R(*GP*CP*GP*UP*CP*AP*GP*GP*UP*CP*(CBV[...]
  • X-ray diffraction
  • Release Date: 2003-06-03
1.7 Å11(1) 1LNT|1|A+1LNT|1|B
1128NR_3.0_33378.1
Exact match
Caenorhabditis elegans
3V74|1|B (3V74)
  • RNA (5'-R(*UP*CP*AP*UP*GP*UP*GP*CP*CP*AP[...]
  • X-ray diffraction
  • Release Date: 2012-01-04
2.3 Å11(1) 3V74|1|B
1129NR_3.0_33499.1
Exact match
Streptococcus pneumoniae
5ZQ8|1|D (5ZQ8)
  • RNA (5'-R(*CP*CP*GP*UP*(MUM)P*GP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2018-10-24
2.2 Å11(2) 5ZQ8|1|D, 5ZQ8|1|C
1130NR_3.0_36783.1
Exact match
Satellite tobacco mosaic virus
5BKN|1|bb+5BKN|1|qq (5BKN)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
3.0 Å11(1) 5BKN|1|bb+5BKN|1|qq
1131NR_3.0_36938.1
Exact match
synthetic construct
5I9H|1|B (5I9H)
  • RNA (5'-R(*GP*GP*GP*GP*UP*UP*UP*UP*GP*GP[...]
  • X-ray diffraction
  • Release Date: 2016-04-27
2.5 Å11(1) 5I9H|1|B
1132NR_3.0_37298.1
Exact match
2ASB|1|B (2ASB)
  • ribosomal RNA (5'- GAACUCAAUAG -3')
  • X-ray diffraction
  • Release Date: 2005-10-11
1.5 Å11(1) 2ASB|1|B
1133NR_3.0_37308.1
Exact match
Satellite tobacco mosaic virus
5BKL|1|e+5BKL|1|P (5BKL)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å11(1) 5BKL|1|e+5BKL|1|P
1134NR_3.0_37536.1
Exact match
synthetic construct
6M6S|1|C+6M6S|1|D (6M6S)
  • RNA (5'-R(*(GTP)P*GP*CP*GP*CP*GP*CP*GP*C[...]
  • X-ray diffraction
  • Release Date: 2021-03-17
1.6 Å11(1) 6M6S|1|C+6M6S|1|D
1135NR_3.0_38306.1
Exact match
Homo sapiens
6DCL|1|C (6DCL)
  • RNA (5'-R(*AP*GP*UP*AP*GP*AP*UP*UP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2018-06-27
2.5 Å11(1) 6DCL|1|C
1136NR_3.0_38769.1
Exact match
synthetic construct
5I9D|1|B (5I9D)
  • RNA (5'-R(*GP*GP*GP*G*UP*UP*UP*UP*AP*AP*[...]
  • X-ray diffraction
  • Release Date: 2016-04-27
2.6 Å11(1) 5I9D|1|B
1137NR_3.0_39119.1
Exact match
2G92|1|A+2G92|1|B (2G92)
  • 5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*AP*GP*[...]
  • X-ray diffraction
  • Release Date: 2006-04-18
1.6 Å11(1) 2G92|1|A+2G92|1|B
1138NR_3.0_42548.1
Exact match
synthetic construct
5WZH|1|B (5WZH)
  • RNA (5'-R(*GP*GP*AP*AP*UP*UP*GP*AP*CP*GP[...]
  • X-ray diffraction
  • Release Date: 2017-09-27
2.5 Å11(1) 5WZH|1|B
1139NR_3.0_42883.1
Exact match
synthetic construct
5WZI|1|B (5WZI)
  • RNA (5'-R(*GP*GP*AP*GP*UP*UP*GP*AP*CP*GP[...]
  • X-ray diffraction
  • Release Date: 2017-09-27
2.8 Å11(1) 5WZI|1|B
1140NR_3.0_43749.1
Exact match
2Q1O|1|C+2Q1O|1|D (2Q1O)
  • RNA (5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2007-10-30
1.1 Å11(2) 2Q1O|1|C+2Q1O|1|D, 2Q1O|1|A+2Q1O|1|B
1141NR_3.0_44326.1
Exact match
1YZ9|1|C+1YZ9|1|D+1YZ9|1|E+1YZ9|1|F (1YZ9)
  • 5'-R(*CP*GP*AP*AP*CP*UP*UP*CP*GP*CP*G)-3[...]
  • X-ray diffraction
  • Release Date: 2005-11-22
2.1 Å11(1) 1YZ9|1|C+1YZ9|1|D+1YZ9|1|E+1YZ9|1|F
1142NR_3.0_44340.1
Exact match
3LRR|1|C+3LRR|1|D (3LRR)
  • RNA (5'-R(*(ATP)P*UP*AP*UP*AP*UP*AP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2010-06-02
2.2 Å11(1) 3LRR|1|C+3LRR|1|D
1143NR_3.0_46052.1
Exact match
synthetic construct
6QIC|1|F (6QIC)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2019-03-06
2.7 Å11(4) 6QIC|1|F, 6QIC|1|H, 6QIC|1|E, 6QIC|1|G
1144NR_3.0_47834.1
Exact match
Tribolium castaneum
7KQM|1|B (7KQM)
  • RNA (5'-R(*AP*UP*CP*CP*AP*GP*GP*UP*GP*CP[...]
  • X-ray diffraction
  • Release Date: 2022-03-23
2.7 Å11(1) 7KQM|1|B
1145NR_3.0_48333.1
Exact match
Schizosaccharomyces pombe
6FPX|1|D (6FPX)
  • RNA (5'-R(P*UP*UP*UP*AP*AP*AP*CP*CP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2018-05-09
2.0 Å11(1) 6FPX|1|D
1146NR_3.0_49464.2
Exact match
synthetic construct
5AY2|1|A+5AY2|1|B (5AY2)
  • RNA (5'-R(*GP*GP*AP*CP*UP*(CBR)P*GP*AP*C[...]
  • X-ray diffraction
  • Release Date: 2015-10-21
1.3 Å11(6) 5AY2|1|A+5AY2|1|B, 5AY3|1|A+5AY3|1|B, 5AY2|1|C+5AY2|1|D, 5AY4|1|A+5AY4|1|B, 7EDU|1|A+7EDU|1|B, 7EDU|1|C+7EDU|1|D
1147NR_3.0_49747.1
Exact match
Homo sapiens
3NNH|1|F (3NNH)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2010-10-27
2.8 Å11(1) 3NNH|1|F
1148NR_3.0_51631.1
Exact match
Homo sapiens
3NNH|1|E (3NNH)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2010-10-27
2.8 Å11(1) 3NNH|1|E
1149NR_3.0_55153.1
Exact match
3FS0|1|B+3FS0|1|A (3FS0)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2009-02-24
2.3 Å11(1) 3FS0|1|B+3FS0|1|A
1150NR_3.0_63837.1
Exact match
Saccharomyces cerevisiae
5WTY|1|D (5WTY)
  • RNA (5'-R(*AP*AP*AP*GP*GP*AP*AP*UP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 2017-01-25
2.8 Å11(1) 5WTY|1|D
1151NR_3.0_64635.1
Exact match
1KD4|1|A+1KD4|1|B (1KD4)
  • 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2003-03-04
1.9 Å11(1) 1KD4|1|A+1KD4|1|B
1152NR_3.0_65768.1
Exact match
3AEV|1|C (3AEV)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*CP*UP*CP[...]
  • X-ray diffraction
  • Release Date: 2010-04-21
2.8 Å11(1) 3AEV|1|C
1153NR_3.0_66547.1
Exact match
Saccharomyces cerevisiae
5WTY|1|C (5WTY)
  • RNA (5'-R(*AP*AP*AP*GP*GP*AP*AP*UP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 2017-01-25
2.8 Å11(1) 5WTY|1|C
1154NR_3.0_66760.1
Exact match
synthetic construct
5I9F|1|F (5I9F)
  • RNA (5'-R(*GP*GP*GP*GP*UP*UP*UP*UP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2016-04-27
2.2 Å11(1) 5I9F|1|F
1155NR_3.0_67617.1
Exact match
synthetic construct
7Y7P|1|C+7Y7P|1|D (7Y7P)
  • RNA (5'-R(*GP*AP*A*CP*UP*AP*UP*GP*GP*UP*[...]
  • X-ray diffraction
  • Release Date: 2022-09-28
2.7 Å11(2) 7Y7P|1|C+7Y7P|1|D, 7Y7P|1|E+7Y7P|1|J
1156NR_3.0_70081.1
Exact match
3IBK|1|B (3IBK)
  • RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*G[...]
  • X-ray diffraction
  • Release Date: 2010-05-12
2.2 Å11(1) 3IBK|1|B
1157NR_3.0_71544.1
Exact match
Satellite tobacco mosaic virus
5BKL|1|bb+5BKL|1|qq (5BKL)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å11(1) 5BKL|1|bb+5BKL|1|qq
1158NR_3.0_73125.1
Exact match
synthetic construct
7EDT|1|A+7EDT|1|B (7EDT)
  • RNA (5'-R(*GP*GP*AP*CP*UP*CP*CP*GP*GP*(5[...]
  • X-ray diffraction
  • Release Date: 2022-03-23
1.2 Å11(1) 7EDT|1|A+7EDT|1|B
1159NR_3.0_75220.1
Exact match
synthetic construct
7ECK|1|I+7ECK|1|J (7ECK)
  • DNA/RNA (5'-R(*GP*GP*AP*CP*U)-D(P*(CBR))[...]
  • X-ray diffraction
  • Release Date: 2022-03-16
2.8 Å11(6) 7ECK|1|I+7ECK|1|J, 7ECK|1|G+7ECK|1|H, 7ECK|1|E+7ECK|1|F, 7ECK|1|A+7ECK|1|B, 7ECK|1|K+7ECK|1|L, 7ECK|1|C+7ECK|1|D
1160NR_3.0_77791.1
Exact match
Tetrahymena thermophila
5C9H|1|G+5C9H|1|E (5C9H)
  • RNA (5'-R(P*UP*CP*AP*UP*UP*CP*AP*GP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2015-10-14
3.0 Å11(1) 5C9H|1|G+5C9H|1|E
1161NR_3.0_79094.1
Exact match
Lassa mammarenavirus
7OJN|1|R+7OJN|1|M (7OJN)
  • 3' RNA, product RNA
  • Electron microscopy
  • Release Date: 2021-12-01
2.9 Å11(1) 7OJN|1|R+7OJN|1|M
1162NR_3.0_79645.1
Exact match
Spodoptera frugiperda
4KRE|1|R (4KRE)
  • RNA (5'-R(P*AP*AP*UP*AP*UP*UP*AP*AP*A*AP[...]
  • X-ray diffraction
  • Release Date: 2013-06-19
1.8 Å11(1) 4KRE|1|R
1163NR_3.0_86033.1
Exact match
Homo sapiens
6DCL|1|D (6DCL)
  • RNA (5'-R(*AP*GP*UP*AP*GP*AP*UP*UP*AP*GP[...]
  • X-ray diffraction
  • Release Date: 2018-06-27
2.5 Å11(1) 6DCL|1|D
1164NR_3.0_86951.1
Exact match
synthetic construct
7RDQ|1|I (7RDQ)
  • RNA (5'-R(P*GP*GP*GP*GP*GP*GP*GP*GP*GP*G[...]
  • Electron microscopy
  • Release Date: 2022-02-02
3.0 Å11(1) 7RDQ|1|I
1165NR_3.0_88000.1
Exact match
synthetic construct
5XOG|1|P (5XOG)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*AP*UP*CP[...]
  • X-ray diffraction
  • Release Date: 2017-08-16
3.0 Å11(1) 5XOG|1|P
1166NR_3.0_90371.1
Exact match
synthetic construct
5WZJ|1|B (5WZJ)
  • RNA (5'-R(*GP*GP*AP*UP*UP*UP*GP*AP*CP*GP[...]
  • X-ray diffraction
  • Release Date: 2017-09-27
2.1 Å11(1) 5WZJ|1|B
1167NR_3.0_01773.1
Exact match
Vaccinia virus GLV-1h68
7AOH|1|P (7AOH)
  • RNA (5'-R(P*AP*AP*AP*AP*UP*CP*UP*AP*UP*A[...]
  • Electron microscopy
  • Release Date: 2021-10-06
2.7 Å10(1) 7AOH|1|P
1168NR_3.0_06694.1
Exact match
4ED5|1|D (4ED5)
  • 5'-R(*A*UP*UP*UP*UP*UP*AP*UP*UP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2012-05-23
2.0 Å10(2) 4ED5|1|D, 4ED5|1|C
1169NR_3.0_07550.1
Exact match
Streptococcus pneumoniae
5XJ2|1|G (5XJ2)
  • RNA (5'-R(*GP*GP*CP*AP*CP*GP*UP*GP*CP*U)[...]
  • X-ray diffraction
  • Release Date: 2017-11-01
2.8 Å10(1) 5XJ2|1|G
1170NR_3.0_07634.1
Exact match
Homo sapiens
6HU6|1|B+6HU6|1|F (6HU6)
  • RNA (5'-R(*GP*AP*GP*UP*GP*CP*CP*AP*GP*A)[...]
  • X-ray diffraction
  • Release Date: 2018-11-21
1.9 Å10(1) 6HU6|1|B+6HU6|1|F
1171NR_3.0_09807.1
Exact match
synthetic construct
6LSH|1|B+6LSH|1|C (6LSH)
  • RNA (35-MER), RNA (5'-R(*UP*GP*UP*UP*CP*[...]
  • X-ray diffraction
  • Release Date: 2020-04-29
2.2 Å10(1) 6LSH|1|B+6LSH|1|C
1172NR_3.0_11108.1
Exact match
synthetic construct
8SX6|1|B+8SX6|1|A (8SX6)
  • RNA (5'-R(*(TLN)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-ray diffraction
  • Release Date: 2023-05-31
1.5 Å10(4) 8SX6|1|B+8SX6|1|A, 8SY1|1|A+8SY1|1|B, 8SWO|1|A+8SWO|1|B, 8SY1|1|C+8SY1|1|D
1173NR_3.0_11942.1
Exact match
6MSF|1|S (6MSF)
  • RNA (5'-R(*CP*AP*GP*UP*CP*AP*CP*UP*GP*G)[...]
  • X-ray diffraction
  • Release Date: 1998-07-08
2.8 Å10(1) 6MSF|1|S
1174NR_3.0_14212.1
Exact match
synthetic construct
5HO4|1|B (5HO4)
  • RNA (5'-R(*AP*AP*GP*GP*AP*CP*UP*AP*GP*C)[...]
  • X-ray diffraction
  • Release Date: 2017-02-08
1.9 Å10(1) 5HO4|1|B
1175NR_3.0_14653.1
Exact match
1DQF|1|B+1DQF|1|A (1DQF)
  • RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)[...]
  • X-ray diffraction
  • Release Date: 2000-11-13
2.2 Å10(1) 1DQF|1|B+1DQF|1|A
1176NR_3.0_14757.1
Exact match
synthetic construct
5ZC9|1|B (5ZC9)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*AP*GP*AP*G)[...]
  • X-ray diffraction
  • Release Date: 2019-01-16
2.0 Å10(2) 5ZC9|1|B, 6XKI|1|B
1177NR_3.0_15457.1
Exact match
synthetic construct
7BPV|1|S (7BPV)
  • RNA (5'-R(P*GP*UP*GP*GP*GP*CP*CP*GP*AP*C[...]
  • X-ray diffraction
  • Release Date: 2021-03-03
1.8 Å10(1) 7BPV|1|S
1178NR_3.0_17672.1
Exact match
Satellite tobacco mosaic virus
7M2V|1|yy+7M2V|1|zz (7M2V)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
1.8 Å10(1) 7M2V|1|yy+7M2V|1|zz
1179NR_3.0_18726.1
Exact match
synthetic construct
6MFN|1|E+6MFN|1|C (6MFN)
  • RNA (5'-R(P*UP*CP*UP*GP*UP*GP*AP*UP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2019-08-07
2.5 Å10(1) 6MFN|1|E+6MFN|1|C
1180NR_3.0_18996.1
Exact match
1DI2|1|E (1DI2)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*C)[...]
  • X-ray diffraction
  • Release Date: 1999-12-02
1.9 Å10(5) 1DI2|1|E, 1DI2|1|C+1DI2|1|D, 1RC7|1|B+1RC7|1|C, 1RC7|1|D+1RC7|1|E, 1DI2|1|G
1181NR_3.0_20857.1
Exact match
synthetic construct
5VAJ|1|C (5VAJ)
  • RNA (5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*(U[...]
  • X-ray diffraction
  • Release Date: 2017-09-13
2.0 Å10(1) 5VAJ|1|C
1182NR_3.0_23187.1
Exact match
3AGV|1|S (3AGV)
  • 5'-R(*GP*GP*AP*GP*GP*(UFT)P*GP*(CFZ)P*(U[...]
  • X-ray diffraction
  • Release Date: 2010-11-10
2.2 Å10(2) 3AGV|1|S, 3AGV|1|U
1183NR_3.0_24517.1
Exact match
synthetic construct
7U8B|1|A+7U8B|1|B (7U8B)
  • RNA (5'-R(*(TLN)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-ray diffraction
  • Release Date: 2023-03-15
1.7 Å10(1) 7U8B|1|A+7U8B|1|B
1184NR_3.0_25369.1
Exact match
3NJ7|1|C+3NJ7|1|D (3NJ7)
  • 5'-R(*GP*GP*CP*AP*GP*CP*AP*GP*CP*C)-3'
  • X-ray diffraction
  • Release Date: 2010-08-25
1.9 Å10(4) 3NJ7|1|C+3NJ7|1|D, 3NJ7|1|E+3NJ7|1|F, 3NJ7|1|A+3NJ7|1|B, 3NJ6|1|A
1185NR_3.0_25735.1
Exact match
1PJG|1|A (1PJG)
  • 5'-R(*CP*AP*AP*AP*GP*AP*AP*AP*AP*G)-3', [...]
  • X-ray diffraction
  • Release Date: 2003-12-09
1.2 Å10(9) 1PJG|1|A, 1PJO|1|A, 1G4Q|1|A, 7OOO|1|A, 7OOO|1|D, 1JB8|1|A, 7NRP|1|A, 7OOS|1|A, 7OZZ|1|A
1186NR_3.0_26975.1
Exact match
synthetic construct
5JS1|1|B (5JS1)
  • siRNA
  • X-ray diffraction
  • Release Date: 2016-07-20
2.5 Å10(1) 5JS1|1|B
1187NR_3.0_28670.1
Exact match
synthetic construct
7LO9|1|A+7LO9|1|B (7LO9)
  • Chains: A,B,C,D
  • X-ray diffraction
  • Release Date: 2021-12-22
1.8 Å10(2) 7LO9|1|A+7LO9|1|B, 7LO9|1|C+7LO9|1|D
1188NR_3.0_30079.1
Exact match
synthetic construct
5V1K|1|A+5V1K|1|B (5V1K)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*(5BU)P*(8RJ[...]
  • X-ray diffraction
  • Release Date: 2017-06-21
1.2 Å10(1) 5V1K|1|A+5V1K|1|B
1189NR_3.0_30259.1
Exact match
Mus musculus
5T7B|1|R (5T7B)
  • RNA (UVP)UAUAGAGCAAGAACACUGUU
  • X-ray diffraction
  • Release Date: 2016-12-14
2.5 Å10(1) 5T7B|1|R
1190NR_3.0_30422.1
Exact match
Saccharomyces cerevisiae
2VNU|1|B (2VNU)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP)-3'
  • X-ray diffraction
  • Release Date: 2008-04-08
2.3 Å10(1) 2VNU|1|B
1191NR_3.0_30582.1
Exact match
unidentified
5Z98|1|C (5Z98)
  • RNA (5'-R(P*CP*UP*GP*CP*CP*GP*GP*GP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2018-08-15
2.2 Å10(1) 5Z98|1|C
1192NR_3.0_30844.1
Exact match
1QC0|1|B+1QC0|1|A (1QC0)
  • 5'-R(GP*CP*AP*CP*CP*GP*CP*UP*AP*C)-3', 5[...]
  • X-ray diffraction
  • Release Date: 1999-11-11
1.6 Å10(1) 1QC0|1|B+1QC0|1|A
1193NR_3.0_31125.1
Exact match
Escherichia coli
7UWE|1|R (7UWE)
  • RNA (18-MER)
  • Electron microscopy
  • Release Date: 2023-05-31
2.9 Å10(1) 7UWE|1|R
1194NR_3.0_33558.1
Exact match
Endothia gyrosa
4PCO|1|A+4PCO|1|B (4PCO)
  • RNA (5'-D(*GP*GP*UP*GP*GP*CP*UP*GP*UP*U)[...]
  • X-ray diffraction
  • Release Date: 2015-10-14
1.3 Å10(3) 4PCO|1|A+4PCO|1|B, 4PCO|1|E, 4PCO|1|C+4PCO|1|D
1195NR_3.0_34359.8
Exact match
synthetic construct
2NVQ|1|R (2NVQ)
  • 5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*A)-3', [...]
  • X-ray diffraction
  • Release Date: 2006-12-12
2.9 Å10(3) 2NVQ|1|R, 7OOB|1|P, 7OO3|1|P
1196NR_3.0_35958.1
Exact match
synthetic construct
7Y7Q|1|C+7Y7Q|1|D (7Y7Q)
  • RNA (5'-R(*GP*AP*AP*CP*UP*AP*CP*CP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2022-09-28
2.1 Å10(2) 7Y7Q|1|C+7Y7Q|1|D, 7Y7Q|1|E
1197NR_3.0_37403.4
Exact match
synthetic construct
8SYI|1|R (8SYI)
  • RNA (5'-R(P*CP*GP*GP*AP*GP*AP*GP*GP*UP*A[...]
  • Electron microscopy
  • Release Date: 2023-07-05
2.9 Å10(2) 8SYI|1|R, 8E95|1|R
1198NR_3.0_37621.1
Exact match
Satellite tobacco mosaic virus
7M2V|1|T+7M2V|1|k (7M2V)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
1.8 Å10(1) 7M2V|1|T+7M2V|1|k
1199NR_3.0_38094.1
Exact match
synthetic construct
7C45|1|D (7C45)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-ray diffraction
  • Release Date: 2021-04-07
1.8 Å10(1) 7C45|1|D
1200NR_3.0_39323.1
Exact match
3ADL|1|B+3ADL|1|C (3ADL)
  • RNA (5'-R(P*CP*GP*CP*GP*CP*GP*CP*GP*CP*G[...]
  • X-ray diffraction
  • Release Date: 2010-05-26
2.2 Å10(1) 3ADL|1|B+3ADL|1|C
1201NR_3.0_42877.1
Exact match
Homo sapiens
4OLA|1|B (4OLA)
  • 5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*U)-3'
  • X-ray diffraction
  • Release Date: 2014-02-05
2.3 Å10(2) 4OLA|1|B, 4OLB|1|B
1202NR_3.0_43595.1
Exact match
synthetic construct
5WWE|1|B (5WWE)
  • RNA (5'-R(*AP*GP*GP*GP*AP*CP*UP*AP*GP*A)[...]
