Exact match 2604; New id, no parents 8;

#Equivalence classRepresentativeResolutionNtsClass members
1NR_all_72859.1
Exact match
Drosophila melanogaster
4V6W|1|A5+4V6W|1|A8 (4V6W)
  • 28S ribosomal RNA, 5.8S ribosomal RNA, 2[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A5, A8; model(s): 1
6.0 Å3806(1) 4V6W|1|A5+4V6W|1|A8
2NR_all_65061.1
Exact match
Homo sapiens
6QZP|1|L5+6QZP|1|L8 (6QZP)
  • 28S rRNA (3773-MER), 5.8S rRNA (156-MER)[...]
  • ELECTRON MICROSCOPY
  • Chain(s): L5, L8; model(s): 1
2.9 Å3696(18) 6QZP|1|L5+6QZP|1|L8, 6EK0|1|L5+6EK0|1|L8, 6OLE|1|t+6OLE|1|D, 6OM0|1|t+6OM0|1|D, 6OLI|1|t+6OLI|1|D, 6OLG|1|A2+6OLG|1|A3, 5T2C|1|A+5T2C|1|C, 6OM7|1|t+6OM7|1|D, 4UG0|1|L5+4UG0|1|L8, 6OLF|1|t+6OLF|1|D, 6IP5|1|1A+6IP5|1|1C, 6IP8|1|1A+6IP8|1|1C, 6OLZ|1|A2+6OLZ|1|A3, 5AJ0|1|A2+5AJ0|1|A3, 5LKS|1|L5+5LKS|1|L8, 6IP6|1|1A+6IP6|1|1C, 4V6X|1|A5+4V6X|1|A8, 5A8L|1|A
3NR_all_26483.1
Exact match
Sus scrofa
3J7Q|1|5+3J7Q|1|8 (3J7Q)
  • 28S ribosomal RNA, 5.8S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5, 8; model(s): 1
3.4 Å3662(4) 3J7Q|1|5+3J7Q|1|8, 3J7O|1|5+3J7O|1|8, 3J7P|1|5+3J7P|1|8, 3J7R|1|5+3J7R|1|8
4NR_all_06650.9
Exact match
Oryctolagus cuniculus
6R5Q|1|5+6R5Q|1|8 (6R5Q)
  • 28S ribosomal RNA, 5.8S ribosomal RNA, 2[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 5, 8; model(s): 1
3.0 Å3543(48) 6R5Q|1|5+6R5Q|1|8, 6R6P|1|5+6R6P|1|8, 6D9J|1|5+6D9J|1|8, 1VWW|1|5+1VWW|1|8, 1VWY|1|5+1VWY|1|8, 3J71|1|5+3J71|1|8, 3J72|1|5+3J72|1|8, 5LZS|1|5+5LZS|1|8, 1VX3|1|5+1VX3|1|8, 3J74|1|5+3J74|1|8, 5LZV|1|5+5LZV|1|8, 6MTD|1|5+6MTD|1|8, 6D90|1|5+6D90|1|8, 6MTE|1|5+6MTE|1|8, 6MTC|1|5+6MTC|1|8, 6GZ5|1|A2+6GZ5|1|A3, 5LZZ|1|5+5LZZ|1|8, 5LZW|1|5+5LZW|1|8, 6GZ3|1|A2+6GZ3|1|A3, 5LZX|1|5+5LZX|1|8, 6GZ4|1|A2+6GZ4|1|A3, 5LZT|1|5+5LZT|1|8, 6MTB|1|5+6MTB|1|8, 1VX0|1|5+1VX0|1|8, 3J73|1|5+3J73|1|8, 6R6G|1|5+6R6G|1|8, 6HCJ|1|51+6HCJ|1|81, 5LZU|1|5+5LZU|1|8, 6FRK|1|5+6FRK|1|8, 6R7Q|1|5+6R7Q|1|8, 6HCF|1|52+6HCF|1|82, 5LZY|1|5+5LZY|1|8, 3JAH|1|5+3JAH|1|8, 6FTI|1|u+6FTI|1|w, 3JAG|1|5+3JAG|1|8, 3JAI|1|5+3JAI|1|8, 3J92|1|5+3J92|1|8, 6FTJ|1|u+6FTJ|1|w, 6HCQ|1|51+6HCQ|1|81, 6HCM|1|52+6HCM|1|82, 4UJE|1|A2+4UJE|1|A3, 6FTG|1|u+6FTG|1|w, 3JAN|1|5+3JAN|1|8, 3JAJ|1|5+3JAJ|1|8, 4UJD|1|A2+4UJD|1|A3, 4D5Y|1|2+4D5Y|1|3, 4D67|1|2+4D67|1|3, 4UJC|1|A2+4UJC|1|A3
5NR_all_66254.1
Exact match
Triticum aestivum
4V7E|1|Aa+4V7E|1|Ac (4V7E)
  • 60S ribosomal RNA, 5.8S ribosomal RNA, 2[...]
  • ELECTRON MICROSCOPY
  • Chain(s): Aa, Ac; model(s): 1
5.5 Å3391(2) 4V7E|1|Aa+4V7E|1|Ac, 3IZ9|1|A+3IZ9|1|B
6NR_all_91619.1
Exact match
Kluyveromyces lactis
4V91|1|1+4V91|1|4 (4V91)
  • 25S RRNA, 5.8S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1, 4; model(s): 1
3.7 Å3203(1) 4V91|1|1+4V91|1|4
7NR_all_95755.2
Exact match
Plasmodium falciparum
3J79|1|A+3J79|1|C (3J79)
  • 28S ribosomal RNA, 5.8S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A, C; model(s): 1
3.2 Å3191(5) 3J79|1|A+3J79|1|C, 5UMD|1|A+5UMD|1|C, 3JBN|1|AA+3JBN|1|AC, 3JBO|1|AA+3JBO|1|AC, 3JBP|1|AA+3JBP|1|AC
8NR_all_48954.1
Exact match
Thermomyces lanuginosus
4V7H|1|B5+4V7H|1|B4 (4V7H)
  • 26S ribosomal RNA, 5.8S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B4, B5; model(s): 1
8.9 Å3170(1) 4V7H|1|B5+4V7H|1|B4
9NR_all_90506.31
Exact match
Saccharomyces cerevisiae
5TBW|1|1+5TBW|1|4 (5TBW)
  • 25S ribosomal RNA, 5.8S ribosomal RNA, 2[...]
  • X-RAY DIFFRACTION
  • Chain(s): 1, 4; model(s): 1
3.0 Å3149(126) 5TBW|1|1+5TBW|1|4, 5TBW|1|AR+5TBW|1|AT, 4V88|1|A5+4V88|1|A8, 4V88|1|A1+4V88|1|A4, 5I4L|1|5+5I4L|1|8, 5I4L|1|1+5I4L|1|4, 5MEI|1|AR+5MEI|1|AT, 5MEI|1|1+5MEI|1|4, 6HHQ|1|AR+6HHQ|1|AT, 6HHQ|1|1+6HHQ|1|4, 5OBM|1|5+5OBM|1|8, 5OBM|1|1+5OBM|1|4, 5LYB|1|5+5LYB|1|8, 5NDV|1|1+5NDV|1|4, 5ON6|1|1+5ON6|1|4, 5LYB|1|1+5LYB|1|4, 5ON6|