  • X-ray diffraction
  • Release Date: 2018-01-17
2.4 Å10(1) 5WWE|1|B
1203NR_3.0_44115.1
Exact match
Satellite tobacco mosaic virus
7M50|1|WW+7M50|1|V (7M50)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.3 Å10(1) 7M50|1|WW+7M50|1|V
1204NR_3.0_45731.1
Exact match
synthetic construct
6LSG|1|B+6LSG|1|C (6LSG)
  • RNA (35-MER), RNA (5'-R(*UP*GP*UP*UP*CP*[...]
  • X-ray diffraction
  • Release Date: 2020-04-29
2.1 Å10(1) 6LSG|1|B+6LSG|1|C
1205NR_3.0_47419.1
Exact match
Satellite tobacco mosaic virus
7M2V|1|S+7M2V|1|h (7M2V)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
1.8 Å10(22) 7M2V|1|S+7M2V|1|h, 7M2V|1|ff+7M2V|1|xx, 7M2V|1|P+7M2V|1|e, 7M2V|1|TT+7M2V|1|i, 7M2V|1|U, 7M2T|1|Q, 7M2T|1|RR, 7M2T|1|U, 7M2T|1|VV, 7M2T|1|W, 7M2T|1|YY, 7M2T|1|Z, 7M2T|1|a, 7M2T|1|b, 7M2T|1|c, 7M2T|1|cc, 7M2T|1|d, 7M2T|1|dd, 7M2T|1|ee, 7M2T|1|ff, 7M2T|1|gg, 7M2T|1|V+7M2T|1|WW
1206NR_3.0_49339.2
Exact match
synthetic construct
5DHC|1|C+5DHC|1|D (5DHC)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCA)P*(LCG)P*A[...]
  • X-ray diffraction
  • Release Date: 2016-12-07
1.6 Å10(5) 5DHC|1|C+5DHC|1|D, 5DHC|1|A+5DHC|1|B, 5HBX|1|C+5HBX|1|D, 5HBX|1|A+5HBX|1|B, 5V0J|1|A+5V0J|1|B
1207NR_3.0_51111.1
Exact match
Tobacco virtovirus 1
4NIA|1|o (4NIA)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2014-09-10
1.8 Å10(18) 4NIA|1|o, 4NIA|1|p, 4NIA|1|s, 4NIA|1|j, 4NIA|1|r, 4NIA|1|k, 4NIA|1|l, 4NIA|1|q, 4NIA|1|f, 4OQ9|1|p, 4OQ9|1|k, 4OQ9|1|o, 4OQ9|1|r, 4OQ9|1|j, 4OQ9|1|q, 4OQ9|1|f, 4OQ9|1|l, 4OQ9|1|s
1208NR_3.0_51748.1
Exact match
3I62|1|B (3I62)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3', [...]
  • X-ray diffraction
  • Release Date: 2009-09-08
2.0 Å10(4) 3I62|1|B, 3I61|1|B, 3I5X|1|B, 3I5Y|1|B
1209NR_3.0_53424.1
Exact match
2GUN|1|B (2GUN)
  • 5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3'
  • X-ray diffraction
  • Release Date: 2006-08-01
2.8 Å10(1) 2GUN|1|B
1210NR_3.0_54448.1
Exact match
2BBV|1|N (2BBV)
  • RNA (5'-R(*UP*CP*UP*UP*AP*UP*AP*UP*CP*U)[...]
  • X-ray diffraction
  • Release Date: 1994-08-31
2.8 Å10(1) 2BBV|1|N
1211NR_3.0_56321.1
Exact match
synthetic construct
8SXL|1|A+8SXL|1|B (8SXL)
  • RNA (5'-R(*(TLN)P*(TLN)P*(LCA)P*(LCG)P*A[...]
  • X-ray diffraction
  • Release Date: 2023-05-31
1.9 Å10(1) 8SXL|1|A+8SXL|1|B
1212NR_3.0_57060.1
Exact match
1DQH|1|B+1DQH|1|A (1DQH)
  • RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)[...]
  • X-ray diffraction
  • Release Date: 2000-11-13
1.7 Å10(1) 1DQH|1|B+1DQH|1|A
1213NR_3.0_58324.1
Exact match
synthetic construct
6I3P|1|F (6I3P)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2019-03-06
2.8 Å10(4) 6I3P|1|F, 6I3P|1|H, 6I3P|1|E, 6I3P|1|G
1214NR_3.0_58704.1
Exact match
synthetic construct
6O16|1|C (6O16)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-ray diffraction
  • Release Date: 2019-04-17
2.9 Å10(2) 6O16|1|C, 6O16|1|D
1215NR_3.0_61644.1
Exact match
1XMQ|1|X+1XMQ|1|W (1XMQ)
  • Anticodon RNA, A-Site Messenger RNA, tRN[...]
  • X-ray diffraction
  • Release Date: 2004-12-14
3.0 Å10(2) 1XMQ|1|X+1XMQ|1|W, 3T1Y|1|X+3T1Y|1|W
1216NR_3.0_63209.1
Exact match
3R1E|1|A+3R1E|1|B (3R1E)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2011-06-01
1.0 Å10(1) 3R1E|1|A+3R1E|1|B
1217NR_3.0_63322.1
Exact match
Schizosaccharomyces pombe
6FPX|1|B (6FPX)
  • RNA (5'-R(P*UP*UP*UP*AP*AP*AP*CP*CP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2018-05-09
2.0 Å10(2) 6FPX|1|B, 6FPX|1|F
1218NR_3.0_64483.1
Exact match
Satellite tobacco mosaic virus
7M2V|1|QQ (7M2V)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
1.8 Å10(1) 7M2V|1|QQ
1219NR_3.0_66387.1
Exact match
Homo sapiens
3OK4|1|N (3OK4)
  • 5'-R(*GP*GP*CP*AP*UP*UP*AP*CP*GP*GP)-3',[...]
  • X-ray diffraction
  • Release Date: 2011-11-30
1.2 Å10(22) 3OK4|1|N, 3OK4|1|D, 3OK4|1|L, 3OK4|1|Z, 3OK4|1|4, 3OK4|1|V, 3OK4|1|X, 3OK4|1|P, 3OK4|1|F, 3OK4|1|H, 3OK4|1|J, 3OK4|1|R, 3OK4|1|T, 3OK4|1|2, 3OK4|1|B, 3OK2|1|B, 3OK2|1|D, 3OK2|1|F, 2BJ6|1|E, 2BJ6|1|F, 2BJ6|1|G, 2BJ6|1|H
1220NR_3.0_66843.1
Exact match
La Crosse orthobunyavirus
5AMQ|1|C (5AMQ)
  • RNA
  • X-ray diffraction
  • Release Date: 2015-06-03
3.0 Å10(1) 5AMQ|1|C
1221NR_3.0_66900.1
Exact match
Satellite tobacco mosaic virus
7M2V|1|X+7M2V|1|m (7M2V)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
1.8 Å10(1) 7M2V|1|X+7M2V|1|m
1222NR_3.0_69766.1
Exact match
Homo sapiens
4MCF|1|B+4MCF|1|D+4MCF|1|C+4MCF|1|A (4MCF)
  • Gas5 GREM Rev, Gas5 GREM Fwd
  • X-ray diffraction
  • Release Date: 2014-11-12
1.9 Å10(5) 4MCF|1|B+4MCF|1|D+4MCF|1|C+4MCF|1|A, 4MCE|1|B+4MCE|1|A, 4MCF|1|H+4MCF|1|G, 4MCF|1|F+4MCF|1|E, 4MCE|1|D+4MCE|1|C
1223NR_3.0_73303.1
Exact match
synthetic construct
5WZG|1|B (5WZG)
  • RNA (5'-R(*GP*AP*AP*UP*UP*GP*AP*CP*GP*G)[...]
  • X-ray diffraction
  • Release Date: 2017-09-27
2.6 Å10(1) 5WZG|1|B
1224NR_3.0_73930.1
Exact match
synthetic construct
2YJY|1|C (2YJY)
  • 5'-R(*AP*UP*UP*GP*CP*AP*UP*AP*UP*AP)-3'
  • X-ray diffraction
  • Release Date: 2011-06-08
2.6 Å10(2) 2YJY|1|C, 2YJY|1|D
1225NR_3.0_73942.1
Exact match
1EFO|1|B (1EFO)
  • RNA (5'-R(*GP*AP*AP*GP*AP*GP*AP*GP*AP*G)[...]
  • X-ray diffraction
  • Release Date: 2000-05-29
2.3 Å10(1) 1EFO|1|B
1226NR_3.0_73988.1
Exact match
Saccharomyces cerevisiae
5L2L|1|D (5L2L)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*G)[...]
  • X-ray diffraction
  • Release Date: 2016-12-21
1.6 Å10(4) 5L2L|1|D, 5L2L|1|C, 5L2L|1|H, 5L2L|1|G
1227NR_3.0_77156.1
Exact match
synthetic construct
8SX5|1|A+8SX5|1|B (8SX5)
  • RNA (5'-R(*(TLN)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-ray diffraction
  • Release Date: 2023-05-31
2.0 Å10(1) 8SX5|1|A+8SX5|1|B
1228NR_3.0_80035.1
Exact match
Spodoptera frugiperda
5W6V|1|R (5W6V)
  • RNA (5'-R(P*AP*AP*UP*AP*UP*UP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2017-07-26
2.8 Å10(1) 5W6V|1|R
1229NR_3.0_80545.1
Exact match
Satellite tobacco mosaic virus
5BKL|1|WW+5BKL|1|V (5BKL)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å10(1) 5BKL|1|WW+5BKL|1|V
1230NR_3.0_80929.1
Exact match
Satellite tobacco mosaic virus
7M2V|1|Y+7M2V|1|n (7M2V)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
1.8 Å10(1) 7M2V|1|Y+7M2V|1|n
1231NR_3.0_81175.1
Exact match
1M8Y|1|D (1M8Y)
  • 5'-R(P*AP*UP*UP*GP*UP*AP*CP*AP*UP*A)-3'
  • X-ray diffraction
  • Release Date: 2002-09-25
2.6 Å10(2) 1M8Y|1|D, 1M8Y|1|C
1232NR_3.0_81393.1
Exact match
Escherichia coli
8FVW|1|C (8FVW)
  • RNA (16-MER)
  • Electron microscopy
  • Release Date: 2023-04-05
2.1 Å10(2) 8FVW|1|C, 8FVR|1|C
1233NR_3.0_84932.1
Exact match
synthetic construct
5WWF|1|B (5WWF)
  • RNA
  • X-ray diffraction
  • Release Date: 2018-01-17
2.2 Å10(2) 5WWF|1|B, 5WWF|1|D
1234NR_3.0_85270.1
Exact match
Escherichia coli
8CWO|1|Y (8CWO)
  • mRNA
  • Electron microscopy
  • Release Date: 2023-03-15
2.8 Å10(1) 8CWO|1|Y
1235NR_3.0_85489.1
Exact match
unidentified
5Z98|1|D (5Z98)
  • RNA (5'-R(*AP*UP*AP*CP*CP*CP*GP*GP*CP*A)[...]
  • X-ray diffraction
  • Release Date: 2018-08-15
2.2 Å10(1) 5Z98|1|D
1236NR_3.0_86056.1
Exact match
Satellite tobacco mosaic virus
7M2V|1|V+7M2V|1|ww (7M2V)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
1.8 Å10(1) 7M2V|1|V+7M2V|1|ww
1237NR_3.0_86160.1
Exact match
synthetic construct
5BZ5|1|B (5BZ5)
  • RNA (5'-R(*UP*GP*UP*AP*AP*CP*UP*UP*UP*A)[...]
  • X-ray diffraction
  • Release Date: 2015-09-23
2.8 Å10(1) 5BZ5|1|B
1238NR_3.0_87852.1
Exact match
synthetic construct
5JCH|1|U+5JCH|1|V (5JCH)
  • RNA (5'-R(P*GP*GP*UP*AP*CP*GP*UP*AP*CP*C[...]
  • X-ray diffraction
  • Release Date: 2016-06-01
3.0 Å10(5) 5JCH|1|U+5JCH|1|V, 5JCH|1|X+5JCH|1|Y, 5JC3|1|X+5JC3|1|Y, 5JCF|1|C+5JCF|1|D, 5JC3|1|C+5JC3|1|D
1239NR_3.0_88266.1
Exact match
1G2E|1|B (1G2E)
  • 5'-R(P*UP*AP*UP*UP*UP*AP*UP*UP*UP*A)-3'
  • X-ray diffraction
  • Release Date: 2001-02-05
2.3 Å10(1) 1G2E|1|B
1240NR_3.0_91231.1
Exact match
Homo sapiens
3VYX|1|B+3VYX|1|C (3VYX)
  • 5'-R(*GP*CP*GP*CP*GP*CP*GP*CP*GP*CP)-3',[...]
  • X-ray diffraction
  • Release Date: 2013-02-13
2.3 Å10(8) 3VYX|1|B+3VYX|1|C, 4BPB|1|C+4BPB|1|D, 2YKG|1|C+2YKG|1|D, 3VYY|1|C+3VYY|1|D, 3ZD7|1|C+3ZD7|1|D, 3ZD6|1|C+3ZD6|1|D, 3VYY|1|E+3VYY|1|F, 3VYY|1|G
1241NR_3.0_91544.1
Exact match
3BSX|1|C (3BSX)
  • 5'-R(*UP*UP*GP*UP*AP*AP*UP*AP*UP*UP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2008-04-08
2.3 Å10(2) 3BSX|1|C, 3BSX|1|D
1242NR_3.0_91665.5
Exact match
4QCL|1|B (4QCL)
  • RNA primer, RNA (5'-R(*GP*CP*CP*UP*GP*GP[...]
  • X-ray diffraction
  • Release Date: 2014-11-26
2.2 Å10(4) 4QCL|1|B, 7N2M|1|B, 4Q5V|1|B, 4Q5V|1|F
1243NR_3.0_92727.1
Exact match
3K49|1|F (3K49)
  • RNA (5'-R(*CP*CP*UP*GP*UP*AP*AP*AP*UP*A)[...]
  • X-ray diffraction
  • Release Date: 2009-10-27
2.5 Å10(3) 3K49|1|F, 3K49|1|D, 3K49|1|B
1244NR_3.0_92759.1
Exact match
1FIX|1|A (1FIX)
  • RNA (5'-R(*UP*UP*CP*GP*GP*GP*CP*GP*CP*C)[...]
  • X-ray diffraction
  • Release Date: 1996-12-11
2.3 Å10(1) 1FIX|1|A
1245NR_3.0_93033.1
Exact match
Francisella tularensis subsp. holarctica LVS
6WMP|1|R (6WMP)
  • RNA
  • Electron microscopy
  • Release Date: 2020-11-11
3.0 Å10(1) 6WMP|1|R
1246NR_3.0_94840.1
Exact match
404D|1|A (404D)
  • 5'-R(*GP*AP*AP*GP*AP*GP*AP*AP*GP*C)-3'
  • X-ray diffraction
  • Release Date: 1998-12-14
2.5 Å10(1) 404D|1|A
1247NR_3.0_99181.1
Exact match
1MSW|1|R (1MSW)
  • RNA message
  • X-ray diffraction
  • Release Date: 2002-11-15
2.1 Å10(1) 1MSW|1|R
1248NR_3.0_01166.1
Exact match
synthetic construct
7Z1L|1|R (7Z1L)
  • RNA
  • Electron microscopy
  • Release Date: 2022-08-31
2.8 Å9(1) 7Z1L|1|R
1249NR_3.0_06759.1
Exact match
Zea mays
6EEN|1|I (6EEN)
  • RNA (5'-R(P*CP*CP*CP*CP*CP*CP*CP*CP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2019-08-21
2.0 Å9(1) 6EEN|1|I
1250NR_3.0_07184.1
Exact match
synthetic construct
2UXC|1|X+2UXC|1|Y (2UXC)
  • A-SITE MESSENGER RNA FRAGMENT CGGG, ANTI[...]
  • X-ray diffraction
  • Release Date: 2007-05-08
2.9 Å9(1) 2UXC|1|X+2UXC|1|Y
1251NR_3.0_07366.1
Exact match
Zea mays
6EEN|1|F (6EEN)
  • RNA (5'-R(P*GP*GP*GP*GP*GP*GP*GP*GP*G)-3[...]
  • X-ray diffraction
  • Release Date: 2019-08-21
2.0 Å9(1) 6EEN|1|F
1252NR_3.0_07962.1
Exact match
synthetic construct
7LNE|1|A+7LNE|1|B (7LNE)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-ray diffraction
  • Release Date: 2021-09-08
1.5 Å9(3) 7LNE|1|A+7LNE|1|B, 7LNF|1|A+7LNF|1|B, 7LNG|1|A+7LNG|1|B
1253NR_3.0_08107.1
Exact match
synthetic construct
4BOC|1|R (4BOC)
  • 5'-R(*AP*GP*UP*CP*UP*GP*CP*GP*GP*CP*GP*C[...]
  • X-ray diffraction
  • Release Date: 2013-09-25
2.7 Å9(1) 4BOC|1|R
1254NR_3.0_08596.1
Exact match
4B3G|1|G (4B3G)
  • RNA (5'-(AP*AP*AP*AP*AP*AP*AP*AP*AP)-3')
  • X-ray diffraction
  • Release Date: 2012-09-26
2.9 Å9(1) 4B3G|1|G
1255NR_3.0_10014.1
Exact match
3QGC|1|B (3QGC)
  • 5'-R(*UP*GP*UP*GP*CP*CP*UP*UP*A)-3'
  • X-ray diffraction
  • Release Date: 2011-03-23
1.9 Å9(2) 3QGC|1|B, 3QG9|1|B
1256NR_3.0_10954.1
Exact match
2E9R|1|A+2E9R|1|B (2E9R)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*CP*C)-3', 5'-[...]
  • X-ray diffraction
  • Release Date: 2007-06-26
2.8 Å9(1) 2E9R|1|A+2E9R|1|B
1257NR_3.0_12183.1
Exact match
421D|1|B (421D)
  • RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3'[...]
  • X-ray diffraction
  • Release Date: 1999-01-05
1.8 Å9(1) 421D|1|B
1258NR_3.0_12757.1
Exact match
Satellite tobacco mosaic virus
5BKL|1|Y+5BKL|1|n (5BKL)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å9(1) 5BKL|1|Y+5BKL|1|n
1259NR_3.0_14742.1
Exact match
Caenorhabditis elegans
7RZZ|1|B (7RZZ)
  • RNA
  • X-ray diffraction
  • Release Date: 2022-04-13
2.4 Å9(1) 7RZZ|1|B
1260NR_3.0_14980.1
Exact match
3K61|1|B (3K61)
  • 5'-R(*UP*GP*UP*AP*AP*AP*AP*UP*C)-3'
  • X-ray diffraction
  • Release Date: 2009-11-03
2.2 Å9(1) 3K61|1|B
1261NR_3.0_15214.1
Exact match
synthetic construct
8CLM|1|A (8CLM)
  • RNA (5'-R(*G*UP*CP*UP*CP*CP*UP*AP*GP*)-3[...]
  • X-ray diffraction
  • Release Date: 2023-03-01
1.8 Å9(3) 8CLM|1|A, 8CLM|1|B, 8CLM|1|C
1262NR_3.0_15912.1
Exact match
Homo sapiens
8AMI|1|B+8AMI|1|A (8AMI)
  • RNA (5'-R(*AP*UP*GP*UP*GP*GP*CP*AP*U)-3'[...]
  • X-ray diffraction
  • Release Date: 2022-11-23
1.8 Å9(64) 8AMI|1|B+8AMI|1|A, 8AMG|1|H+8AMG|1|G, 8AMG|1|E+8AMG|1|F, 8AMG|1|A+8AMG|1|B, 8AMG|1|C+8AMG|1|D, 8AMG|1|J+8AMG|1|I, 8AMM|1|I+8AMM|1|J, 8AMM|1|G+8AMM|1|H, 8AMM|1|E+8AMM|1|F, 8AMG|1|K+8AMG|1|L, 8AMM|1|K+8AMM|1|L, 8AMM|1|A+8AMM|1|B, 8AMM|1|O+8AMM|1|P, 8AMM|1|C+8AMM|1|D, 8AMM|1|M+8AMM|1|N, 8AMM|1|Z+8AMM|1|Y, 8AMJ|1|A+8AMJ|1|B, 8AMM|1|Q+8AMM|1|R, 8AMM|1|S+8AMM|1|T, 8AMM|1|U+8AMM|1|V, 8AMM|1|c+8AMM|1|d, 8AMM|1|a+8AMM|1|b, 8AMN|1|A+8AMN|1|B, 8AMN|1|C+8AMN|1|D, 8AMN|1|E+8AMN|1|F, 8AMN|1|G+8AMN|1|H, 8AMN|1|I+8AMN|1|J, 8AMN|1|K+8AMN|1|L, 8AMN|1|M+8AMN|1|N, 8AMN|1|O+8AMN|1|P, 8AMN|1|Q+8AMN|1|R, 8AMN|1|S+8AMN|1|T, 8AMN|1|U+8AMN|1|V, 8AMN|1|Y+8AMN|1|Z, 8AMN|1|a+8AMN|1|b, 8AMN|1|c+8AMN|1|d, 8AMK|1|A+8AMK|1|B, 8AMK|1|C+8AMK|1|D, 8AMK|1|E+8AMK|1|F, 8AMK|1|G+8AMK|1|H, 8AMK|1|I+8AMK|1|J, 8AMK|1|K+8AMK|1|L, 8AMK|1|M+8AMK|1|N, 8AMK|1|O+8AMK|1|P, 8AMK|1|Q+8AMK|1|R, 8AMK|1|S+8AMK|1|T, 8AMK|1|U+8AMK|1|V, 8AMK|1|Y+8AMK|1|Z, 8AMK|1|a+8AMK|1|b, 8AMK|1|c+8AMK|1|d, 8AML|1|C+8AML|1|D, 8AML|1|E+8AML|1|F, 8AML|1|G+8AML|1|H, 8AML|1|I+8AML|1|J, 8AML|1|K+8AML|1|L, 8AML|1|M+8AML|1|N, 8AML|1|O+8AML|1|P, 8AML|1|Q+8AML|1|R, 8AML|1|S+8AML|1|T, 8AML|1|U+8AML|1|V, 8AML|1|Y+8AML|1|Z, 8AML|1|a+8AML|1|b, 8AML|1|c+8AML|1|d, 8AML|1|A+8AML|1|B
1263NR_3.0_16683.1
Exact match
Satellite tobacco mosaic virus
5BKN|1|X+5BKN|1|m (5BKN)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
3.0 Å9(1) 5BKN|1|X+5BKN|1|m
1264NR_3.0_18559.1
Exact match
Zea mays
6EEN|1|H (6EEN)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2019-08-21
2.0 Å9(1) 6EEN|1|H
1265NR_3.0_19513.1
Exact match
438D|1|A+438D|1|B (438D)
  • RNA (5'-R(*GP*GP*GP*CP*GP*CP*UP*CP*C)-3'[...]
  • X-ray diffraction
  • Release Date: 1999-05-12
2.5 Å9(1) 438D|1|A+438D|1|B
1266NR_3.0_19539.1
Exact match
synthetic construct
5HNJ|1|A+5HNJ|1|B (5HNJ)
  • RNA (5'-R(*GP*UP*AP*(OFC)P*GP*UP*AP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2016-04-27
1.2 Å9(13) 5HNJ|1|A+5HNJ|1|B, 5HNJ|1|C+5HNJ|1|D, 5HN2|1|B+5HN2|1|A, 5HNJ|1|E+5HNJ|1|F, 5HN2|1|C+5HN2|1|D, 5HN2|1|E+5HN2|1|F, 5HNQ|1|A+5HNQ|1|B, 5HNQ|1|C+5HNQ|1|D, 5HNQ|1|K+5HNQ|1|L, 5HNQ|1|E+5HNQ|1|F, 5HNQ|1|I+5HNQ|1|J, 5HNQ|1|M, 5HNQ|1|G+5HNQ|1|H
1267NR_3.0_19677.1
Exact match
synthetic construct
5C0Y|1|D (5C0Y)
  • poly U RNA
  • X-ray diffraction
  • Release Date: 2015-08-05
2.1 Å9(1) 5C0Y|1|D
1268NR_3.0_21747.1
Exact match
Saccharomyces cerevisiae
4TYY|1|B (4TYY)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2014-12-31
2.7 Å9(1) 4TYY|1|B
1269NR_3.0_23118.1
Exact match
synthetic construct
5HBY|1|A (5HBY)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-ray diffraction
  • Release Date: 2016-12-07
1.2 Å9(2) 5HBY|1|A, 5V0K|1|A
1270NR_3.0_25162.1
Exact match
3K5Q|1|B (3K5Q)
  • 5'-R(P*UP*GP*UP*AP*CP*UP*AP*UP*A)-3', FB[...]
  • X-ray diffraction
  • Release Date: 2009-11-03
2.2 Å9(2) 3K5Q|1|B, 7S02|1|B
1271NR_3.0_26816.1
Exact match
3K5Z|1|B (3K5Z)
  • 5'-R(*UP*GP*UP*AP*CP*CP*AP*UP*A)-3'
  • X-ray diffraction
  • Release Date: 2009-11-03
2.4 Å9(1) 3K5Z|1|B
1272NR_3.0_27661.1
Exact match
3BX2|1|D (3BX2)
  • HO endonuclease 3' UTR binding sequence
  • X-ray diffraction
  • Release Date: 2008-03-11
2.8 Å9(2) 3BX2|1|D, 3BX2|1|C
1273NR_3.0_29245.1
Exact match
3AVU|1|T+3AVU|1|G (3AVU)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-ray diffraction
  • Release Date: 2012-01-18
2.9 Å9(1) 3AVU|1|T+3AVU|1|G
1274NR_3.0_30489.1
Exact match
Homo sapiens
5LQO|1|A+5LQO|1|B (5LQO)
  • RNA (5'-R(*GP*(CBV)P*CP*GP*GP*AP*CP*GP*G[...]
  • X-ray diffraction
  • Release Date: 2017-06-21
1.9 Å9(1) 5LQO|1|A+5LQO|1|B
1275NR_3.0_33912.2
Exact match
synthetic construct
7RIQ|1|R (7RIQ)
  • RNA
  • X-ray diffraction
  • Release Date: 2022-01-12
3.0 Å9(2) 7RIQ|1|R, 7RIM|1|R
1276NR_3.0_35047.1
Exact match
Mycoplasma genitalium G37
7DIC|1|C (7DIC)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2021-03-17
2.2 Å9(1) 7DIC|1|C
1277NR_3.0_36481.1
Exact match
synthetic construct
4CSF|1|u (4CSF)
  • RNA (5'-R(*UP*GP*UP*GP*UP*UP*UP*CP*UP)-3[...]
  • X-ray diffraction
  • Release Date: 2014-04-09
2.6 Å9(12) 4CSF|1|u, 4CSF|1|q, 4CSF|1|g, 4CSF|1|m, 4CSF|1|k, 4CSF|1|a, 4CSF|1|i, 4CSF|1|s, 4CSF|1|c, 4CSF|1|w, 4CSF|1|o, 4CSF|1|e
1278NR_3.0_41539.1
Exact match
synthetic construct
2XZL|1|B (2XZL)
  • 5- R(*UP*UP*UP*UP*UP*UP*UP*UP*U) -3
  • X-ray diffraction
  • Release Date: 2011-03-30
2.4 Å9(1) 2XZL|1|B
1279NR_3.0_49071.1
Exact match
synthetic construct
5YKI|1|C (5YKI)
  • RNA (5'-R(*UP*GP*UP*UP*GP*UP*AP*UP*A)-3'[...]
  • X-ray diffraction
  • Release Date: 2018-03-14
2.3 Å9(1) 5YKI|1|C
1280NR_3.0_50004.1
Exact match
1FXL|1|B (1FXL)
  • 5'-R(P*UP*UP*UP*UP*AP*UP*UP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2001-02-05
1.8 Å9(1) 1FXL|1|B
1281NR_3.0_50007.1
Exact match
Satellite tobacco mosaic virus
5BKL|1|m+5BKL|1|X (5BKL)
  • RNA (5'-R(UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å9(1) 5BKL|1|m+5BKL|1|X
1282NR_3.0_52626.1
Exact match
3K64|1|B (3K64)
  • 5'-R(*UP*GP*UP*GP*UP*CP*AP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2009-11-03
2.0 Å9(1) 3K64|1|B
1283NR_3.0_53890.1
Exact match
2AO5|1|C+2AO5|1|D (2AO5)
  • 5'-R(*GP*GP*CP*GP*(5BU)P*GP*CP*GP*CP*U)-[...]
  • X-ray diffraction
  • Release Date: 2006-03-28
2.1 Å9(2) 2AO5|1|C+2AO5|1|D, 2AO5|1|A+2AO5|1|B
1284NR_3.0_53989.1
Exact match
Satellite tobacco mosaic virus
5BKN|1|Y+5BKN|1|n (5BKN)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
3.0 Å9(1) 5BKN|1|Y+5BKN|1|n
1285NR_3.0_56046.1
Exact match
1SI3|1|B (1SI3)
  • 5'-R(*CP*GP*UP*GP*AP*CP*UP*CP*U)-3'
  • X-ray diffraction
  • Release Date: 2004-05-25
2.6 Å9(1) 1SI3|1|B
1286NR_3.0_56860.1
Exact match
Arabidopsis thaliana
5Z9X|1|R (5Z9X)
  • RNA (5'-R(P*GP*CP*CP*CP*AP*UP*UP*AP*G)-3[...]
  • X-ray diffraction
  • Release Date: 2018-06-27
2.8 Å9(1) 5Z9X|1|R
1287NR_3.0_57097.1
Exact match
Satellite tobacco mosaic virus
5BKN|1|TT+5BKN|1|kk (5BKN)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
3.0 Å9(1) 5BKN|1|TT+5BKN|1|kk
1288NR_3.0_62003.1
Exact match
2E9Z|1|B+2E9Z|1|C (2E9Z)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*CP*C)-3', 5'-[...]
  • X-ray diffraction
  • Release Date: 2007-06-26
3.0 Å9(1) 2E9Z|1|B+2E9Z|1|C
1289NR_3.0_65678.1
Exact match
1YVP|1|C+1YVP|1|D (1YVP)
  • Y RNA sequence, first strand, Y RNA sequ[...]
  • X-ray diffraction
  • Release Date: 2005-06-07
2.2 Å9(2) 1YVP|1|C+1YVP|1|D, 1YVP|1|E+1YVP|1|F
1290NR_3.0_68289.1
Exact match
4F02|1|B (4F02)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2012-08-08
2.0 Å9(2) 4F02|1|B, 4F02|1|E
1291NR_3.0_68446.1
Exact match
4U6K|1|A (4U6K)
  • RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*G)-3'[...]
  • X-ray diffraction
  • Release Date: 2015-08-19
1.5 Å9(8) 4U6K|1|A, 4U6K|1|C, 4U6M|1|A, 4U6L|1|A, 479D|1|B, 2DQP|1|B, 2DQO|1|B, 2DQQ|1|B
1292NR_3.0_69465.1
Exact match
synthetic construct
7KUN|1|A+7KUN|1|B (7KUN)
  • RNA (5'-R(*(LKC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-ray diffraction
  • Release Date: 2021-09-08
1.6 Å9(1) 7KUN|1|A+7KUN|1|B
1293NR_3.0_70012.1
Exact match
Homo sapiens
8D71|1|B (8D71)
  • miR-122, RNA (5'-R(P*UP*GP*GP*AP*GP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2023-05-03
2.5 Å9(3) 8D71|1|B, 8D6J|1|B, 5KI6|1|B
1294NR_3.0_70244.1
Exact match
Vaccinia virus
6RID|1|P (6RID)
  • RNA
  • Electron microscopy
  • Release Date: 2019-12-18
2.9 Å9(1) 6RID|1|P
1295NR_3.0_70596.1
Exact match
Satellite tobacco mosaic virus
5BKN|1|UU+5BKN|1|ll (5BKN)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
3.0 Å9(1) 5BKN|1|UU+5BKN|1|ll
1296NR_3.0_70938.1
Exact match
Homo sapiens
4XW0|1|A+4XW0|1|B (4XW0)
  • RNA (5'-R(*GP*CP*CP*UP*(LCG)P*CP*CP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2016-01-13
1.8 Å9(1) 4XW0|1|A+4XW0|1|B
1297NR_3.0_71760.1
Exact match
Homo sapiens
6RA4|1|L+6RA4|1|M (6RA4)
  • RNA (5'-R(*CP*GP*UP*GP*AP*CP*UP*CP*U)-3'[...]
  • X-ray diffraction
  • Release Date: 2019-05-08
1.9 Å9(1) 6RA4|1|L+6RA4|1|M
1298NR_3.0_72030.1
Exact match
1ZH5|1|C+1ZH5|1|D (1ZH5)
  • 5'-R(*UP*GP*CP*UP*GP*UP*UP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2006-01-17
1.9 Å9(2) 1ZH5|1|C+1ZH5|1|D, 1YTY|1|C+1YTY|1|D
1299NR_3.0_72319.1
Exact match
Homo sapiens
5LR3|1|A+5LR3|1|B (5LR3)
  • RNA (5'-R(*GP*(CBV)P*CP*GP*GP*AP*UP*GP*G[...]
  • X-ray diffraction
  • Release Date: 2017-06-21
1.7 Å9(1) 5LR3|1|A+5LR3|1|B
1300NR_3.0_74556.1
Exact match
synthetic construct
5BZV|1|B (5BZV)
  • RNA (5'-R(*UP*GP*UP*AP*CP*UP*AP*UP*A)-3'[...]
  • X-ray diffraction
  • Release Date: 2015-09-23
2.4 Å9(2) 5BZV|1|B, 5BYM|1|C
1301NR_3.0_76670.1
Exact match
3BSB|1|C (3BSB)
  • 5'-R(*UP*UP*UP*AP*AP*UP*GP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2008-04-08
2.8 Å9(1) 3BSB|1|C
1302NR_3.0_82961.1
Exact match
3GIB|1|H (3GIB)
  • 5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3'
  • X-ray diffraction
  • Release Date: 2009-11-17
2.4 Å9(1) 3GIB|1|H
1303NR_3.0_84036.1
Exact match
3QGB|1|B (3QGB)
  • 5'-R(*UP*GP*UP*GP*CP*CP*AP*UP*A)-3'
  • X-ray diffraction
  • Release Date: 2011-03-23
2.4 Å9(2) 3QGB|1|B, 3K5Y|1|B
1304NR_3.0_84294.1
Exact match
synthetic construct
6BM4|1|R (6BM4)
  • RNA (5'-R(*AP*UP*CP*AP*AP*GP*AP*GP*A)-3'[...]
  • X-ray diffraction
  • Release Date: 2018-02-28
3.0 Å9(1) 6BM4|1|R
1305NR_3.0_85397.1
Exact match
Zea mays
6EEN|1|G (6EEN)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*U)-3[...]
  • X-ray diffraction
  • Release Date: 2019-08-21
2.0 Å9(1) 6EEN|1|G
1306NR_3.0_85719.1
Exact match
1S76|1|R (1S76)
  • RNA (5'-R(P*AP*CP*AP*CP*GP*GP*CP*GP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2004-03-23
2.9 Å9(1) 1S76|1|R
1307NR_3.0_85762.1
Exact match
3K62|1|B (3K62)
  • 5'-R(*UP*GP*UP*GP*UP*UP*AP*UP*C)-3'
  • X-ray diffraction
  • Release Date: 2009-11-03
1.9 Å9(1) 3K62|1|B
1308NR_3.0_85902.1
Exact match
1CVJ|1|M (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-ray diffraction
  • Release Date: 1999-10-04
2.6 Å9(1) 1CVJ|1|M
1309NR_3.0_86424.1
Exact match
Aquifex aeolicus
3R2C|1|R (3R2C)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-ray diffraction
  • Release Date: 2011-06-22
1.9 Å9(2) 3R2C|1|R, 3R2C|1|S
1310NR_3.0_86840.1
Exact match
Escherichia coli O157:H7
6XLN|1|R (6XLN)
  • 9-nt RNA transcript
  • Electron microscopy
  • Release Date: 2021-04-07
2.8 Å9(1) 6XLN|1|R
1311NR_3.0_87059.1
Exact match
1CVJ|1|Q (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-ray diffraction
  • Release Date: 1999-10-04
2.6 Å9(1) 1CVJ|1|Q
1312NR_3.0_93862.1
Exact match
Saccharomyces cerevisiae
7C7A|1|R (7C7A)
  • Internal Transcribed Spacer 1
  • Electron microscopy
  • Release Date: 2020-07-08
2.8 Å9(1) 7C7A|1|R
1313NR_3.0_94396.3
Exact match
synthetic construct
4WAN|1|B (4WAN)
  • RNA (5'-R(P*UP*AP*CP*UP*AP*AP*CP*A)-3')
  • X-ray diffraction
  • Release Date: 2014-12-17
1.8 Å9(5) 4WAN|1|B, 4WAN|1|F, 4WAN|1|H, 4WAN|1|D, 4WAL|1|B
1314NR_3.0_96836.1
Exact match
synthetic construct
7Y8P|1|A+7Y8P|1|B (7Y8P)
  • RNA (5'-R(*GP*GP*AP*(IKS)P*(ILK)P*(IKS)P[...]
  • X-ray diffraction
  • Release Date: 2023-05-03
1.5 Å9(1) 7Y8P|1|A+7Y8P|1|B
1315NR_3.0_96884.1
Exact match
Satellite tobacco mosaic virus
7M50|1|bb+7M50|1|qq (7M50)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.3 Å9(1) 7M50|1|bb+7M50|1|qq
1316NR_3.0_98913.1
Exact match
1S77|1|R (1S77)
  • RNA (5'-R(*AP*CP*AP*CP*GP*GP*CP*GP*AP*(3[...]
  • X-ray diffraction
  • Release Date: 2004-03-23
2.7 Å9(1) 1S77|1|R
1317NR_3.0_00179.1
Exact match
synthetic construct
5EIM|1|C (5EIM)
  • RNA (5'-R(*AP*UP*UP*AP*AP*AP*CP*A)-3')
  • X-ray diffraction
  • Release Date: 2016-01-27
1.5 Å8(2) 5EIM|1|C, 5EIM|1|D
1318NR_3.0_02127.1
Exact match
synthetic construct
7OM7|1|H+7OM7|1|G (7OM7)
  • RNA PRIMER TEMPLATE CAAAAUUU, RNA (5'-R([...]
  • X-ray diffraction
  • Release Date: 2021-07-28
2.4 Å8(9) 7OM7|1|H+7OM7|1|G, 7OM6|1|E+7OM6|1|C, 7OM7|1|F+7OM7|1|E, 7OM7|1|I+7OM7|1|J, 7OM6|1|F+7OM6|1|D, 4WTA|1|T+4WTA|1|P, 7OM7|1|K+7OM7|1|L, 4WTF|1|T+4WTF|1|P, 4WTG|1|T+4WTG|1|P
1319NR_3.0_02402.1
Exact match
synthetic construct
4WTE|1|T+4WTE|1|P (4WTE)
  • RNA PRIMER TEMPLATE ACAAAUUU
  • X-ray diffraction
  • Release Date: 2015-02-11
2.9 Å8(1) 4WTE|1|T+4WTE|1|P
1320NR_3.0_02834.1
Exact match
472D|1|A+472D|1|B (472D)
  • RNA (5'-R(*GP*UP*GP*UP*UP*UP*AP*C)-3'), [...]
  • X-ray diffraction
  • Release Date: 2000-11-27
1.9 Å8(1) 472D|1|A+472D|1|B
1321NR_3.0_03183.1
Exact match
Homo sapiens
4XW1|1|C (4XW1)
  • RNA (5'-R(*GP*CP*CP*UP*(LCG)P*CP*CP*UP*G[...]
  • X-ray diffraction
  • Release Date: 2016-01-13
2.3 Å8(1) 4XW1|1|C
1322NR_3.0_04094.1
Exact match
Satellite tobacco mosaic virus
7M50|1|UU (7M50)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.3 Å8(1) 7M50|1|UU
1323NR_3.0_04974.3
Exact match
synthetic construct
4U3L|1|A+4U3L|1|B (4U3L)
  • RNA (5'-R(*UP*CP*GP*UP*AP*CP*GP*A)-3')
  • X-ray diffraction
  • Release Date: 2015-07-29
1.5 Å8(6) 4U3L|1|A+4U3L|1|B, 4U3O|1|A+4U3O|1|B, 4U3R|1|A+4U3R|1|B, 4U78|1|A+4U78|1|B, 4U47|1|A+4U47|1|B, 4U3P|1|A+4U3P|1|B
1324NR_3.0_05128.1
Exact match
synthetic construct
4FVU|1|B+4FVU|1|C (4FVU)
  • RNA (5'-R(*GP*GP*AP*GP*GP*GP*AP*G)-3'), [...]
  • X-ray diffraction
  • Release Date: 2012-09-19
2.9 Å8(1) 4FVU|1|B+4FVU|1|C
1325NR_3.0_07663.1
Exact match
3RER|1|K (3RER)
  • 5'-R(*AP*UP*UP*UP*UP*UP*UP*A)-3', RNA (5[...]
  • X-ray diffraction
  • Release Date: 2011-10-19
1.7 Å8(2) 3RER|1|K, 4HT9|1|E
1326NR_3.0_08738.1
Exact match
3Q0P|1|D (3Q0P)
  • 5'-R(UP*GP*UP*AP*UP*AP*UP*A)-3'
  • X-ray diffraction
  • Release Date: 2011-03-16
2.6 Å8(2) 3Q0P|1|D, 3Q0P|1|C
1327NR_3.0_10146.1
Exact match
Satellite tobacco mosaic virus
7M50|1|X+7M50|1|m (7M50)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.3 Å8(1) 7M50|1|X+7M50|1|m
1328NR_3.0_10913.1
Exact match
3Q0L|1|C (3Q0L)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-ray diffraction
  • Release Date: 2011-03-16
2.5 Å8(1) 3Q0L|1|C
1329NR_3.0_11837.1
Exact match
Drosophila melanogaster
5KLA|1|B (5KLA)
  • RNA (5'-R(*UP*GP*UP*AP*CP*AP*UP*A)-3')
  • X-ray diffraction
  • Release Date: 2016-08-17
1.1 Å8(1) 5KLA|1|B
1330NR_3.0_12466.1
Exact match
synthetic construct
7YEY|1|B (7YEY)
  • RNA (5'-R(*CP*AP*CP*GP*GP*CP*AP*C)-3')
  • X-ray diffraction
  • Release Date: 2023-07-12
1.9 Å8(1) 7YEY|1|B
1331NR_3.0_12677.1
Exact match
402D|1|A+402D|1|B (402D)
  • RNA(5'-R(*CP*GP*CP*CP*AP*GP*CP*G)-3')
  • X-ray diffraction
  • Release Date: 1998-06-16
2.3 Å8(1) 402D|1|A+402D|1|B
1332NR_3.0_14977.1
Exact match
4B3G|1|H (4B3G)
  • RNA (5'-(AP*AP*AP*AP*AP*AP*AP*AP*AP)-3')
  • X-ray diffraction
  • Release Date: 2012-09-26
2.9 Å8(1) 4B3G|1|H
1333NR_3.0_15037.1
Exact match
3PF4|1|R (3PF4)
  • hexaribonucleotide (rGUCUUUA)
  • X-ray diffraction
  • Release Date: 2011-09-21
1.4 Å8(1) 3PF4|1|R
1334NR_3.0_15174.1
Exact match
Homo sapiens
7VBB|1|R (7VBB)
  • RNA (5'-R(P*UP*GP*CP*UP*GP*AP*CP*U)-3')
  • Electron microscopy
  • Release Date: 2022-03-02
2.8 Å8(2) 7VBB|1|R, 7VBA|1|R
1335NR_3.0_16093.1
Exact match
Homo sapiens
6UV2|1|C (6UV2)
  • RNA 125a_oligo1
  • X-ray diffraction
  • Release Date: 2020-01-01
1.9 Å8(1) 6UV2|1|C
1336NR_3.0_16755.1
Exact match
2EC0|1|B+2EC0|1|C (2EC0)
  • 5'-R(P*AP*UP*GP*GP*GP*CP*CP*C)-3', 5'-R([...]
  • X-ray diffraction
  • Release Date: 2007-06-26
2.8 Å8(2) 2EC0|1|B+2EC0|1|C, 2EC0|1|E+2EC0|1|F
1337NR_3.0_16983.1
Exact match
1J9H|1|A+1J9H|1|B (1J9H)
  • 5'-R(*GP*UP*GP*UP*CP*GP*(CBR)P*AP*C)-3'
  • X-ray diffraction
  • Release Date: 2001-10-26
1.4 Å8(2) 1J9H|1|A+1J9H|1|B, 1J9H|1|C+1J9H|1|D
1338NR_3.0_17782.1
Exact match
3R1C|1|Q+3R1C|1|R (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-ray diffraction
  • Release Date: 2011-06-01
2.1 Å8(9) 3R1C|1|Q+3R1C|1|R, 3R1C|1|T+3R1C|1|U, 3R1C|1|M+3R1C|1|N, 3R1C|1|A+3R1C|1|B, 3R1C|1|O+3R1C|1|P, 3R1C|1|V+3R1C|1|Z, 3R1C|1|a+3R1C|1|b, 3R1C|1|G+3R1C|1|H, 3R1C|1|S+3R1C|1|Y
1339NR_3.0_18395.1
Exact match
synthetic construct
7VKL|1|B (7VKL)
  • RNA (8-mer)
  • X-ray diffraction
  • Release Date: 2022-10-05
2.0 Å8(1) 7VKL|1|B
1340NR_3.0_18913.1
Exact match
4QPX|1|P+4QPX|1|T (4QPX)
  • RNA (5'-R(*UP*GP*CP*CP*CP*GP*GP*G)-3'), [...]
  • X-ray diffraction
  • Release Date: 2015-04-22
1.9 Å8(1) 4QPX|1|P+4QPX|1|T
1341NR_3.0_19056.1
Exact match
synthetic construct
5WWG|1|B (5WWG)
  • RNA (5'-R(*AP*AP*GP*GP*AP*CP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2018-01-17
2.0 Å8(1) 5WWG|1|B
1342NR_3.0_19241.1
Exact match
1JZV|1|B+1JZV|1|A (1JZV)
  • 5'-R(*CP*AP*GP*UP*AP*CP*GP*(5IC)P*C)-3',[...]
  • X-ray diffraction
  • Release Date: 2003-11-11
1.7 Å8(2) 1JZV|1|B+1JZV|1|A, 1JZV|1|D+1JZV|1|C
1343NR_3.0_22904.1
Exact match
3R1C|1|K+3R1C|1|L (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-ray diffraction
  • Release Date: 2011-06-01
2.1 Å8(6) 3R1C|1|K+3R1C|1|L, 3R1C|1|I+3R1C|1|J, 3R1C|1|W+3R1C|1|X, 3R1C|1|c+3R1C|1|d, 3R1C|1|e+3R1C|1|f, 3R1C|1|C+3R1C|1|D
1344NR_3.0_23650.1
Exact match
2A0P|1|A+2A0P|1|B (2A0P)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*GP*G)-3'), [...]
  • X-ray diffraction
  • Release Date: 2005-08-16
2.0 Å8(4) 2A0P|1|A+2A0P|1|B, 259D|1|A+259D|1|B, 1RXB|1|A+1RXB|1|B, 1RXA|1|A
1345NR_3.0_24114.1
Exact match
Caenorhabditis elegans
6NOH|1|B (6NOH)
  • RNA (5'-R(*UP*GP*UP*AP*AP*AP*UP*A)-3')
  • X-ray diffraction
  • Release Date: 2019-01-30
2.3 Å8(3) 6NOH|1|B, 6NOF|1|B, 6NOC|1|B
1346NR_3.0_24803.1
Exact match
Caenorhabditis elegans
7CGM|1|B (7CGM)
  • PBE-5U (5'-R(P*UP*GP*UP*AP*UP*AP*UP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2021-07-07
2.6 Å8(1) 7CGM|1|B
1347NR_3.0_25020.1
Exact match
synthetic construct
7OUO|1|AAA+7OUO|1|BBB (7OUO)
  • RNA (5'-R(*UP*CP*GP*UP*GP*CP*GP*A)-3')
  • X-ray diffraction
  • Release Date: 2022-03-30
2.2 Å8(1) 7OUO|1|AAA+7OUO|1|BBB
1348NR_3.0_25251.1
Exact match
Caenorhabditis elegans
7CGL|1|B (7CGL)
  • PBE-5C (5'-R(P*UP*GP*UP*AP*CP*AP*UP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2021-07-07
2.5 Å8(1) 7CGL|1|B
1349NR_3.0_31724.1
Exact match
Caenorhabditis elegans
7CGJ|1|B (7CGJ)
  • PBE-5G (5'-R(P*UP*GP*UP*AP*GP*AP*UP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2021-07-07
2.5 Å8(1) 7CGJ|1|B
1350NR_3.0_34246.1
Exact match
Norwalk virus
5TSN|1|P+5TSN|1|T (5TSN)
  • RNA (5'-R(*UP*GP*CP*CP*CP*GP*GP*G)-3')
  • X-ray diffraction
  • Release Date: 2017-04-12
2.1 Å8(1) 5TSN|1|P+5TSN|1|T
1351NR_3.0_34318.1
Exact match
synthetic construct
6ZM2|1|B (6ZM2)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2021-04-21
2.1 Å8(1) 6ZM2|1|B
1352NR_3.0_34492.3
Exact match
398D|1|C (398D)
  • RNA (5'-R(*GP*CP*AP*GP*UP*GP*GP*C)-3')
  • X-ray diffraction
  • Release Date: 1998-10-06
1.9 Å8(2) 398D|1|C, 398D|1|A
1353NR_3.0_34681.1
Exact match
Escherichia coli
5THE|1|H (5THE)
  • RNA (5'-R(P*UP*AP*AP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2018-03-14
2.1 Å8(4) 5THE|1|H, 5THE|1|F, 5THE|1|B, 5THE|1|D
1354NR_3.0_34992.1
Exact match
3L25|1|C+3L25|1|F (3L25)
  • RNA (5'-R(*CP*GP*CP*AP*UP*GP*CP*G)-3')
  • X-ray diffraction
  • Release Date: 2010-01-26
2.0 Å8(2) 3L25|1|C+3L25|1|F, 3L26|1|C
1355NR_3.0_36895.1
Exact match
Caenorhabditis elegans
7CGH|1|B (7CGH)
  • PBE-5C (5'-R(P*UP*GP*UP*AP*CP*AP*UP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2021-07-07
2.4 Å8(1) 7CGH|1|B
1356NR_3.0_38078.1
Exact match
3MJ0|1|B (3MJ0)
  • RNA (5'-R(*CP*GP*UP*UP*AP*CP*GP*CP*(OMU)[...]
  • X-ray diffraction
  • Release Date: 2011-05-25
2.3 Å8(1) 3MJ0|1|B
1357NR_3.0_39179.1
Exact match
synthetic construct
4WZM|1|B+4WZM|1|C (4WZM)
  • RNA template, RNA primer
  • X-ray diffraction
  • Release Date: 2015-05-06
2.5 Å8(1) 4WZM|1|B+4WZM|1|C
1358NR_3.0_40126.1
Exact match
1M8W|1|E (1M8W)
  • 5'-R(P*UP*UP*GP*UP*CP*CP*AP*G)-3'
  • X-ray diffraction
  • Release Date: 2002-09-25
2.2 Å8(1) 1M8W|1|E
1359NR_3.0_40545.1
Exact match
3KNC|1|B (3KNC)
  • 5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3'
  • X-ray diffraction
  • Release Date: 2010-12-08
2.5 Å8(1) 3KNC|1|B
1360NR_3.0_40895.1
Exact match
4JVY|1|D (4JVY)
  • RNA (5'-R(P*CP*UP*AP*AP*CP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2013-05-08
2.9 Å8(2) 4JVY|1|D, 4JVY|1|F
1361NR_3.0_41538.1
Exact match
1WNE|1|B+1WNE|1|C (1WNE)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*C)-3', 5'-R(*[...]
  • X-ray diffraction
  • Release Date: 2004-08-31
3.0 Å8(1) 1WNE|1|B+1WNE|1|C
1362NR_3.0_43560.1
Exact match
3Q0L|1|D (3Q0L)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-ray diffraction
  • Release Date: 2011-03-16
2.5 Å8(1) 3Q0L|1|D
1363NR_3.0_43688.1
Exact match
Caenorhabditis elegans
7CGF|1|B (7CGF)
  • PBE-5G (5'-R(P*UP*GP*UP*AP*GP*AP*UP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2021-07-07
1.7 Å8(1) 7CGF|1|B
1364NR_3.0_45692.1
Exact match
2XBM|1|E+2XBM|1|F (2XBM)
  • 5'-(*G3AP*GP*AP*AP*CP*CP*UP*GP*A)-3'
  • X-ray diffraction
  • Release Date: 2010-09-29
2.9 Å8(1) 2XBM|1|E+2XBM|1|F
1365NR_3.0_49451.1
Exact match
3G9Y|1|C (3G9Y)
  • RNA (5'-R(*AP*GP*GP*UP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2009-03-03
1.4 Å8(1) 3G9Y|1|C
1366NR_3.0_49582.1
Exact match
4FXD|1|E (4FXD)
  • RNA (5'-R(*AP*GP*GP*CP*GP*GP*GP*CP*AP*G)[...]
  • X-ray diffraction
  • Release Date: 2013-02-27
3.0 Å8(2) 4FXD|1|E, 4FXD|1|F
1367NR_3.0_49696.1
Exact match
Homo sapiens
5LQT|1|A+5LQT|1|B (5LQT)
  • RNA (5'-R(*GP*(CBV)P*CP*GP*GP*(6MZ)P*CP*[...]
  • X-ray diffraction
  • Release Date: 2017-06-21
1.5 Å8(1) 5LQT|1|A+5LQT|1|B
1368NR_3.0_51156.1
Exact match
3SQX|1|B (3SQX)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2011-10-12
2.1 Å8(2) 3SQX|1|B, 3SQW|1|B
1369NR_3.0_51454.1
Exact match
Caenorhabditis elegans
6NOD|1|E (6NOD)
  • RNA (5'-R(P*UP*GP*UP*AP*UP*AP*UP*A)-3')
  • X-ray diffraction
  • Release Date: 2019-01-30
2.6 Å8(3) 6NOD|1|E, 6NOD|1|F, 6NOD|1|D
1370NR_3.0_53827.1
Exact match
1ZDJ|1|R (1ZDJ)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*C)-3')
  • X-ray diffraction
  • Release Date: 1998-07-08
2.9 Å8(2) 1ZDJ|1|R, 1ZDJ|1|S
1371NR_3.0_53841.1
Exact match
2E9T|1|B+2E9T|1|C (2E9T)
  • 5'-R(P*UP*AP*GP*GP*GP*CP*CP*C)-3', 5'-R([...]
  • X-ray diffraction
  • Release Date: 2007-06-26
2.6 Å8(2) 2E9T|1|B+2E9T|1|C, 2E9T|1|E+2E9T|1|F
1372NR_3.0_54128.1
Exact match
3Q0R|1|B (3Q0R)
  • 5'-R(UP*GP*UP*AP*GP*AP*UP*A)-3'
  • X-ray diffraction
  • Release Date: 2011-03-16
2.0 Å8(3) 3Q0R|1|B, 3Q0M|1|C, 3Q0M|1|D
1373NR_3.0_55504.1
Exact match
Foot-and-mouth disease virus
5JXS|1|B+5JXS|1|C (5JXS)
  • RNA Template, RNA Primer
  • X-ray diffraction
  • Release Date: 2016-06-01
2.8 Å8(1) 5JXS|1|B+5JXS|1|C
1374NR_3.0_55926.1
Exact match
Homo sapiens
4E59|1|A+4E59|1|B (4E59)
  • RNA duplex containing CCG repeats
  • X-ray diffraction
  • Release Date: 2012-12-12
1.5 Å8(1) 4E59|1|A+4E59|1|B
1375NR_3.0_57114.1
Exact match
Homo sapiens
5N94|1|D (5N94)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2018-03-14
2.4 Å8(2) 5N94|1|D, 5N94|1|C
1376NR_3.0_57734.1
Exact match
2BGG|1|P+2BGG|1|Q (2BGG)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP)-3', 5'-R([...]
  • X-ray diffraction
  • Release Date: 2005-03-31
2.2 Å8(2) 2BGG|1|P+2BGG|1|Q, 2BGG|1|R+2BGG|1|S
1377NR_3.0_57770.1
Exact match
1N35|1|C+1N35|1|B (1N35)
  • 5'-R(*AP*UP*UP*AP*GP*CP*CP*CP*CP*C)-3', [...]
  • X-ray diffraction
  • Release Date: 2002-12-25
2.5 Å8(1) 1N35|1|C+1N35|1|B
1378NR_3.0_60906.1
Exact match
synthetic construct
4JAB|1|A+4JAB|1|B (4JAB)
  • RNA (5'-R(*GP*UP*GP*UP*AP*UP*AP*C)-3')
  • X-ray diffraction
  • Release Date: 2014-01-29
2.2 Å8(1) 4JAB|1|A+4JAB|1|B
1379NR_3.0_60938.1
Exact match
Satellite tobacco mosaic virus
5BKN|1|V+5BKN|1|WW (5BKN)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
3.0 Å8(1) 5BKN|1|V+5BKN|1|WW
1380NR_3.0_60948.1
Exact match
Chikungunya virus
6JIM|1|C (6JIM)
  • RNA (5'-R(P*UP*UP*UP*UP*UP)-3')
  • X-ray diffraction
  • Release Date: 2019-04-10
2.0 Å8(2) 6JIM|1|C, 6JIM|1|D
1381NR_3.0_62752.1
Exact match
3EQT|1|C+3EQT|1|D (3EQT)
  • 5'-R(*GP*CP*GP*CP*GP*CP*GP*C)-3'
  • X-ray diffraction
  • Release Date: 2009-03-10
2.0 Å8(1) 3EQT|1|C+3EQT|1|D
1382NR_3.0_64844.1
Exact match
3H5X|1|T+3H5X|1|P (3H5X)
  • RNA (5'-R(*UP*GP*CP*CP*CP*GP*GP*GP*(N5M)[...]
  • X-ray diffraction
  • Release Date: 2009-05-19
1.8 Å8(4) 3H5X|1|T+3H5X|1|P, 3BSO|1|T+3BSO|1|P, 3H5Y|1|T+3H5Y|1|P, 3BSN|1|T+3BSN|1|P
1383NR_3.0_65712.1
Exact match
3VNV|1|T+3VNV|1|G (3VNV)
  • RNA (5'-R(*GP*GP*GP*UP*AP*GP*GP*G)-3'), [...]
  • X-ray diffraction
  • Release Date: 2012-08-08
2.6 Å8(1) 3VNV|1|T+3VNV|1|G
1384NR_3.0_68171.1
Exact match
3R1C|1|E+3R1C|1|F (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-ray diffraction
  • Release Date: 2011-06-01
2.1 Å8(3) 3R1C|1|E+3R1C|1|F, 3R1C|1|i+3R1C|1|j, 3R1C|1|g+3R1C|1|h
1385NR_3.0_68652.1
Exact match
3QRP|1|B+3QRP|1|C (3QRP)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*(PGP)[...]
  • X-ray diffraction
  • Release Date: 2011-05-25
2.4 Å8(1) 3QRP|1|B+3QRP|1|C
1386NR_3.0_74766.1
Exact match
Acinetobacter baumannii
6YHS|1|8+6YHS|1|6 (6YHS)
  • E-site tRNA
  • Electron microscopy
  • Release Date: 2020-09-16
  • Standardized name: tRNA + tRNA
  • Source: Bacteria
  • Rfam: RF00005 + RF00005
2.7 Å8(1) 6YHS|1|8+6YHS|1|6
1387NR_3.0_74928.1
Exact match
Homo sapiens
5V7C|1|C (5V7C)
  • RNA (5'-R(*CP*UP*UP*UP*UP*CP*CP*G)-3')
  • X-ray diffraction
  • Release Date: 2017-04-19
2.6 Å8(1) 5V7C|1|C
1388NR_3.0_77778.1
Exact match
synthetic construct
4WZQ|1|B+4WZQ|1|C (4WZQ)
  • RNA template, RNAprimer
  • X-ray diffraction
  • Release Date: 2015-05-06
2.8 Å8(1) 4WZQ|1|B+4WZQ|1|C
1389NR_3.0_77859.1
Exact match
Caenorhabditis elegans
7CGK|1|B (7CGK)
  • PBE-5A (5'-R(P*UP*GP*UP*AP*AP*AP*UP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2021-07-07
2.4 Å8(2) 7CGK|1|B, 7CGG|1|B
1390NR_3.0_78670.1
Exact match
1CVJ|1|N (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-ray diffraction
  • Release Date: 1999-10-04
2.6 Å8(6) 1CVJ|1|N, 1CVJ|1|O, 1CVJ|1|S, 1CVJ|1|P, 1CVJ|1|T, 1CVJ|1|R
1391NR_3.0_78848.1
Exact match
Escherichia coli
3T5Q|1|F (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*A)-3')
  • X-ray diffraction
  • Release Date: 2012-01-11
3.0 Å8(1) 3T5Q|1|F
1392NR_3.0_79446.1
Exact match
2G91|1|A+2G91|1|B (2G91)
  • 5'-R(*GP*GP*UP*GP*CP*GP*CP*(CBR)P*C-3'
  • X-ray diffraction
  • Release Date: 2007-04-03
1.5 Å8(1) 2G91|1|A+2G91|1|B
1393NR_3.0_79660.1
Exact match
Escherichia coli
3T5Q|1|J (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*C)-3')
  • X-ray diffraction
  • Release Date: 2012-01-11
3.0 Å8(1) 3T5Q|1|J
1394NR_3.0_80423.1
Exact match
4MDX|1|C (4MDX)
  • RNA, mRNA
  • X-ray diffraction
  • Release Date: 2013-10-23
1.5 Å8(1) 4MDX|1|C
1395NR_3.0_81068.1
Exact match
1M8W|1|C (1M8W)
  • 5'-R(P*UP*UP*GP*UP*AP*UP*AP*U)-3'
  • X-ray diffraction
  • Release Date: 2002-09-25
2.2 Å8(2) 1M8W|1|C, 1M8X|1|C
1396NR_3.0_83172.1
Exact match
Homo sapiens
8B6Z|1|B (8B6Z)
  • 28S ribosomal RNA
  • Electron microscopy
  • Release Date: 2022-12-07
  • Standardized name: LSU rRNA
  • Source: Eukarya
  • Rfam: RF02543
2.9 Å8(1) 8B6Z|1|B
1397NR_3.0_83415.1
Exact match
synthetic construct
4WTC|1|T+4WTC|1|P (4WTC)
  • RNA PRIMER TEMPLATE AGAAAUUU
  • X-ray diffraction
  • Release Date: 2015-02-11
2.8 Å8(1) 4WTC|1|T+4WTC|1|P
1398NR_3.0_85126.1
Exact match
synthetic construct
5BZU|1|B (5BZU)
  • UGUAAUA
  • X-ray diffraction
  • Release Date: 2015-09-23
2.5 Å8(1) 5BZU|1|B
1399NR_3.0_85964.1
Exact match
Rhinovirus B14
7BG6|1|C (7BG6)
  • RNA-octamer (5'-R(P*UP*GP*UP*UP*UP*UP*UP[...]
  • Electron microscopy
  • Release Date: 2021-05-19
2.6 Å8(1) 7BG6|1|C
1400NR_3.0_86088.1
Exact match
Homo sapiens
5LR4|1|A+5LR4|1|B (5LR4)
  • RNA (5'-R(*GP*(CBV)P*CP*GP*GP*(6MZ)P*UP*[...]
  • X-ray diffraction
  • Release Date: 2017-06-21
1.8 Å8(2) 5LR4|1|A+5LR4|1|B, 5LR4|1|C+5LR4|1|D
1401NR_3.0_86909.1
Exact match
7A9N|1|K+7A9N|1|L (7A9N)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*G)-3'), [...]
  • X-ray diffraction
  • Release Date: 2021-05-26
1.6 Å8(18) 7A9N|1|K+7A9N|1|L, 6ZRS|1|K+6ZRS|1|L, 7A9O|1|K+7A9O|1|L, 6ZR1|1|K+6ZR1|1|L, 6ZQ9|1|K+6ZQ9|1|L, 6ZPF|1|K+6ZPF|1|L, 6ZWU|1|M+6ZWU|1|N, 7A9T|1|K+7A9T|1|L, 6ZW3|1|M+6ZW3|1|N, 6ZX5|1|K+6ZX5|1|L, 7A9Q|1|K+7A9Q|1|L, 439D|1|A+439D|1|B, 7A9L|1|M+7A9L|1|N, 6ZRL|1|M+6ZRL|1|N, 6ZX8|1|K+6ZX8|1|L, 7A9S|1|K+7A9S|1|L, 7A9R|1|M+7A9R|1|N, 7A9P|1|M+7A9P|1|N
1402NR_3.0_87893.1
Exact match
1IHA|1|A+1IHA|1|B (1IHA)
  • DNA/RNA (5'-R(*GP*CP*UP*UP*CP*GP*GP*CP*)[...]
  • X-ray diffraction
  • Release Date: 2001-05-07
1.6 Å8(3) 1IHA|1|A+1IHA|1|B, 165D|1|A+165D|1|B, 1IDW|1|A+1IDW|1|B
1403NR_3.0_88361.1
Exact match
Satellite tobacco mosaic virus
7M50|1|h+7M50|1|S (7M50)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.3 Å8(1) 7M50|1|h+7M50|1|S
1404NR_3.0_92104.1
Exact match
Escherichia coli
3T5Q|1|C (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*A)-3')
  • X-ray diffraction
  • Release Date: 2012-01-11
3.0 Å8(1) 3T5Q|1|C
1405NR_3.0_92683.1
Exact match
2G3S|1|I+2G3S|1|J (2G3S)
  • 5'-R(*GP*GP*CP*GP*UP*GP*CP*C)-3'
  • X-ray diffraction
  • Release Date: 2007-01-16
1.5 Å8(5) 2G3S|1|I+2G3S|1|J, 2G3S|1|G+2G3S|1|H, 2G3S|1|C+2G3S|1|D, 2G3S|1|A+2G3S|1|B, 2G3S|1|E+2G3S|1|F
1406NR_3.0_93661.1
Exact match
Rhinovirus B14
7NUQ|1|C (7NUQ)
  • Octanucleotide
  • Electron microscopy
  • Release Date: 2021-05-19
2.8 Å8(1) 7NUQ|1|C
1407NR_3.0_95803.1
Exact match
3BX3|1|C (3BX3)
  • COX17 RNA target sequence
  • X-ray diffraction
  • Release Date: 2008-03-11
3.0 Å8(2) 3BX3|1|C, 3BX3|1|D
1408NR_3.0_96413.1
Exact match
Homo sapiens
5LR5|1|C+5LR5|1|D (5LR5)
  • RNA (5'-R(*GP*GP*(6MZ)P*CP*UP*AP*GP*UP*([...]
  • X-ray diffraction
  • Release Date: 2017-06-21
2.4 Å8(2) 5LR5|1|C+5LR5|1|D, 5LR5|1|A+5LR5|1|B
1409NR_3.0_97043.1
Exact match
Homo sapiens
6JVX|1|B (6JVX)
  • RNA (5'-R(*UP*GP*UP*GP*UP*GP*UP*GP*UP*GP[...]
  • X-ray diffraction
  • Release Date: 2020-01-01
2.3 Å8(1) 6JVX|1|B
1410NR_3.0_97666.1
Exact match
3Q0Q|1|B (3Q0Q)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-ray diffraction
  • Release Date: 2011-03-16
2.0 Å8(1) 3Q0Q|1|B
1411NR_3.0_97847.1
Exact match
Caenorhabditis elegans
6PUN|1|B (6PUN)
  • RNA (5'-R(*CP*UP*GP*UP*GP*AP*AP*U)-3')
  • X-ray diffraction
  • Release Date: 2019-08-21
2.1 Å8(2) 6PUN|1|B, 6PUN|1|D
1412NR_3.0_97864.1
Exact match
synthetic construct
4WTD|1|T+4WTD|1|P (4WTD)
  • RNA PRIMER TEMPLATE AUAAAUUU, RNA (5'-R([...]
  • X-ray diffraction
  • Release Date: 2015-02-11
2.7 Å8(2) 4WTD|1|T+4WTD|1|P, 5UJ2|1|T+5UJ2|1|P
1413NR_3.0_98055.1
Exact match
3Q0S|1|B (3Q0S)
  • 5'-R(UP*GP*UP*AP*CP*AP*UP*C)-3'
  • X-ray diffraction
  • Release Date: 2011-03-16
2.0 Å8(2) 3Q0S|1|B, 3Q0N|1|C
1414NR_3.0_98171.1
Exact match
1ICG|1|A+1ICG|1|B (1ICG)
  • 5'-R(*GP*CP*UP*UP*CP*GP*GP*C)-D(P*(UFP))[...]
  • X-ray diffraction
  • Release Date: 2001-04-09
1.5 Å8(2) 1ICG|1|A+1ICG|1|B, 1ID9|1|A+1ID9|1|B
1415NR_3.0_98371.1
Exact match
Escherichia virus T7
8DH1|1|G (8DH1)
  • 5'-R(*AP*AP*CP*UP*GP*CP*GP*GP*CP*GP *AP*[...]
  • X-ray diffraction
  • Release Date: 2023-02-01
2.7 Å8(28) 8DH1|1|G, 8DH1|1|C, 8DH1|1|K, 8DH0|1|C, 8DH0|1|G, 8DH4|1|C, 8DH0|1|K, 8DH4|1|K, 8DH1|1|N, 8DH4|1|G, 8DH5|1|G, 8DH5|1|C, 8DH5|1|K, 8DH5|1|O, 8DH4|1|O, 8DH0|1|O, 8DH3|1|C, 8DH2|1|C, 8DH3|1|G, 8DH3|1|K, 8DH3|1|O, 8DH2|1|G, 8DH2|1|K, 8DH2|1|N, 1H38|1|F, 1H38|1|I, 1H38|1|L, 1H38|1|O
1416NR_3.0_98426.1
Exact match
Caenorhabditis elegans
7CGI|1|B (7CGI)
  • PBE-5U (5'-R(P*UP*GP*UP*AP*UP*AP*UP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2021-07-07
2.8 Å8(1) 7CGI|1|B
1417NR_3.0_98595.1
Exact match
Parechovirus A
6GV4|1|D (6GV4)
  • RNA (5'-R(*UP*GP*GP*UP*AP*UP*UP*U)-3')
  • Electron microscopy
  • Release Date: 2018-11-21
2.8 Å8(1) 6GV4|1|D
1418NR_3.0_99363.1
Exact match
1SA9|1|C+1SA9|1|D (1SA9)
  • 5'-R(*GP*GP*CP*GP*AP*GP*CP*C)-3'
  • X-ray diffraction
  • Release Date: 2004-05-18
2.9 Å8(3) 1SA9|1|C+1SA9|1|D, 1SA9|1|A+1SA9|1|B, 1SA9|1|E
1419NR_3.0_00121.1
Exact match
Streptococcus pneumoniae
5ZQ0|1|B (5ZQ0)
  • RNA (5'-R(*GP*UP*(MUM)P*GP*AP*AP*AP*A)-3[...]
  • X-ray diffraction
  • Release Date: 2018-10-24
2.0 Å7(1) 5ZQ0|1|B
1420NR_3.0_00973.1
Exact match
Mus musculus
2XS2|1|B (2XS2)
  • 5'-R(*UP*UP*GP*UP*UP*CP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2011-10-05
1.4 Å7(1) 2XS2|1|B
1421NR_3.0_03657.1
Exact match
1DDL|1|D (1DDL)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2000-10-30
2.7 Å7(1) 1DDL|1|D
1422NR_3.0_03690.1
Exact match
Schizosaccharomyces pombe
6FPQ|1|B (6FPQ)
  • RNA (5'-R(*UP*UP*AP*AP*AP*CP*C)-3')
  • X-ray diffraction
  • Release Date: 2018-05-09
1.4 Å7(1) 6FPQ|1|B
1423NR_3.0_05778.1
Exact match
Homo sapiens
5GXH|1|B (5GXH)
  • RNA (5'-R(*A*AP*UP*UP*UP*UP*UP*G)-3')
  • X-ray diffraction
  • Release Date: 2016-10-26
1.8 Å7(1) 5GXH|1|B
1424NR_3.0_06107.1
Exact match
Homo sapiens
2VUQ|1|A+2VUQ|1|B (2VUQ)
  • 5'-R(*GP*CP*AP*UP*UP*GP*GP)-3', 5'-R(*CP[...]
  • X-ray diffraction
  • Release Date: 2009-03-10
1.2 Å7(1) 2VUQ|1|A+2VUQ|1|B
1425NR_3.0_08084.1
Exact match
Human orthopneumovirus
6PZQ|1|J+6PZQ|1|I (6PZQ)
  • RNA (5'-R(P*GP*UP*UP*AP*AP*U)-3')
  • X-ray diffraction
  • Release Date: 2020-08-05
2.7 Å7(1) 6PZQ|1|J+6PZQ|1|I
1426NR_3.0_08327.1
Exact match
435D|1|C+435D|1|D (435D)
  • RNA (5'-R(*UP*AP*GP*CP*CP*CP*C)-3'), RNA[...]
  • X-ray diffraction
  • Release Date: 1999-06-14
1.4 Å7(2) 435D|1|C+435D|1|D, 435D|1|A+435D|1|B
1427NR_3.0_09332.1
Exact match
2JLV|1|C (2JLV)
  • 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U[...]
  • X-ray diffraction
  • Release Date: 2008-11-25
1.9 Å7(10) 2JLV|1|C, 2JLV|1|D, 2JLX|1|C, 2JLX|1|D, 2JLU|1|C, 2JLZ|1|D, 2JLZ|1|C, 2JLU|1|D, 2JLY|1|C, 2JLY|1|D
1428NR_3.0_09504.1
Exact match
synthetic construct
4XWW|1|D (4XWW)
  • RNA (5'-D(UP*UP*UP*UP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2015-12-16
1.7 Å7(1) 4XWW|1|D
1429NR_3.0_09629.1
Exact match
synthetic construct
7Y7S|1|D (7Y7S)
  • RNA (5'-R(*UP*CP*CP*GP*AP*CP*C)-3')
  • X-ray diffraction
  • Release Date: 2022-09-28
2.7 Å7(2) 7Y7S|1|D, 7Y7S|1|J
1430NR_3.0_09770.1
Exact match
246D|1|A+246D|1|B (246D)
  • DNA/RNA (5'-R(*GP*UP*AP*UP*AP*UP*AP*)-D([...]
  • X-ray diffraction
  • Release Date: 1996-08-26
2.2 Å7(1) 246D|1|A+246D|1|B
1431NR_3.0_10769.1
Exact match
1YVP|1|H (1YVP)
  • Y RNA sequence, first strand
  • X-ray diffraction
  • Release Date: 2005-06-07
2.2 Å7(1) 1YVP|1|H
1432NR_3.0_12322.1
Exact match
333D|1|A (333D)
  • RNA (5'-R(*CP*GP*CP*AP*IP*GP*CP*G)-3')
  • X-ray diffraction
  • Release Date: 1997-10-16
2.5 Å7(1) 333D|1|A
1433NR_3.0_13174.1
Exact match
Homo sapiens
4E58|1|D+4E58|1|C+4E58|1|E (4E58)
  • RNA duplex containing CCG repeats
  • X-ray diffraction
  • Release Date: 2012-12-12
2.0 Å7(1) 4E58|1|D+4E58|1|C+4E58|1|E
1434NR_3.0_14080.1
Exact match
315D|1|A+315D|1|B (315D)
  • DNA/RNA (5'-R(*GP*UP*AP*UP*GP*UP*AP*)-D([...]
  • X-ray diffraction
  • Release Date: 1997-09-23
1.4 Å7(1) 315D|1|A+315D|1|B
1435NR_3.0_15161.1
Exact match
Homo sapiens
5EN1|1|B (5EN1)
  • RNA (5'-R(*AP*GP*GP*AP*CP*UP*G)-3')
  • X-ray diffraction
  • Release Date: 2016-11-09
2.6 Å7(1) 5EN1|1|B
1436NR_3.0_15952.1
Exact match
1SI2|1|B (1SI2)
  • 5'-R(*CP*GP*UP*GP*AP*CP*U)-D(P*CP*T)-3'
  • X-ray diffraction
  • Release Date: 2004-05-25
2.6 Å7(1) 1SI2|1|B
1437NR_3.0_16115.1
Exact match
2R7X|1|X (2R7X)
  • RNA (5'-R(*UP*GP*UP*GP*AP*CP*C)-3')
  • X-ray diffraction
  • Release Date: 2008-07-29
2.8 Å7(4) 2R7X|1|X, 2R7X|1|Y, 2R7R|1|X, 2R7W|1|X
1438NR_3.0_16324.1
Exact match
Homo sapiens
2VOD|1|D (2VOD)
  • 5'-R(*AP*UP*AP*UP*UP*UP*UP)-3'
  • X-ray diffraction
  • Release Date: 2008-05-06
2.1 Å7(2) 2VOD|1|D, 2VOD|1|C
1439NR_3.0_16422.1
Exact match
1SAQ|1|A+1SAQ|1|B (1SAQ)
  • 5'-R(*GP*IP*CP*GP*AP*GP*CP*C)-3'
  • X-ray diffraction
  • Release Date: 2004-05-18
2.7 Å7(3) 1SAQ|1|A+1SAQ|1|B, 1SAQ|1|C+1SAQ|1|D, 1SAQ|1|E
1440NR_3.0_17264.1
Exact match
Thermus thermophilus
2XSL|1|C+2XSL|1|D (2XSL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*G)-3', 5'-R(*CP*[...]
  • X-ray diffraction
  • Release Date: 2011-08-10
1.6 Å7(2) 2XSL|1|C+2XSL|1|D, 2XSL|1|A+2XSL|1|B
1441NR_3.0_18162.1
Exact match
1KQ2|1|R (1KQ2)
  • 5'-R(*AP*UP*UP*UP*UP*UP*G)-3'
  • X-ray diffraction
  • Release Date: 2002-07-05
2.7 Å7(1) 1KQ2|1|R
1442NR_3.0_18291.1
Exact match
Escherichia coli
3T5Q|1|D (3T5Q)
  • RNA (5'-R(P*UP*AP*UP*CP*UP*CP*A)-3')
  • X-ray diffraction
  • Release Date: 2012-01-11
3.0 Å7(1) 3T5Q|1|D
1443NR_3.0_18961.1
Exact match
1WMQ|1|D (1WMQ)
  • 5'-R(P*UP*UP*UP*AP*GP*UP*U)-3', 5'-R(*UP[...]
  • X-ray diffraction
  • Release Date: 2005-03-15
1.6 Å7(4) 1WMQ|1|D, 1WMQ|1|C, 1WRQ|1|C, 1WRQ|1|D
1444NR_3.0_19039.1
Exact match
1WPU|1|C (1WPU)
  • 5'-R(*UP*UP*GP*AP*GP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2005-08-30
1.5 Å7(2) 1WPU|1|C, 1WPU|1|D
1445NR_3.0_20024.1
Exact match
Homo sapiens
5H3U|1|C (5H3U)
  • RNA (5'-R(*AP*AP*UP*UP*UP*UP*UP*GP*AP*C)[...]
  • X-ray diffraction
  • Release Date: 2016-12-28
2.5 Å7(1) 5H3U|1|C
1446NR_3.0_20040.1
Exact match
Homo sapiens
6UV1|1|D (6UV1)
  • RNA rU10
  • X-ray diffraction
  • Release Date: 2020-01-01
2.3 Å7(1) 6UV1|1|D
1447NR_3.0_20784.1
Exact match
Saccharomyces cerevisiae
4TZ0|1|B (4TZ0)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2014-12-31
2.4 Å7(1) 4TZ0|1|B
1448NR_3.0_21689.1
Exact match
2B3J|1|G (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-ray diffraction
  • Release Date: 2006-01-24
2.0 Å7(1) 2B3J|1|G
1449NR_3.0_23301.1
Exact match
3HSB|1|X (3HSB)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*A)-3')
  • X-ray diffraction
  • Release Date: 2010-06-23
2.2 Å7(1) 3HSB|1|X
1450NR_3.0_23462.1
Exact match
synthetic construct
6DTA|1|D (6DTA)
  • RNA (5'-R(*UP*UP*GP*GP*UP*GP*G)-3')
  • X-ray diffraction
  • Release Date: 2018-07-11
2.7 Å7(1) 6DTA|1|D
1451NR_3.0_26733.1
Exact match
2G4B|1|B (2G4B)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2006-07-25
2.5 Å7(1) 2G4B|1|B
1452NR_3.0_27290.1
Exact match
419D|1|C+419D|1|D (419D)
  • DNA/RNA (5'-R(*GP*UP*AP*UP*AP*CP*A)-D(P*[...]
  • X-ray diffraction
  • Release Date: 2000-05-29
2.2 Å7(2) 419D|1|C+419D|1|D, 419D|1|A+419D|1|B
1453NR_3.0_28023.1
Exact match
Drosophila
5EX7|1|B (5EX7)
  • RNA (5'-R(P*UP*UP*UP*GP*UP*UP*GP*U)-3')
  • X-ray diffraction
  • Release Date: 2015-12-09
2.6 Å7(1) 5EX7|1|B
1454NR_3.0_29312.1
Exact match
Escherichia coli
2V6W|1|A+2V6W|1|B (2V6W)
  • 5'-R(*GP*GP*AP*GP*AP*GP*AP)-3', 5'-R(*UP[...]
  • X-ray diffraction
  • Release Date: 2007-11-06
1.8 Å7(1) 2V6W|1|A+2V6W|1|B
1455NR_3.0_30938.1
Exact match
Lassa mammarenavirus
7OEA|1|E (7OEA)
  • 3' vRNA
  • Electron microscopy
  • Release Date: 2021-12-01
2.7 Å7(1) 7OEA|1|E
1456NR_3.0_31898.1
Exact match
unidentified
5U0Q|1|C+5U0Q|1|D (5U0Q)
  • RNA (5'-R(*UP*AP*GP*CP*UP*CP*C)-3'), RNA[...]
  • X-ray diffraction
  • Release Date: 2017-11-29
1.4 Å7(4) 5U0Q|1|C+5U0Q|1|D, 5U0Q|1|A+5U0Q|1|B, 5TKO|1|A+5TKO|1|B, 5TKO|1|C+5TKO|1|D
1457NR_3.0_32733.1
Exact match
2PO1|1|C (2PO1)
  • 10-mer poly(A)
  • X-ray diffraction
  • Release Date: 2008-03-18
1.9 Å7(1) 2PO1|1|C
1458NR_3.0_35591.1
Exact match
synthetic construct
7XWZ|1|F (7XWZ)
  • RNA (5'-R(P*GP*UP*CP*AP*GP*UP*G)-3')
  • X-ray diffraction
  • Release Date: 2023-02-08
2.3 Å7(1) 7XWZ|1|F
1459NR_3.0_36129.1
Exact match
Escherichia coli
2VAL|1|A+2VAL|1|C (2VAL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*AP)-3', 5'-R(*UP[...]
  • X-ray diffraction
  • Release Date: 2007-10-16
2.0 Å7(2) 2VAL|1|A+2VAL|1|C, 2VAL|1|B+2VAL|1|D
1460NR_3.0_36650.1
Exact match
synthetic construct
7XWZ|1|C+7XWZ|1|D (7XWZ)
  • RNA (5'-R(*CP*AP*CP*UP*GP*AP*C)-3'), RNA[...]
  • X-ray diffraction
  • Release Date: 2023-02-08
2.3 Å7(2) 7XWZ|1|C+7XWZ|1|D, 7XWZ|1|E
1461NR_3.0_36794.1
Exact match
1G2J|1|A (1G2J)
  • 5'-R(*CP*CP*CP*(PYY)P*GP*GP*GP*G)-3'
  • X-ray diffraction
  • Release Date: 2000-12-06
2.0 Å7(1) 1G2J|1|A
1462NR_3.0_37566.1
Exact match
synthetic construct
4X2B|1|B+4X2B|1|C (4X2B)
  • RNA template, RNA primer
  • X-ray diffraction
  • Release Date: 2015-05-06
2.9 Å7(1) 4X2B|1|B+4X2B|1|C
1463NR_3.0_39268.1
Exact match
synthetic construct
3E2E|1|R (3E2E)
  • RNA (5'-R(*GP*GP*GP*AP*GP*UP*G)-3')
  • X-ray diffraction
  • Release Date: 2008-11-04
3.0 Å7(1) 3E2E|1|R
1464NR_3.0_43929.1
Exact match
Homo sapiens
6UV1|1|C (6UV1)
  • RNA rU10
  • X-ray diffraction
  • Release Date: 2020-01-01
2.3 Å7(1) 6UV1|1|C
1465NR_3.0_45210.1
Exact match
Saccharomyces cerevisiae
4TYW|1|B (4TYW)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2014-12-31
2.2 Å7(1) 4TYW|1|B
1466NR_3.0_45842.1
Exact match
synthetic construct
6GD2|1|D (6GD2)
  • RNA (5'-R(P*UP*UP*UP*AP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2018-10-31
1.9 Å7(1) 6GD2|1|D
1467NR_3.0_46386.1
Exact match
2R7T|1|X (2R7T)
  • RNA (5'-R(*UP*GP*UP*GP*AP*AP*CP*C)-3')
  • X-ray diffraction
  • Release Date: 2008-07-29
3.0 Å7(1) 2R7T|1|X
1468NR_3.0_46712.1
Exact match
synthetic construct
7THB|1|E (7THB)
  • RNA (5'-R(*AP*GP*CP*UP*UP*AP*C)-3')
  • X-ray diffraction
  • Release Date: 2022-04-27
1.6 Å7(3) 7THB|1|E, 7THB|1|B, 7THB|1|H
1469NR_3.0_48641.1
Exact match
1M8X|1|D (1M8X)
  • 5'-R(P*UP*GP*UP*AP*UP*AP*U)-3'
  • X-ray diffraction
  • Release Date: 2002-09-25
2.2 Å7(2) 1M8X|1|D, 1M8W|1|D
1470NR_3.0_50067.1
Exact match
Homo sapiens
3NNC|1|B (3NNC)
  • RNA (5'-R(*UP*GP*UP*GP*UP*GP*UP*UP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2010-10-27
2.2 Å7(1) 3NNC|1|B
1471NR_3.0_50890.1
Exact match
3JXQ|1|L+3JXQ|1|K (3JXQ)
  • r[CGCG(5-fluoro)CG]2
  • X-ray diffraction
  • Release Date: 2010-02-09
1.5 Å7(4) 3JXQ|1|L+3JXQ|1|K, 3JXQ|1|B+3JXQ|1|A, 3JXR|1|A+3JXR|1|B, 3JXR|1|K
1472NR_3.0_50990.1
Exact match
synthetic construct
4U34|1|B+4U34|1|A (4U34)
  • RNA (5'-R(*GP*GP*AP*GP*CP*UP*A)-3'), RNA[...]
  • X-ray diffraction
  • Release Date: 2014-08-13
1.4 Å7(1) 4U34|1|B+4U34|1|A
1473NR_3.0_51514.1
Exact match
Homo sapiens
6L5N|1|D (6L5N)
  • poly(U)-15mer
  • X-ray diffraction
  • Release Date: 2020-06-17
2.2 Å7(1) 6L5N|1|D
1474NR_3.0_54586.1
Exact match
1L3Z|1|B (1L3Z)
  • 5'-R(*GP*UP*AP*UP*AP*CP*A)-3'
  • X-ray diffraction
  • Release Date: 2003-02-25
2.0 Å7(2) 1L3Z|1|B, 1L3Z|1|A
1475NR_3.0_54592.1
Exact match
464D|1|A+464D|1|B (464D)
  • RNA (5'-R(*UP*AP*GP*CP*UP*CP*C)-3'), RNA[...]
  • X-ray diffraction
  • Release Date: 1999-08-16
1.2 Å7(11) 464D|1|A+464D|1|B, 464D|1|C+464D|1|D, 466D|1|C+466D|1|D, 466D|1|A+466D|1|B, 4U37|1|A+4U37|1|B, 4U38|1|A+4U38|1|B, 4U38|1|C+4U38|1|D, 4U38|1|E+4U38|1|F, 4U38|1|G+4U38|1|H, 434D|1|C+434D|1|D, 434D|1|A+434D|1|B
1476NR_3.0_56855.1
Exact match
3KNA|1|B+3KNA|1|C (3KNA)
  • RNA (5'-R(*AP*UP*GP*GP*GP*CP*C)-3'), RNA[...]
  • X-ray diffraction
  • Release Date: 2010-07-07
2.8 Å7(4) 3KNA|1|B+3KNA|1|C, 4IQX|1|B+4IQX|1|C, 3KMS|1|B+3KMS|1|C, 3KLV|1|B+3KLV|1|C
1477NR_3.0_57614.1
Exact match
Thermus thermophilus
6OVR|1|I (6OVR)
  • RNA (5'-D(*(GTP))-R(P*GP*GP*GP*GP*GP*GP*[...]
  • X-ray diffraction
  • Release Date: 2019-07-24
2.8 Å7(1) 6OVR|1|I
1478NR_3.0_57688.1
Exact match
409D|1|C+409D|1|D (409D)
  • RNA (5'-R(*CP*CP*CP*IP*UP*GP*GP*G)-3')
  • X-ray diffraction
  • Release Date: 1999-01-13
2.5 Å7(3) 409D|1|C+409D|1|D, 409D|1|A+409D|1|B, 409D|1|E+409D|1|F
1479NR_3.0_59612.1
Exact match
2DB3|1|E (2DB3)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2006-05-02
2.2 Å7(4) 2DB3|1|E, 2DB3|1|F, 2DB3|1|G, 2DB3|1|H
1480NR_3.0_59755.1
Exact match
2JLW|1|D (2JLW)
  • 5'-R(*UP*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*C[...]
  • X-ray diffraction
  • Release Date: 2008-11-25
2.6 Å7(2) 2JLW|1|D, 2JLW|1|C
1481NR_3.0_59870.1
Exact match
3S49|1|E+3S49|1|F (3S49)
  • RNA (5'-R(*GP*UP*AP*UP*AP*(RUS)P*AP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2011-06-29
2.3 Å7(4) 3S49|1|E+3S49|1|F, 3S49|1|C+3S49|1|D, 3S49|1|A+3S49|1|B, 3S49|1|G
1482NR_3.0_61167.1
Exact match
synthetic construct
4U35|1|B+4U35|1|A (4U35)
  • RNA (5'-R(*GP*GP*UP*GP*CP*UP*A)-3'), RNA[...]
  • X-ray diffraction
  • Release Date: 2014-08-13
1.6 Å7(1) 4U35|1|B+4U35|1|A
1483NR_3.0_63291.1
Exact match
synthetic construct
6GVY|1|C+6GVY|1|B (6GVY)
  • RNA (5'-R(P*CP*UP*CP*CP*CP*GP*GP*G)-3'),[...]
  • X-ray diffraction
  • Release Date: 2018-08-01
2.2 Å7(1) 6GVY|1|C+6GVY|1|B
1484NR_3.0_63343.1
Exact match
Schizosaccharomyces pombe
5DNO|1|B (5DNO)
  • RNA (5'-R(*CP*UP*UP*AP*AP*AP*C)-3')
  • X-ray diffraction
  • Release Date: 2016-04-06
1.8 Å7(1) 5DNO|1|B
1485NR_3.0_64642.1
Exact match
synthetic construct
4XWW|1|E (4XWW)
  • RNA (5'-D(UP*UP*UP*UP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2015-12-16
1.7 Å7(1) 4XWW|1|E
1486NR_3.0_65010.1
Exact match
Homo sapiens
2V7R|1|A+2V7R|1|B (2V7R)
  • HUMAN TRNAGLY MICROHELIX
  • X-ray diffraction
  • Release Date: 2008-03-18
1.2 Å7(1) 2V7R|1|A+2V7R|1|B
1487NR_3.0_67036.1
Exact match
Homo sapiens
5H1L|1|B (5H1L)
  • U4 snRNA (5'-R(*AP*UP*UP*UP*UP*UP*G)-3')
  • X-ray diffraction
  • Release Date: 2016-11-23
2.1 Å7(1) 5H1L|1|B
1488NR_3.0_67171.1
Exact match
418D|1|A+418D|1|B (418D)
  • RNA (5'-R(*GP*UP*GP*CP*AP*CP*AP*C)-3')
  • X-ray diffraction
  • Release Date: 2003-06-10
2.4 Å7(1) 418D|1|A+418D|1|B
1489NR_3.0_69076.1
Exact match
3G0H|1|E (3G0H)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2009-02-17
2.7 Å7(1) 3G0H|1|E
1490NR_3.0_71389.1
Exact match
synthetic construct
6M6R|1|B (6M6R)
  • RNA (5'-R(*(GTP)P*GP*CP*CP*GP*CP*CP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2021-03-17
1.9 Å7(1) 6M6R|1|B
1491NR_3.0_71707.1
Exact match
Homo sapiens
2VON|1|C (2VON)
  • 5'-R(*AP*UP*AP*AP*UP*UP*UP)-3'
  • X-ray diffraction
  • Release Date: 2008-05-06
2.1 Å7(2) 2VON|1|C, 2VON|1|D
1492NR_3.0_72146.1
Exact match
Satellite tobacco mosaic virus
7M50|1|n+7M50|1|Y (7M50)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*U)-3'),[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.3 Å7(1) 7M50|1|n+7M50|1|Y
1493NR_3.0_73115.1
Exact match
Homo sapiens
4HT9|1|D (4HT9)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2013-04-17
1.8 Å7(3) 4HT9|1|D, 4HT8|1|I, 4HT8|1|K
1494NR_3.0_73160.1
Exact match
Homo sapiens
6UV4|1|C (6UV4)
  • 18a_oligo1
  • X-ray diffraction
  • Release Date: 2020-01-01
1.7 Å7(1) 6UV4|1|C
1495NR_3.0_73255.1
Exact match
485D|1|A+485D|1|B (485D)
  • RNA/DNA(5'-R(*CP*GP*UP*GP*AP*UP*CP*GP)-D[...]
  • X-ray diffraction
  • Release Date: 1999-12-18
1.0 Å7(2) 485D|1|A+485D|1|B, 6IBQ|1|A+6IBQ|1|B
1496NR_3.0_75344.1
Exact match
4QM6|1|D (4QM6)
  • RNA
  • X-ray diffraction
  • Release Date: 2014-10-08
1.5 Å7(2) 4QM6|1|D, 4QM6|1|C
1497NR_3.0_75428.1
Exact match
synthetic construct
7BPG|1|G (7BPG)
  • RNA (5'-R(*GP*CP*UP*GP*CP*(5BU)P*GP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2020-11-25
1.7 Å7(4) 7BPG|1|G, 7BPG|1|A, 7BPG|1|E, 7BPG|1|C
1498NR_3.0_76721.1
Exact match
Homo sapiens
8E3I|1|E (8E3I)
  • RNA (5'-R(P*CP*AP*UP*UP*AP*AP*AP*CP*AP*A[...]
  • Electron microscopy
  • Release Date: 2023-01-18
2.5 Å7(1) 8E3I|1|E
1499NR_3.0_76723.1
Exact match
Satellite tobacco mosaic virus
5BKL|1|h+5BKL|1|S (5BKL)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å7(1) 5BKL|1|h+5BKL|1|S
1500NR_3.0_77683.1
Exact match
2JEA|1|C (2JEA)
  • RNA
  • X-ray diffraction
  • Release Date: 2007-04-03
2.3 Å7(1) 2JEA|1|C
1501NR_3.0_78605.1
Exact match
synthetic construct
5JJI|1|G (5JJI)
  • rU12: 5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*[...]
  • X-ray diffraction
  • Release Date: 2016-11-16
2.6 Å7(1) 5JJI|1|G
1502NR_3.0_79329.1
Exact match
332D|1|A+332D|1|B (332D)
  • DNA/RNA (5'-R(*GP*UP*GP*UP*GP*UP*AP*)-D([...]
  • X-ray diffraction
  • Release Date: 1997-09-23
1.6 Å7(1) 332D|1|A+332D|1|B
1503NR_3.0_80487.1
Exact match
SFTS virus AH12
8ASD|1|E (8ASD)
  • RNA (5'-R(P*AP*CP*AP*CP*AP*GP*AP*GP*AP*C[...]
  • Electron microscopy
  • Release Date: 2023-01-18
2.6 Å7(1) 8ASD|1|E
1504NR_3.0_80567.1
Exact match
3GVN|1|A+3GVN|1|B (3GVN)
  • 5'-R(*GP*GP*UP*GP*AP*GP*G)-3', 5'-R(*CP*[...]
  • X-ray diffraction
  • Release Date: 2009-07-28
1.2 Å7(1) 3GVN|1|A+3GVN|1|B
1505NR_3.0_81724.1
Exact match
3Q0N|1|D (3Q0N)
  • 5'-R(UP*GP*UP*AP*CP*AP*UP*C)-3'
  • X-ray diffraction
  • Release Date: 2011-03-16
2.4 Å7(3) 3Q0N|1|D, 3Q0O|1|C, 3Q0O|1|D
1506NR_3.0_82332.1
Exact match
Homo sapiens
6UV3|1|B (6UV3)
  • 125a-oligo2
  • X-ray diffraction
  • Release Date: 2020-01-01
1.6 Å7(1) 6UV3|1|B
1507NR_3.0_83451.1
Exact match
synthetic construct
7Y7R|1|D (7Y7R)
  • RNA (5'-R(*UP*CP*CP*GP*AP*CP*G)-3')
  • X-ray diffraction
  • Release Date: 2022-09-28
2.1 Å7(3) 7Y7R|1|D, 7Y7R|1|F, 7Y7R|1|G
1508NR_3.0_83946.1
Exact match
Bombyx mori
5GUH|1|B (5GUH)
  • RNA (28-MER)
  • X-ray diffraction
  • Release Date: 2016-10-19
2.4 Å7(1) 5GUH|1|B
1509NR_3.0_87746.1
Exact match
4IQS|1|E (4IQS)
  • RNA (5'-R(*GP*UP*GP*(S5)P*AP*CP*AP*C)-3'[...]
  • X-ray diffraction
  • Release Date: 2013-12-25
2.6 Å7(4) 4IQS|1|E, 4IQS|1|C+4IQS|1|D, 4IQS|1|A+4IQS|1|B, 4IQS|1|F
1510NR_3.0_87898.1
Exact match
Lassa mammarenavirus
7OJN|1|E (7OJN)
  • 3' RNA
  • Electron microscopy
  • Release Date: 2021-12-01
2.9 Å7(1) 7OJN|1|E
1511NR_3.0_88706.1
Exact match
synthetic construct
4JAH|1|A+4JAH|1|B (4JAH)
  • RNA (5'-R(*GP*UP*GP*UP*AP*(RUS)P*AP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2014-01-29
1.5 Å7(3) 4JAH|1|A+4JAH|1|B, 4JAH|1|C+4JAH|1|D, 4JAH|1|E+4JAH|1|F
1512NR_3.0_89476.1
Exact match
unidentified
5JRC|1|E (5JRC)
  • ssRNA
  • X-ray diffraction
  • Release Date: 2016-09-28
1.9 Å7(1) 5JRC|1|E
1513NR_3.0_90383.1
Exact match
synthetic construct
6KOO|1|I (6KOO)
  • RNA (5'-R(*CP*CP*CP*UP*CP*GP*A)-3')
  • X-ray diffraction
  • Release Date: 2020-03-11
2.8 Å7(2) 6KOO|1|I, 5ZX2|1|I
1514NR_3.0_93459.1
Exact match
1M8W|1|F (1M8W)
  • 5'-R(P*UP*GP*UP*CP*CP*AP*G)-3'
  • X-ray diffraction
  • Release Date: 2002-09-25
2.2 Å7(1) 1M8W|1|F
1515NR_3.0_97196.1
Exact match
Caenorhabditis elegans
3V71|1|B (3V71)
  • RNA (5'-R(*CP*UP*CP*UP*GP*UP*AP*UP*CP*UP[...]
  • X-ray diffraction
  • Release Date: 2012-01-04
2.9 Å7(1) 3V71|1|B
1516NR_3.0_97569.1
Exact match
Escherichia coli
2W89|1|A+2W89|1|B (2W89)
  • 5'-R(*GP*CP*AP*UP*CP*CP*GP)-3', 5'-R(*CP[...]
  • X-ray diffraction
  • Release Date: 2009-11-17
2.0 Å7(2) 2W89|1|A+2W89|1|B, 2W89|1|C+2W89|1|D
1517NR_3.0_97629.1
Exact match
3NL0|1|B+3NL0|1|C (3NL0)
  • 5'-R(P*UP*GP*GP*GP*CP*CP*C)-3', 5'-R(*G*[...]
  • X-ray diffraction
  • Release Date: 2011-07-13
2.6 Å7(1) 3NL0|1|B+3NL0|1|C
1518NR_3.0_99259.1
Exact match
synthetic construct
6VEM|1|A+6VEM|1|B (6VEM)
  • Modified Octamer RNA
  • X-ray diffraction
  • Release Date: 2020-11-18
1.6 Å7(1) 6VEM|1|A+6VEM|1|B
1519NR_3.0_99388.1
Exact match
Satellite tobacco mosaic virus
5BKL|1|UU+5BKL|1|ll (5BKL)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å7(1) 5BKL|1|UU+5BKL|1|ll
1520NR_3.0_99409.1
Exact match
Homo sapiens
6QIT|1|A+6QIT|1|B (6QIT)
  • RNA (5'-R(*GP*CP*AP*G)-D(P*(CSL))-R(P*AP[...]
  • X-ray diffraction
  • Release Date: 2019-09-25
1.5 Å7(9) 6QIT|1|A+6QIT|1|B, 6QIT|1|C+6QIT|1|D, 6QIR|1|A+6QIR|1|B, 6QIR|1|C+6QIR|1|D, 6QIV|1|A, 6QIQ|1|A+6QIQ|1|B, 6QIS|1|A+6QIS|1|B+6QIS|1|C+6QIS|1|D, 6QIS|1|E+6QIS|1|F, 6QIS|1|G+6QIS|1|H
1521NR_3.0_00429.1
Exact match
synthetic construct
6WXY|1|A (6WXY)
  • cA6
  • X-ray diffraction
  • Release Date: 2020-12-30
2.1 Å6(1) 6WXY|1|A
1522NR_3.0_00935.1
Exact match
synthetic construct
7NDJ|1|C (7NDJ)
  • RNA (5'-R(*UP*UP*AP*UP*UP*AP*U)-3')
  • X-ray diffraction
  • Release Date: 2021-05-19
1.6 Å6(1) 7NDJ|1|C
1523NR_3.0_05648.1
Exact match
Human gammaherpesvirus 8
6HAU|1|D (6HAU)
  • MRE fragment of PAN RNA
  • X-ray diffraction
  • Release Date: 2018-11-21
1.9 Å6(1) 6HAU|1|D
1524NR_3.0_06254.1
Exact match
synthetic construct
3P4C|1|A (3P4C)
  • 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ[...]
  • X-ray diffraction
  • Release Date: 2011-01-05
1.2 Å6(1) 3P4C|1|A
1525NR_3.0_09702.1
Exact match
synthetic construct
4RJ1|1|B (4RJ1)
  • RNA (5'-R(*UP*GP*GP*GP*GP*U)-3')
  • X-ray diffraction
  • Release Date: 2014-11-12
0.9 Å6(1) 4RJ1|1|B
1526NR_3.0_09880.4
Exact match
2G8I|1|B (2G8I)
  • 5'-R(*UP*CP*GP*AP*CP*A)-3', 5'-R(P*UP*CP[...]
  • X-ray diffraction
  • Release Date: 2006-04-25
1.7 Å6(17) 2G8I|1|B, 2G8F|1|B, 5USG|1|B, 3ULD|1|B, 2G8K|1|B, 3TWH|1|B, 5USA|1|B, 5WJR|1|B, 5W7O|1|B, 5USE|1|B, 5US2|1|B, 5W7N|1|B, 2G8H|1|B, 2R7Y|1|B, 2G8V|1|B, 2G8W|1|B, 2G8U|1|B
1527NR_3.0_12080.1
Exact match
3HGA|1|X (3HGA)
  • RNA (5'-R(*UP*UP*CP*GP*CP*G)-3'), 5'-R(*[...]
  • X-ray diffraction
  • Release Date: 2009-08-18
1.3 Å6(2) 3HGA|1|X, 1OSU|1|A
1528NR_3.0_13395.1
Exact match
3MDG|1|C (3MDG)
  • RNA (5'-R(*UP*UP*GP*UP*AP*U)-3')
  • X-ray diffraction
  • Release Date: 2010-06-02
2.2 Å6(1) 3MDG|1|C
1529NR_3.0_15144.1
Exact match
3FHT|1|D (3FHT)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-ray diffraction
  • Release Date: 2009-02-17
2.2 Å6(1) 3FHT|1|D
1530NR_3.0_15756.1
Exact match
Saccharomyces cerevisiae
4U8T|1|T (4U8T)
  • RNA (5'-R(*AP*GP*GP*(6MZ)P*CP*AP*U)-3')
  • X-ray diffraction
  • Release Date: 2014-09-10
2.7 Å6(6) 4U8T|1|T, 4U8T|1|P, 4U8T|1|Q, 4U8T|1|S, 4U8T|1|O, 4U8T|1|R
1531NR_3.0_16130.1
Exact match
synthetic construct
1UTD|1|0 (1UTD)
  • 5'-R(*GP*UP*UP*UP*GP*AP)-3'
  • X-ray diffraction
  • Release Date: 2004-01-15
2.1 Å6(10) 1UTD|1|0, 1UTD|1|6, 1UTD|1|Z, 1UTD|1|4, 1UTD|1|7, 1UTD|1|9, 1UTD|1|5, 1UTD|1|3, 1UTD|1|2, 1UTD|1|8
1532NR_3.0_17090.1
Exact match
synthetic construct
5XC6|1|C (5XC6)
  • RNA (5'-R(*AP*GP*UP*UP*GP*UP*UP*AP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2017-11-08
2.9 Å6(2) 5XC6|1|C, 5XC6|1|D
1533NR_3.0_18481.1
Exact match
synthetic construct
5EV4|1|B (5EV4)
  • DNA/RNA (5'-R(P*UP*UP*UP*(UD)P*UP*U)-D(P[...]
  • X-ray diffraction
  • Release Date: 2016-02-24
1.6 Å6(1) 5EV4|1|B
1534NR_3.0_24223.1
Exact match
Escherichia coli
6F3H|1|C (6F3H)
  • RNA (5'-R(P*AP*GP*AP*UP*AP*C)-3')
  • X-ray diffraction
  • Release Date: 2018-01-17
2.7 Å6(1) 6F3H|1|C
1535NR_3.0_24721.1
Exact match
synthetic construct
6PPP|1|A (6PPP)
  • Mimic of processed U6 snRNA
  • X-ray diffraction
  • Release Date: 2020-06-17
2.3 Å6(2) 6PPP|1|A, 6PPP|1|I
1536NR_3.0_25170.1
Exact match
Satellite tobacco mosaic virus
5BKL|1|kk+5BKL|1|TT (5BKL)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å6(1) 5BKL|1|kk+5BKL|1|TT
1537NR_3.0_25498.1
Exact match
synthetic construct
6LLB|1|D (6LLB)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2020-01-01
2.6 Å6(1) 6LLB|1|D
1538NR_3.0_25852.1
Exact match
1M8V|1|P (1M8V)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-ray diffraction
  • Release Date: 2003-02-11
2.6 Å6(7) 1M8V|1|P, 1M8V|1|R, 1M8V|1|U, 1M8V|1|Q, 1M8V|1|S, 1M8V|1|T, 1M8V|1|O
1539NR_3.0_26105.1
Exact match
synthetic construct
5ELS|1|I (5ELS)
  • RNA (5'-R(P*AP*AP*AP*UP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2016-01-13
2.9 Å6(1) 5ELS|1|I
1540NR_3.0_28499.1
Exact match
Virus-associated RNAs
6L1W|1|C (6L1W)
  • RNA (5'-R(*CP*GP*UP*CP*GP*U)-3')
  • X-ray diffraction
  • Release Date: 2020-01-01
2.2 Å6(1) 6L1W|1|C
1541NR_3.0_28964.1
Exact match
1PGL|1|3 (1PGL)
  • 5'-R(*AP*GP*UP*CP*UP*C)-3'
  • X-ray diffraction
  • Release Date: 2003-11-18
2.8 Å6(1) 1PGL|1|3
1542NR_3.0_29328.1
Exact match
synthetic construct
8EDJ|1|R (8EDJ)
  • RNA (5'-R(P*UP*GP*AP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2023-01-11
1.8 Å6(1) 8EDJ|1|R
1543NR_3.0_29370.1
Exact match
synthetic construct
5WWW|1|B (5WWW)
  • RNA (5'-R(*GP*UP*UP*UP*AP*G)-3')
  • X-ray diffraction
  • Release Date: 2017-08-23
1.8 Å6(1) 5WWW|1|B
1544NR_3.0_29524.1
Exact match
2J0S|1|E (2J0S)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP *UP*[...]
  • X-ray diffraction
  • Release Date: 2006-09-06
2.2 Å6(1) 2J0S|1|E
1545NR_3.0_31074.2
Exact match
4RKV|1|A (4RKV)
  • 5'-R(*UP*GP*GP*GP*GP*U)-3', RNA (5'-R(*U[...]
  • X-ray diffraction
  • Release Date: 2014-11-19
0.9 Å6(13) 4RKV|1|A, 4RNE|1|B, 4RJ1|1|A, 4RNE|1|C, 4RNE|1|E, 4RNE|1|D, 4RNE|1|A, 4RNE|1|G, 4RNE|1|F, 4RNE|1|H, 1J8G|1|A, 1J8G|1|C, 1J8G|1|D
1546NR_3.0_33315.1
Exact match
2A8V|1|E (2A8V)
  • 5'-R(P*CP*CP*CP*CP*CP*C)-3'
  • X-ray diffraction
  • Release Date: 1999-04-26
2.4 Å6(1) 2A8V|1|E
1547NR_3.0_33509.1
Exact match
3MDI|1|C (3MDI)
  • RNA (5'-R(*UP*GP*UP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2010-06-02
2.1 Å6(1) 3MDI|1|C
1548NR_3.0_33619.1
Exact match
Saccharomyces cerevisiae
5K78|1|x (5K78)
  • branch 2 of branched RNA 5'-UACUAA(2'-GU[...]
  • X-ray diffraction
  • Release Date: 2016-12-07
2.6 Å6(2) 5K78|1|x, 5K78|1|y
1549NR_3.0_41566.1
Exact match
4RKV|1|B (4RKV)
  • 5'-R(*UP*GP*GP*GP*GP*U)-3', RNA (5'-R(*U[...]
  • X-ray diffraction
  • Release Date: 2014-11-19
0.9 Å6(2) 4RKV|1|B, 1J8G|1|B
1550NR_3.0_41745.1
Exact match
synthetic construct
6DOY|1|B (6DOY)
  • RNA (5'-R(*AP*CP*AP*UP*CP*G)-3')
  • X-ray diffraction
  • Release Date: 2018-08-15
1.5 Å6(1) 6DOY|1|B
1551NR_3.0_41964.1
Exact match
4O8J|1|D (4O8J)
  • RNA
  • X-ray diffraction
  • Release Date: 2014-09-10
2.0 Å6(2) 4O8J|1|D, 4O8J|1|E
1552NR_3.0_43624.1
Exact match
Schizosaccharomyces pombe
7EIU|1|C (7EIU)
  • RNA (5'-R(P*UP*UP*CP*UP*GP*C)-3')
  • X-ray diffraction
  • Release Date: 2022-04-06
2.3 Å6(2) 7EIU|1|C, 7EIU|1|D
1553NR_3.0_49675.1
Exact match
synthetic construct
7BPF|1|A (7BPF)
  • RNA (5'-R(*GP*CP*UP*GP*CP*(5BU)P*GP*C)-3[...]
  • X-ray diffraction
  • Release Date: 2020-11-25
1.8 Å6(2) 7BPF|1|A, 7BPF|1|B
1554NR_3.0_50496.1
Exact match
synthetic construct
5YTT|1|B (5YTT)
  • RNA (5'-R(P*UP*CP*AP*UP*GP*U)-3')
  • X-ray diffraction
  • Release Date: 2018-12-05
1.6 Å6(1) 5YTT|1|B
1555NR_3.0_51148.1
Exact match
synthetic construct
5ELS|1|H (5ELS)
  • RNA (5'-R(P*AP*AP*AP*UP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2016-01-13
2.9 Å6(1) 5ELS|1|H
1556NR_3.0_54538.1
Exact match
4JIY|1|A (4JIY)
  • 5'-(CGUACG)-3'
  • X-ray diffraction
  • Release Date: 2013-09-04
1.9 Å6(1) 4JIY|1|A
1557NR_3.0_55334.1
Exact match
Mus musculus
5ELK|1|R (5ELK)
  • RNA
  • X-ray diffraction
  • Release Date: 2015-12-09
2.3 Å6(1) 5ELK|1|R
1558NR_3.0_55974.1
Exact match
synthetic construct
7S3C|1|B (7S3C)
  • DNA/RNA (5'-R(P*UP*UP*(UD)P*AP*U)-D(P*(B[...]
  • X-ray diffraction
  • Release Date: 2022-05-25
1.5 Å6(1) 7S3C|1|B
1559NR_3.0_56199.1
Exact match
Escherichia coli
5NEW|1|H (5NEW)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2017-10-04
2.5 Å6(1) 5NEW|1|H
1560NR_3.0_57261.1
Exact match
synthetic construct
6GD3|1|P (6GD3)
  • RNA (5'-R(P*UP*AP*UP*UP*UP*A)-3')
  • X-ray diffraction
  • Release Date: 2018-10-31
1.4 Å6(1) 6GD3|1|P
1561NR_3.0_57322.1
Exact match
synthetic construct
7S3B|1|B (7S3B)
  • DNA/RNA (5'-R(P*UP*UP*(UD)P*GP*U)-D(P*(B[...]
  • X-ray diffraction
  • Release Date: 2022-05-25
1.9 Å6(1) 7S3B|1|B
1562NR_3.0_57351.1
Exact match
synthetic construct
7S3A|1|B (7S3A)
  • DNA/RNA (5'-R(P*UP*UP*(UD)P*CP*U)-D(P*(B[...]
  • X-ray diffraction
  • Release Date: 2022-05-25
1.5 Å6(1) 7S3A|1|B
1563NR_3.0_58357.1
Exact match
Thermus thermophilus
1FJG|1|X (1FJG)
  • FRAGMENT OF MESSENGER RNA
  • X-ray diffraction
  • Release Date: 2000-09-25
3.0 Å6(1) 1FJG|1|X
1564NR_3.0_58396.1
Exact match
Severe acute respiratory syndrome coronavirus 2
7CXM|1|L (7CXM)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*U)-3')
  • Electron microscopy
  • Release Date: 2020-11-04
2.9 Å6(1) 7CXM|1|L
1565NR_3.0_59826.1
Exact match
Satellite tobacco mosaic virus
7M50|1|a (7M50)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2021-12-15
2.3 Å6(1) 7M50|1|a
1566NR_3.0_60357.1
Exact match
3KOA|1|B+3KOA|1|C (3KOA)
  • RNA (5'-R(P*AP*UP*GP*GP*GP*C)-3'), RNA ([...]
  • X-ray diffraction
  • Release Date: 2010-07-07
2.4 Å6(1) 3KOA|1|B+3KOA|1|C
1567NR_3.0_60836.1
Exact match
Streptomyces coelicolor
5A0V|1|E (5A0V)
  • 5'-R(*CP*GP*CP*CP*UP*CP)-3'
  • X-ray diffraction
  • Release Date: 2015-08-19
2.8 Å6(2) 5A0V|1|E, 5A0V|1|F
1568NR_3.0_66606.1
Exact match
synthetic construct
7UU4|1|R (7UU4)
  • RNA (5'-R(P*UP*AP*AP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2023-01-11
2.1 Å6(1) 7UU4|1|R
1569NR_3.0_66740.1
Exact match
Escherichia coli
3T5N|1|C (3T5N)
  • RNA (5'-R(P*UP*AP*UP*CP*UP*C)-3')
  • X-ray diffraction
  • Release Date: 2012-01-11
1.8 Å6(3) 3T5N|1|C, 3T5Q|1|H, 3T5Q|1|L
1570NR_3.0_67685.1
Exact match
3D2S|1|E (3D2S)
  • 5'-R(*CP*GP*CP*UP*GP*U)-3'
  • X-ray diffraction
  • Release Date: 2008-12-02
1.7 Å6(2) 3D2S|1|E, 3D2S|1|G
1571NR_3.0_68255.1
Exact match
Drosophila melanogaster
7ZHH|1|C (7ZHH)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2022-12-07
1.6 Å6(1) 7ZHH|1|C
1572NR_3.0_68486.1
Exact match
synthetic construct
6KQG|1|I (6KQG)
  • RNA (5'-R(*CP*CP*UP*CP*GP*A)-3')
  • X-ray diffraction
  • Release Date: 2020-03-11
2.8 Å6(2) 6KQG|1|I, 6JCX|1|I
1573NR_3.0_68928.1
Exact match
Bombyx mori
4D25|1|D (4D25)
  • 5'-R(*UP*GP*AP*CP*AP*UP)-3'
  • X-ray diffraction
  • Release Date: 2014-06-18
1.9 Å6(2) 4D25|1|D, 4D26|1|D
1574NR_3.0_69142.1
Exact match
Homo sapiens
3NMR|1|B (3NMR)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2010-10-27
1.9 Å6(1) 3NMR|1|B
1575NR_3.0_71379.1
Exact match
3RC8|1|E (3RC8)
  • RNA fragment
  • X-ray diffraction
  • Release Date: 2011-05-11
2.9 Å6(1) 3RC8|1|E
1576NR_3.0_74924.21
Exact match
3PEY|1|B (3PEY)
  • 5'-R(*UP*UP*UP*UP*UP*U)-3', RNA (5'-R(*U[...]
  • X-ray diffraction
  • Release Date: 2011-03-23
1.4 Å6(32) 3PEY|1|B, 3PEW|1|B, 5ELX|1|B, 4ALP|1|E, 2HYI|1|F, 6G2K|1|R, 2HYI|1|L, 3EX7|1|J, 5SZE|1|C, 3EX7|1|F, 3O8C|1|C, 5BTE|1|D, 3PF5|1|R, 5BTE|1|C, 6WRE|1|D, 7SOW|1|B, 6I0U|1|B, 5ZSA|1|C, 5ZSA|1|D, 3O8R|1|C, 4Y91|1|O, 4Y91|1|N, 3PF5|1|S, 6PPN|1|A, 6PPN|1|I, 7ZNJ|1|E, 7ZNJ|1|J, 7ZNJ|1|O, 7ZNJ|1|e, 7ZNJ|1|j, 7ZNJ|1|o, 6M7D|1|B
1577NR_3.0_75304.1
Exact match
3AHU|1|X (3AHU)
  • 5'-R(*AP*GP*AP*GP*AP*G)-3'
  • X-ray diffraction
  • Release Date: 2011-07-13
2.2 Å6(1) 3AHU|1|X
1578NR_3.0_76177.1
Exact match
2GXB|1|E+2GXB|1|F (2GXB)
  • 5'-R(P*(DU)P*CP*GP*CP*GP*CP*G)-3'
  • X-ray diffraction
  • Release Date: 2007-05-01
2.3 Å6(1) 2GXB|1|E+2GXB|1|F
1579NR_3.0_76648.1
Exact match
1AV6|1|B (1AV6)
  • RNA (5'-R(*GP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 1998-02-25
2.8 Å6(1) 1AV6|1|B
1580NR_3.0_78175.1
Exact match
3ICE|1|G (3ICE)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*[...]
  • X-ray diffraction
  • Release Date: 2009-11-10
2.8 Å6(1) 3ICE|1|G
1581NR_3.0_79034.1
Exact match
Mycoplasma genitalium G37
7DOL|1|C (7DOL)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2021-03-17
2.0 Å6(1) 7DOL|1|C
1582NR_3.0_80904.1
Exact match
3FHT|1|C (3FHT)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-ray diffraction
  • Release Date: 2009-02-17
2.2 Å6(1) 3FHT|1|C
1583NR_3.0_81482.1
Exact match
Escherichia coli
6F3H|1|D (6F3H)
  • RNA (5'-R(P*CP*AP*CP*UP*GP*A)-3')
  • X-ray diffraction
  • Release Date: 2018-01-17
2.7 Å6(1) 6F3H|1|D
1584NR_3.0_81682.1
Exact match
synthetic construct
6PPV|1|H (6PPV)
  • RNA (5'-R(*AP*UP*UP*UP*UP*G)-3')
  • X-ray diffraction
  • Release Date: 2020-06-17
2.1 Å6(1) 6PPV|1|H
1585NR_3.0_81754.1
Exact match
synthetic construct
6LLB|1|C (6LLB)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2020-01-01
2.6 Å6(1) 6LLB|1|C
1586NR_3.0_83079.1
Exact match
2P7E|1|A (2P7E)
  • 5' substrate strand, pentameric fragment
  • X-ray diffraction
  • Release Date: 2007-05-22
2.1 Å6(2) 2P7E|1|A, 2P7D|1|A
1587NR_3.0_83261.1
Exact match
synthetic construct
7Z1O|1|R (7Z1O)
  • RNA
  • Electron microscopy
  • Release Date: 2022-08-31
2.7 Å6(2) 7Z1O|1|R, 7AE1|1|R
1588NR_3.0_84359.1
Exact match
3S14|1|R (3S14)
  • RNA (5'-R(*GP*AP*GP*AP*GP*G)-3')
  • X-ray diffraction
  • Release Date: 2011-08-10
2.9 Å6(1) 3S14|1|R
1589NR_3.0_86148.1
Exact match
Escherichia coli
5A0T|1|E (5A0T)
  • 5'-R(*CP*GP*CP*CP*UP)-3'
  • X-ray diffraction
  • Release Date: 2015-08-19
2.3 Å6(2) 5A0T|1|E, 5A0T|1|F
1590NR_3.0_87665.1
Exact match
synthetic construct
5D8T|1|A+5D8T|1|B (5D8T)
  • RNA oligonucleotide containing (S)-C5'-M[...]
  • X-ray diffraction
  • Release Date: 2016-06-29
1.2 Å6(15) 5D8T|1|A+5D8T|1|B, 6CY2|1|A+6CY2|1|B, 6CXZ|1|A+6CXZ|1|B, 5VR4|1|C+5VR4|1|D, 5VR4|1|A+5VR4|1|B, 6CY4|1|C+6CY4|1|D, 6CY4|1|A+6CY4|1|B, 6CY4|1|E+6CY4|1|F, 6CY4|1|G+6CY4|1|H, 5DER|1|A+5DER|1|B, 5DER|1|C+5DER|1|D, 6CY0|1|A+6CY0|1|B, 6CY0|1|C+6CY0|1|D, 6CY0|1|E+6CY0|1|F, 6CY0|1|G+6CY0|1|H
1591NR_3.0_92635.3
Exact match
synthetic construct
6L5N|1|C (6L5N)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*U)-3'), poly([...]
  • X-ray diffraction
  • Release Date: 2020-06-17
2.2 Å6(5) 6L5N|1|C, 8ENK|1|M, 5SUP|1|D, 5SUP|1|E, 5SUP|1|F
1592NR_3.0_94195.1
Exact match
synthetic construct
6XLW|1|B (6XLW)
  • DNA/RNA (5'-R(P*UP*UP*(UD)P*UP*U)-D(P*(B[...]
  • X-ray diffraction
  • Release Date: 2020-10-07
1.5 Å6(3) 6XLW|1|B, 6XLV|1|B, 6XLX|1|B
1593NR_3.0_03341.1
Exact match
4HOR|1|X (4HOR)
  • RNA (5'-R(*(CTP)P*CP*CP*CP*C)-3')
  • X-ray diffraction
  • Release Date: 2013-01-23
1.9 Å5(1) 4HOR|1|X
1594NR_3.0_08138.1
Exact match
Homo sapiens
5F0Q|1|C (5F0Q)
  • RNA (5'-R(P*GP*GP*CP*GP*GP*C)-3')
  • X-ray diffraction
  • Release Date: 2016-03-23
2.2 Å5(4) 5F0Q|1|C, 5F0Q|1|E, 5F0S|1|C, 5F0S|1|E
1595NR_3.0_08150.1
Exact match
1YVP|1|G (1YVP)
  • Y RNA sequence, first strand
  • X-ray diffraction
  • Release Date: 2005-06-07
2.2 Å5(1) 1YVP|1|G
1596NR_3.0_09580.1
Exact match
synthetic construct
5C0Y|1|C (5C0Y)
  • poly U RNA
  • X-ray diffraction
  • Release Date: 2015-08-05
2.1 Å5(1) 5C0Y|1|C
1597NR_3.0_09823.1
Exact match
Vaccinia virus GLV-1h68
7AOZ|1|P (7AOZ)
  • RNA (5'-R(P*AP*UP*AP*AP*A)-3')
  • Electron microscopy
  • Release Date: 2021-10-06
2.9 Å5(1) 7AOZ|1|P
1598NR_3.0_10469.1
Exact match
1P79|1|A (1P79)
  • 5'-R(*UP*GP*UP*GP*GP*U)-3'
  • X-ray diffraction
  • Release Date: 2003-11-04
1.1 Å5(1) 1P79|1|A
1599NR_3.0_11258.1
Exact match
2XGJ|1|C (2XGJ)
  • RNA (5'-(*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2010-06-23
2.9 Å5(1) 2XGJ|1|C
1600NR_3.0_11290.1
Exact match
1N38|1|C+1N38|1|B (1N38)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3', 5'-R(P*GP*C)[...]
  • X-ray diffraction
  • Release Date: 2002-12-25
2.8 Å5(1) 1N38|1|C+1N38|1|B
1601NR_3.0_12819.1
Exact match
Mus musculus
2XS7|1|B (2XS7)
  • 5'-R(*UP*UP*GP*UP*UP*UP)-3'
  • X-ray diffraction
  • Release Date: 2011-10-05
1.5 Å5(1) 2XS7|1|B
1602NR_3.0_12865.1
Exact match
synthetic construct
5ZSE|1|C (5ZSE)
  • RNA (5'-R(*GP*UP*CP*CP*C)-3')
  • X-ray diffraction
  • Release Date: 2019-01-30
2.2 Å5(4) 5ZSE|1|C, 5ZSE|1|D, 5ZSM|1|D, 5ZSM|1|E
1603NR_3.0_14761.1
Exact match
synthetic construct
5WWX|1|C (5WWX)
  • RNA (5'-R(P*AP*GP*AP*GP*U)-3')
  • X-ray diffraction
  • Release Date: 2017-08-23
2.0 Å5(1) 5WWX|1|C
1604NR_3.0_17764.1
Exact match
4M7A|1|P (4M7A)
  • U6 snRNA
  • X-ray diffraction
  • Release Date: 2013-11-13
2.8 Å5(2) 4M7A|1|P, 4M7A|1|O
1605NR_3.0_17996.6
Exact match
synthetic construct
4J7L|1|B (4J7L)
  • RNA (5'-R(P*UP*UP*UP*UP*U)-3'), RNA (5'-[...]
  • X-ray diffraction
  • Release Date: 2013-03-27
1.8 Å5(11) 4J7L|1|B, 5W0M|1|J, 5BUD|1|E, 5W0M|1|I, 5W0M|1|H, 4J7M|1|B, 5BUD|1|D, 6A4E|1|B, 6A4E|1|D, 8ACB|1|B, 8ACC|1|B
1606NR_3.0_18600.1
Exact match
synthetic construct
6PPQ|1|H (6PPQ)
  • RNA (5'-R(*UP*UP*UP*UP*UP*A)-3')
  • X-ray diffraction
  • Release Date: 2020-06-17
1.8 Å5(1) 6PPQ|1|H
1607NR_3.0_23233.1
Exact match
2Q66|1|X (2Q66)
  • 5'-R(P*AP*AP*AP*AP*A)-3'
  • X-ray diffraction
  • Release Date: 2007-08-28
1.8 Å5(1) 2Q66|1|X
1608NR_3.0_23362.1
Exact match
synthetic construct
5EBI|1|F (5EBI)
  • DNA/RNA (5'-D(*C)-R(P*G)-D(P*C)-R(P*G)-D[...]
  • X-ray diffraction
  • Release Date: 2016-02-10
1.1 Å5(8) 5EBI|1|F, 5EBI|1|A, 5EBI|1|H, 5EBI|1|B, 5EBI|1|D, 5EBI|1|C, 5EBI|1|E, 5EBI|1|G
1609NR_3.0_24045.1
Exact match
Satellite tobacco mosaic virus
7M50|1|ll (7M50)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*U)-3[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.3 Å5(1) 7M50|1|ll
1610NR_3.0_24558.1
Exact match
Saccharomyces cerevisiae
2XNR|1|C (2XNR)
  • 5'-R(*UP*UP*CP*UP*UP*AP*UP*UP*CP*UP*UP*A[...]
  • X-ray diffraction
  • Release Date: 2010-09-08
1.6 Å5(1) 2XNR|1|C
1611NR_3.0_24908.1
Exact match
Homo sapiens
5GXI|1|B (5GXI)
  • RNA (5'-R(*A*AP*UP*UP*UP*UP*UP*GP*AP*G)-[...]
  • X-ray diffraction
  • Release Date: 2016-10-26
1.9 Å5(1) 5GXI|1|B
1612NR_3.0_27566.1
Exact match
synthetic construct
5WS2|1|D (5WS2)
  • RNA (5'-R(P*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2017-12-06
2.4 Å5(4) 5WS2|1|D, 5HAB|1|C, 5WS2|1|C, 5HAB|1|D
1613NR_3.0_28334.1
Exact match
1KNZ|1|W (1KNZ)
  • 5'-R(*UP*GP*AP*CP*C)-3'
  • X-ray diffraction
  • Release Date: 2002-01-17
2.5 Å5(4) 1KNZ|1|W, 1KNZ|1|X, 1KNZ|1|Z, 1KNZ|1|Y
1614NR_3.0_28661.1
Exact match
Saccharomyces cerevisiae
5K78|1|X (5K78)
  • branch 1 of branched RNA 5'-UACUAA(2'-GU[...]
  • X-ray diffraction
  • Release Date: 2016-12-07
2.6 Å5(1) 5K78|1|X
1615NR_3.0_28676.1
Exact match
Satellite tobacco mosaic virus
5BKL|1|i+5BKL|1|T (5BKL)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å5(1) 5BKL|1|i+5BKL|1|T
1616NR_3.0_30399.1
Exact match
Satellite tobacco mosaic virus
5BKL|1|a (5BKL)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.9 Å5(1) 5BKL|1|a
1617NR_3.0_35553.1
Exact match
3D2S|1|F (3D2S)
  • 5'-R(*CP*GP*CP*UP*GP*U)-3'
  • X-ray diffraction
  • Release Date: 2008-12-02
1.7 Å5(2) 3D2S|1|F, 3D2S|1|H
1618NR_3.0_35816.1
Exact match
3KMQ|1|B+3KMQ|1|C (3KMQ)
  • RNA (5'-R(P*GP*GP*GP*CP*C)-3'), RNA (5'-[...]
  • X-ray diffraction
  • Release Date: 2010-07-07
2.1 Å5(1) 3KMQ|1|B+3KMQ|1|C
1619NR_3.0_36229.1
Exact match
Homo sapiens
4XBF|1|D (4XBF)
  • RNA (5'-R(*UP*UP*AP*GP*G)-3')
  • X-ray diffraction
  • Release Date: 2016-04-27
2.8 Å5(1) 4XBF|1|D
1620NR_3.0_38180.1
Exact match
Zika virus
5MFX|1|B (5MFX)
  • RNA (5'-R(P*AP*GP*AP*CP*U)-3')
  • X-ray diffraction
  • Release Date: 2017-01-11
1.6 Å5(1) 5MFX|1|B
1621NR_3.0_40477.1
Exact match
synthetic construct
8ENK|1|N (8ENK)
  • RNA
  • X-ray diffraction
  • Release Date: 2023-08-16
2.5 Å5(1) 8ENK|1|N
1622NR_3.0_40750.1
Exact match
Mus musculus
5ELH|1|R (5ELH)
  • RNA (5'-R(*UP*UP*AP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2015-12-09
1.8 Å5(1) 5ELH|1|R
1623NR_3.0_42085.1
Exact match
4M7D|1|P (4M7D)
  • U6 snRNA
  • X-ray diffraction
  • Release Date: 2013-11-13
2.6 Å5(2) 4M7D|1|P, 4M7D|1|O
1624NR_3.0_42633.1
Exact match
Homo sapiens
3NNA|1|B (3NNA)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2010-10-27
1.9 Å5(1) 3NNA|1|B
1625NR_3.0_44600.1
Exact match
Mus musculus
2XS5|1|D (2XS5)
  • 5'-R(*UP*GP*UP*UP*CP)-3'
  • X-ray diffraction
  • Release Date: 2011-10-05
1.6 Å5(2) 2XS5|1|D, 2XS5|1|C
1626NR_3.0_45166.1
Exact match
Homo sapiens
5DET|1|Q (5DET)
  • RNA (5'-R(P*UP*CP*AP*CP*U)-3')
  • X-ray diffraction
  • Release Date: 2015-09-23
2.0 Å5(1) 5DET|1|Q
1627NR_3.0_45527.1
Exact match
4N2Q|1|B (4N2Q)
  • RNA (5'-R(*AP*AP*GP*AP*AP*GP*AP*AP*AP*UP[...]
  • X-ray diffraction
  • Release Date: 2013-10-30
2.8 Å5(1) 4N2Q|1|B
1628NR_3.0_45851.1
Exact match
1YTU|1|E+1YTU|1|F (1YTU)
  • 5'-R(P*AP*GP*AP*CP*AP*G)-3', 5'-R(P*UP*G[...]
  • X-ray diffraction
  • Release Date: 2005-04-05
2.5 Å5(2) 1YTU|1|E+1YTU|1|F, 1YTU|1|C+1YTU|1|D
1629NR_3.0_47295.1
Exact match
Drosophila melanogaster
6I0V|1|B (6I0V)
  • RNA (5'-R(*CP*AP*CP*AP*GP*U)-3')
  • X-ray diffraction
  • Release Date: 2018-12-05
1.9 Å5(1) 6I0V|1|B
1630NR_3.0_48507.1
Exact match
synthetic construct
5GJB|1|B (5GJB)
  • RNA (5'-R(*AP*GP*AP*UP*CP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2016-07-20
1.7 Å5(1) 5GJB|1|B
1631NR_3.0_48702.2
Exact match
Homo sapiens
6GC5|1|E (6GC5)
  • AU-rich RNA
  • X-ray diffraction
  • Release Date: 2019-01-30
1.9 Å5(3) 6GC5|1|E, 6GC5|1|F, 6GC5|1|H
1632NR_3.0_49650.1
Exact match
Homo sapiens
2VOP|1|B (2VOP)
  • 5'-R(*AP*UP*UP*UP*UP)-3'
  • X-ray diffraction
  • Release Date: 2008-05-06
2.8 Å5(1) 2VOP|1|B
1633NR_3.0_51587.2
Exact match
Satellite tobacco mosaic virus
5BKN|1|T+5BKN|1|i (5BKN)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*A)-3'), RNA ([...]
  • X-ray diffraction
  • Release Date: 2021-12-15
3.0 Å5(1) 5BKN|1|T+5BKN|1|i
1634NR_3.0_54899.2
Exact match
synthetic construct
6KQF|1|I (6KQF)
  • RNA (5'-R(*CP*UP*CP*GP*A)-3')
  • X-ray diffraction
  • Release Date: 2020-03-11
2.5 Å5(2) 6KQF|1|I, 6KON|1|I
1635NR_3.0_59443.1
Exact match
Satellite tobacco mosaic virus
7M50|1|i+7M50|1|T (7M50)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*U)-3[...]
  • X-ray diffraction
  • Release Date: 2021-12-15
2.3 Å5(1) 7M50|1|i+7M50|1|T
1636NR_3.0_59550.1
Exact match
Homo sapiens
7F3K|1|B (7F3K)
  • RNA (5'-R(*UP*CP*AP*UP*(5MC)P*U)-3')
  • X-ray diffraction
  • Release Date: 2022-06-22
1.8 Å5(1) 7F3K|1|B
1637NR_3.0_60255.1
Exact match
4LMZ|1|B (4LMZ)
  • RNA (5'-R(*GP*CP*UP*GP*CP*GP*UP*AP*UP*UP[...]
  • X-ray diffraction
  • Release Date: 2014-07-16
2.8 Å5(1) 4LMZ|1|B
1638NR_3.0_65417.1
Exact match
Drosophila melanogaster
6YRQ|1|E (6YRQ)
  • RNA (5'-D(*())-R(P*UP*UP*UP*())-3'), RNA[...]
  • X-ray diffraction
  • Release Date: 2020-10-14
1.9 Å5(6) 6YRQ|1|E, 6YRQ|1|H, 6YRQ|1|G, 6YRQ|1|F, 6YRB|1|C, 6YRB|1|D
1639NR_3.0_65501.1
Exact match
Bacteroides uniformis
7MJY|1|M (7MJY)
  • RNA (5'-R(P*UP*AP*UP*UP*C)-3')
  • X-ray diffraction
  • Release Date: 2021-09-15
1.9 Å5(1) 7MJY|1|M
1640NR_3.0_65762.1
Exact match
4Q5S|1|I (4Q5S)
  • RNA (5'-R(P*CP*UP*CP*AP*C)-3')
  • X-ray diffraction
  • Release Date: 2014-07-09
3.0 Å5(1) 4Q5S|1|I
1641NR_3.0_66381.1
Exact match
Escherichia coli
6H4N|1|I (6H4N)
  • RNA (5'-R(P*CP*UP*CP*CP*U)-3')
  • Electron microscopy
  • Release Date: 2018-09-05
3.0 Å5(1) 6H4N|1|I
1642NR_3.0_70523.1
Exact match
2R7V|1|X (2R7V)
  • RNA (5'-R(*G*GP*CP*UP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2008-07-29
2.8 Å5(1) 2R7V|1|X
1643NR_3.0_70871.1
Exact match
377D|1|A+377D|1|B (377D)
  • RNA-DNA (5'-R(*CP*GP*UP*AP*CP*DG)-3')
  • X-ray diffraction
  • Release Date: 1998-08-10
1.8 Å5(2) 377D|1|A+377D|1|B, 377D|1|C+377D|1|D
1644NR_3.0_74135.1
Exact match
2XGJ|1|D (2XGJ)
  • RNA (5'-(*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2010-06-23
2.9 Å5(1) 2XGJ|1|D
1645NR_3.0_77411.1
Exact match
chemical production metagenome
7V2Z|1|B (7V2Z)
  • RNA (5'-R(*AP*GP*AP*UP*C)-3')
  • X-ray diffraction
  • Release Date: 2022-08-17
2.1 Å5(1) 7V2Z|1|B
1646NR_3.0_81653.1
Exact match
1J6S|1|A (1J6S)
  • 5'-R(*(BRUP*GP*AP*GP*GP*U)-3'
  • X-ray diffraction
  • Release Date: 2003-08-05
1.4 Å5(4) 1J6S|1|A, 1J6S|1|C, 1J6S|1|D, 1J6S|1|B
1647NR_3.0_82140.1
Exact match
1MDG|1|A (1MDG)
  • 5'-R(*UP*(BGM)GP*AP*GP*GP*U)-3', RNA/DNA[...]
  • X-ray diffraction
  • Release Date: 2003-08-12
1.5 Å5(17) 1MDG|1|A, 1N7A|1|A, 1N7A|1|B, 1N7A|1|C, 1N7A|1|D, 1N7A|1|E, 1N7A|1|F, 1N7A|1|G, 1N7A|1|H, 1N7B|1|A, 1N7B|1|B, 1N7B|1|C, 1N7B|1|D, 1N7B|1|E, 1N7B|1|F, 1N7B|1|G, 1N7B|1|H
1648NR_3.0_84195.1
Exact match
synthetic construct
5ZSB|1|C (5ZSB)
  • RNA (5'-R(*AP*UP*UP*AP*A)-3'), RNA (5'-R[...]
  • X-ray diffraction
  • Release Date: 2019-01-30
2.7 Å5(4) 5ZSB|1|C, 5ZSB|1|D, 5ZSN|1|D, 5ZSN|1|E
1649NR_3.0_84537.1
Exact match
2AWE|1|D (2AWE)
  • 5'-R(*UP*(BGM)P*GP*UP*GP*U)-3'
  • X-ray diffraction
  • Release Date: 2006-02-07
2.1 Å5(8) 2AWE|1|D, 2AWE|1|G, 2AWE|1|E, 2AWE|1|A, 2AWE|1|B, 2AWE|1|C, 2AWE|1|F, 2AWE|1|H
1650NR_3.0_95409.1
Exact match
synthetic construct
1UVM|1|D (1UVM)
  • 5'-R(*UP*UP*UP*CP*CP)-3'
  • X-ray diffraction
  • Release Date: 2004-02-19
2.0 Å5(3) 1UVM|1|D, 1UVM|1|E, 1UVM|1|F
1651NR_3.0_96183.1
Exact match
Homo sapiens
7D58|1|T (7D58)
  • RNA
  • Electron microscopy
  • Release Date: 2021-02-17
2.9 Å5(1) 7D58|1|T
1652NR_3.0_96295.1
Exact match
3M7N|1|X (3M7N)
  • 5'-R(*C*UP*CP*CP*CP*C)-3', 5'-R(*CP*UP*C[...]
  • X-ray diffraction
  • Release Date: 2010-04-28
2.4 Å5(6) 3M7N|1|X, 3M7N|1|Z, 3M7N|1|Y, 3M85|1|X, 3M85|1|Z, 3M85|1|Y
1653NR_3.0_96572.1
Exact match
synthetic construct
1UVL|1|B (1UVL)
  • 5'-R(*UP*UP*UP*CP*CP)-3'
  • X-ray diffraction
  • Release Date: 2004-02-26
2.0 Å5(3) 1UVL|1|B, 1UVL|1|F, 1UVL|1|D
1654NR_3.0_98212.1
Exact match
synthetic construct
5ELR|1|B (5ELR)
  • RNA (5'-R(*AP*AP*UP*AP*AP*U)-3')
  • X-ray diffraction
  • Release Date: 2016-01-13
2.3 Å5(1) 5ELR|1|B
1655NR_3.0_01782.1
Exact match
synthetic construct
4WTI|1|T+4WTI|1|P (4WTI)
  • RNA TEMPLATE ACGG, RNA PRIMER CC
  • X-ray diffraction
  • Release Date: 2015-02-11
2.8 Å4(1) 4WTI|1|T+4WTI|1|P
1656NR_3.0_02089.1
Exact match
4G9Z|1|E+4G9Z|1|F (4G9Z)
  • RNA (5'-R(P*GP*CP*CP*C)-3'), RNA (5'-R(P[...]
  • X-ray diffraction
  • Release Date: 2013-04-03
2.0 Å4(1) 4G9Z|1|E+4G9Z|1|F
1657NR_3.0_03325.1
Exact match
synthetic construct
5ZUU|1|E+5ZUU|1|F (5ZUU)
  • RNA (5'-R(*(6MZ)P*CP*UP*AP*G)-3')
  • X-ray diffraction
  • Release Date: 2019-05-15
2.0 Å4(1) 5ZUU|1|E+5ZUU|1|F
1658NR_3.0_04798.1
Exact match
synthetic construct
8DZK|1|N (8DZK)
  • RNA (5'-R(P*(G46)P*UP*GP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2022-08-24
2.1 Å4(2) 8DZK|1|N, 8DZK|1|F
1659NR_3.0_05788.1
Exact match
Thermus thermophilus
6P71|1|I (6P71)
  • RNA (5'-R(P*AP*AP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2019-07-24
2.9 Å4(1) 6P71|1|I
1660NR_3.0_07579.1
Exact match
4OHZ|1|B (4OHZ)
  • RNA (5'-R(*GP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2014-05-14
2.4 Å4(1) 4OHZ|1|B
1661NR_3.0_08270.1
Exact match
synthetic construct
6U6Y|1|F (6U6Y)
  • RNA CGCCU
  • X-ray diffraction
  • Release Date: 2020-09-02
2.5 Å4(1) 6U6Y|1|F
1662NR_3.0_09020.1
Exact match
synthetic construct
5ELT|1|F (5ELT)
  • RNA (5'-R(P*UP*AP*AP*U)-3')
  • X-ray diffraction
  • Release Date: 2016-01-13
2.1 Å4(2) 5ELT|1|F, 5ELT|1|E
1663NR_3.0_11027.1
Exact match
synthetic construct
7YEX|1|B (7YEX)
  • RNA (5'-R(P*CP*AP*CP*AP*CP*AP*CP*A)-3')
  • X-ray diffraction
  • Release Date: 2023-07-12
2.0 Å4(1) 7YEX|1|B
1664NR_3.0_11028.1
Exact match
Saccharomyces
5O1Y|1|B (5O1Y)
  • RNA (5'-R(*GP*UP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2017-08-02
2.5 Å4(1) 5O1Y|1|B
1665NR_3.0_11762.2
Exact match
Severe acute respiratory syndrome-related coronavirus
7L6T|1|C (7L6T)
  • RNA (5'-D(*(M7G))-R(P*AP*UP*UP*A)-3'), R[...]
  • X-ray diffraction
  • Release Date: 2021-01-06
1.8 Å4(6) 7L6T|1|C, 7JYY|1|F, 7L6R|1|C, 7JYY|1|E, 7JZ0|1|F, 7JZ0|1|E
1666NR_3.0_11898.1
Exact match
synthetic construct
5ZSD|1|D (5ZSD)
  • RNA (5'-R(P*UP*UP*GP*A)-3')
  • X-ray diffraction
  • Release Date: 2019-01-30
2.6 Å4(2) 5ZSD|1|D, 5ZSL|1|E
1667NR_3.0_12473.1
Exact match
synthetic construct
7TUV|1|B (7TUV)
  • RNA (5'-R(P*GP*GP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2023-01-11
2.2 Å4(1) 7TUV|1|B
1668NR_3.0_16274.1
Exact match
4OAV|1|C (4OAV)
  • RNA (5'-R(P*(PO4)P*(PO4)P*AP*AP*AP*AP*(P[...]
  • X-ray diffraction
  • Release Date: 2014-03-12
2.1 Å4(1) 4OAV|1|C
1669NR_3.0_19332.1
Exact match
Saccharomyces cerevisiae
6R9P|1|B (6R9P)
  • AAUUAA RNA
  • X-ray diffraction
  • Release Date: 2019-05-22
3.0 Å4(1) 6R9P|1|B
1670NR_3.0_20856.1
Exact match
Mycobacterium tuberculosis
5HJZ|1|C (5HJZ)
  • RNA (5'-R(*CP*AP*UP*C)-D(P*U)-R(P*AP*CP*[...]
  • X-ray diffraction
  • Release Date: 2017-01-18
2.0 Å4(1) 5HJZ|1|C
1671NR_3.0_23205.3
Exact match
Alkalihalobacillus halodurans
6DO8|1|B (6DO8)
  • RNA (5'-R(*AP*CP*AP*U)-3'), 5'-R(*AP*CP*[...]
  • X-ray diffraction
  • Release Date: 2018-08-15
1.4 Å4(54) 6DO8|1|B, 6DP9|1|B, 6DOS|1|B, 6DPB|1|B, 6DPP|1|B, 6DPI|1|B, 6DOK|1|B, 6DOU|1|B, 6DOO|1|B, 6DPD|1|B, 6DOP|1|B, 6DO9|1|B, 6DMN|1|B, 6DPC|1|B, 6DOQ|1|B, 6DOT|1|B, 6DP4|1|B, 6DPL|1|B, 6DPN|1|B, 6DOM|1|B, 6DOG|1|B, 6DOX|1|B, 6DPH|1|B, 6DMV|1|B, 6DOJ|1|B, 6DOH|1|B, 6DP1|1|B, 6DP5|1|B, 6DPA|1|B, 6DPK|1|B, 6DP6|1|B, 6DOL|1|B, 6DOA|1|B, 6DPG|1|B, 6DOZ|1|B, 6DOB|1|B, 6DOV|1|B, 6DPO|1|B, 6DP7|1|B, 6DOF|1|B, 6DON|1|B, 6DOD|1|B, 6DOR|1|B, 6DOW|1|B, 6DPM|1|B, 6DPF|1|B, 6DP3|1|B, 6DPJ|1|B, 6DP2|1|B, 6DPE|1|B, 6DP0|1|B, 6DOC|1|B, 6DOI|1|B, 6DOE|1|B
1672NR_3.0_24351.1
Exact match
Arabidopsis thaliana
7XS4|1|B (7XS4)
  • RNA (5'-R(*AP*AP*AP*U)-3')
  • X-ray diffraction
  • Release Date: 2022-09-21
1.8 Å4(1) 7XS4|1|B
1673NR_3.0_25155.1
Exact match
Saccharomyces cerevisiae
5K78|1|Y (5K78)
  • branch 1 of branched RNA 5'-UACUAA(2'-GU[...]
  • X-ray diffraction
  • Release Date: 2016-12-07
2.6 Å4(1) 5K78|1|Y
1674NR_3.0_28980.1
Exact match
3P4C|1|B (3P4C)
  • 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ[...]
  • X-ray diffraction
  • Release Date: 2011-01-05
1.2 Å4(7) 3P4C|1|B, 3P4B|1|A, 3P4B|1|C, 3P4B|1|D, 3P4B|1|B, 3P4B|1|F, 3P4B|1|E
1675NR_3.0_29277.1
Exact match
4N2S|1|B (4N2S)
  • Zm1a-6 RNA
  • X-ray diffraction
  • Release Date: 2013-10-30
3.0 Å4(1) 4N2S|1|B
1676NR_3.0_30330.1
Exact match
Trypanosoma brucei
6U9X|1|H (6U9X)
  • RNA (5'-R(*GP*AP*GP*AP*GP*GP*GP*GP*GP*UP[...]
  • X-ray diffraction
  • Release Date: 2019-11-06
2.6 Å4(2) 6U9X|1|H, 6U9X|1|K
1677NR_3.0_31949.1
Exact match
synthetic construct
1UVN|1|F (1UVN)
  • 5'-R(*UP*UP*UP*UP*CP*CP)-3'
  • X-ray diffraction
  • Release Date: 2004-02-26
3.0 Å4(3) 1UVN|1|F, 1UVN|1|B, 1UVN|1|D
1678NR_3.0_32973.1
Exact match
synthetic construct
5YTS|1|B (5YTS)
  • RNA (5'-R(P*CP*UP*UP*C)-3')
  • X-ray diffraction
  • Release Date: 2018-12-05
1.8 Å4(1) 5YTS|1|B
1679NR_3.0_33685.1
Exact match
4E6B|1|E+4E6B|1|F (4E6B)
  • 5'-R(P*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*CP*[...]
  • X-ray diffraction
  • Release Date: 2012-07-11
1.5 Å4(1) 4E6B|1|E+4E6B|1|F
1680NR_3.0_35883.1
Exact match
3RZO|1|R (3RZO)
  • RNA (5'-R(*GP*AP*GP*G)-3')
  • X-ray diffraction
  • Release Date: 2011-08-10
3.0 Å4(1) 3RZO|1|R
1681NR_3.0_37135.1
Exact match
synthetic construct
5ZSC|1|D (5ZSC)
  • RNA (5'-R(P*UP*UP*CP*A)-3')
  • X-ray diffraction
  • Release Date: 2019-01-30
2.2 Å4(2) 5ZSC|1|D, 5ZSC|1|C
1682NR_3.0_37244.1
Exact match
synthetic construct
4R3I|0|B (4R3I)
  • RNA (5'-R(*GP*GP*(6MZ)P*CP*U)-3')
  • X-ray diffraction
  • Release Date: 2014-09-17
1.8 Å4(1) 4R3I|0|B
1683NR_3.0_38685.1
Exact match
Dengue virus
5DTO|1|B (5DTO)
  • RNA (5'-R(P*AP*GP*UP*U)-3')
  • X-ray diffraction
  • Release Date: 2015-11-25
2.6 Å4(1) 5DTO|1|B
1684NR_3.0_40400.1
Exact match
3QSU|1|P (3QSU)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2012-09-12
2.2 Å4(2) 3QSU|1|P, 3QSU|1|R
1685NR_3.0_40848.1
Exact match
synthetic construct
5ZSL|1|D (5ZSL)
  • RNA (5'-R(P*UP*UP*GP*A)-3')
  • X-ray diffraction
  • Release Date: 2019-01-30
2.3 Å4(2) 5ZSL|1|D, 5ZSD|1|C
1686NR_3.0_41171.1
Exact match
synthetic construct
7YEW|1|B (7YEW)
  • RNA (5'-R(P*CP*AP*CP*AP*CP*AP*C)-3')
  • X-ray diffraction
  • Release Date: 2023-07-12
2.5 Å4(2) 7YEW|1|B, 7YEW|1|D
1687NR_3.0_41208.1
Exact match
Homo sapiens
7F3J|1|B (7F3J)
  • RNA (5'-R(*UP*CP*AP*UP*(5MC))-3')
  • X-ray diffraction
  • Release Date: 2022-06-22
2.0 Å4(3) 7F3J|1|B, 7F3J|1|F, 7F3J|1|H
1688NR_3.0_41668.2
Exact match
4LJ0|1|C (4LJ0)
  • polyadenosine RNA, RNA (5'-R(P*AP*AP*AP*[...]
  • X-ray diffraction
  • Release Date: 2013-10-09
2.2 Å4(8) 4LJ0|1|C, 4LJ0|1|D, 4LJ0|1|E, 7M50|1|TT+7M50|1|kk, 5BKN|1|P, 5BKN|1|S+5BKN|1|h, 5BKN|1|a, 8CX0|1|K
1689NR_3.0_42542.1
Exact match
synthetic construct
7SOV|1|B (7SOV)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-ray diffraction
  • Release Date: 2022-08-03
1.5 Å4(1) 7SOV|1|B
1690NR_3.0_43515.1
Exact match
synthetic construct
6DP8|1|B (6DP8)
  • RNA (5'-R(*AP*CP*AP*U)-3')
  • X-ray diffraction
  • Release Date: 2018-08-15
1.3 Å4(1) 6DP8|1|B
1691NR_3.0_47084.1
Exact match
Escherichia coli
4QVC|1|G (4QVC)
  • RNA (5'-R(*AP*U*AP*AP*CP*UP*A)-3')
  • X-ray diffraction
  • Release Date: 2015-05-27
2.0 Å4(1) 4QVC|1|G
1692NR_3.0_49228.1
Exact match
4OAV|1|A (4OAV)
  • RNA (5'-R(P*(PO4)P*(PO4)P*AP*AP*AP*AP*(P[...]
  • X-ray diffraction
  • Release Date: 2014-03-12
2.1 Å4(1) 4OAV|1|A
1693NR_3.0_50754.1
Exact match
4E7A|1|P+4E7A|1|T (4E7A)
  • 5'-R(*CP*AP*UP*GP*GP*C)-D(P*(DOC))-3'
  • X-ray diffraction
  • Release Date: 2012-04-18
3.0 Å4(1) 4E7A|1|P+4E7A|1|T
1694NR_3.0_52691.1
Exact match
4E78|1|P+4E78|1|T (4E78)
  • 5'-R(*U*AP*CP*CP*GP*(GDO))-3'
  • X-ray diffraction
  • Release Date: 2012-04-18
2.9 Å4(1) 4E78|1|P+4E78|1|T
1695NR_3.0_53377.1
Exact match
Homo sapiens
7F3J|1|D (7F3J)
  • RNA (5'-R(*UP*CP*AP*UP*(5MC))-3')
  • X-ray diffraction
  • Release Date: 2022-06-22
2.0 Å4(1) 7F3J|1|D
1696NR_3.0_53426.1
Exact match
4E6B|1|A+4E6B|1|B (4E6B)
  • 5'-R(P*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*CP*[...]
  • X-ray diffraction
  • Release Date: 2012-07-11
1.5 Å4(1) 4E6B|1|A+4E6B|1|B
1697NR_3.0_58299.1
Exact match
2GRB|1|F (2GRB)
  • 5'-R(*(U33)P*GP*IP*GP*GP*U)-3'
  • X-ray diffraction
  • Release Date: 2006-11-21
1.4 Å4(8) 2GRB|1|F, 2GRB|1|A, 2GRB|1|C, 2GRB|1|B, 2GRB|1|E, 2GRB|1|H, 2GRB|1|G, 2GRB|1|D
1698NR_3.0_59019.1
Exact match
synthetic construct
7Y7T|1|D (7Y7T)
  • RNA (5'-R(P*AP*AP*AP*G)-3')
  • X-ray diffraction
  • Release Date: 2022-09-28
2.5 Å4(1) 7Y7T|1|D
1699NR_3.0_61884.1
Exact match
synthetic construct
4WTK|1|T+4WTK|1|P (4WTK)
  • RNA TEMPLATE AGCC, RNA PRIMER GG
  • X-ray diffraction
  • Release Date: 2015-02-11
2.5 Å4(1) 4WTK|1|T+4WTK|1|P
1700NR_3.0_62371.1
Exact match
synthetic construct
7SOP|1|B (7SOP)
  • RNA (5'-R(P*AP*AP*AP*UP*AP*A)-3')
  • X-ray diffraction
  • Release Date: 2022-08-03
1.6 Å4(1) 7SOP|1|B
1701NR_3.0_62764.1
Exact match
synthetic construct
5EV1|1|B (5EV1)
  • DNA/RNA (5'-R(*UP*UP*U)-D(P*UP*UP*(BRU)P[...]
  • X-ray diffraction
  • Release Date: 2016-02-24
2.0 Å4(1) 5EV1|1|B
1702NR_3.0_64918.15
Exact match
Saccharolobus solfataricus
7SOS|1|B (7SOS)
  • 5'-R(*AP*AP*AP*AP)-3', Cyclic RNA cA4, C[...]
  • X-ray diffraction
  • Release Date: 2022-08-03
1.3 Å4(37) 7SOS|1|B, 6SCE|1|B, 6XL1|1|C, 6SCF|1|I, 6SCF|1|K, 6YUD|1|K, 6YUD|1|O, 6SCF|1|M, 6YUD|1|P, 6SCF|1|L, 6YUD|1|M, 6YUD|1|Q, 6WXQ|1|E, 8BAO|1|C, 6W11|1|C, 6O6X|1|D, 4BA2|1|R, 7BDV|1|F, 8B0R|1|D, 7BDV|1|H, 6O6X|1|C, 7DID|1|C, 6O7B|1|C, 6O6V|1|C, 6WXX|1|Y, 6WXX|1|X, 6R9R|1|D, 6OV0|1|E, 7YGL|1|C, 6OV0|1|H, 6OV0|1|G, 6O6V|1|D, 6OV0|1|F, 6O7B|1|D, 6R9R|1|E, 7Z55|1|CCC, 6O7H|1|K
1703NR_3.0_65220.1
Exact match
Homo sapiens
6A6J|1|D (6A6J)
  • RNA (5'-R(P*CP*AP*UP*(5MC)P*U)-3'), RNA [...]
  • X-ray diffraction
  • Release Date: 2019-06-19
2.3 Å4(3) 6A6J|1|D, 6A6J|1|B, 6A6L|1|D
1704NR_3.0_65848.1
Exact match
Saccharomyces cerevisiae S288C
6NBJ|1|C (6NBJ)
  • RNA (5'-R(P*CP*CP*CP*C)-3')
  • X-ray diffraction
  • Release Date: 2023-04-26
2.9 Å4(1) 6NBJ|1|C
1705NR_3.0_67009.1
Exact match
synthetic construct
6U6Y|1|H (6U6Y)
  • RNA CGCCU
  • X-ray diffraction
  • Release Date: 2020-09-02
2.5 Å4(1) 6U6Y|1|H
1706NR_3.0_67557.1
Exact match
Drosophila melanogaster
6KR6|1|B (6KR6)
  • piRNA
  • X-ray diffraction
  • Release Date: 2020-02-19
2.9 Å4(1) 6KR6|1|B
1707NR_3.0_70063.1
Exact match
synthetic construct
4WTM|1|T+4WTM|1|P (4WTM)
  • RNA TEMPLATE UAGG, RNA PRIMER CC
  • X-ray diffraction
  • Release Date: 2015-02-11
2.2 Å4(1) 4WTM|1|T+4WTM|1|P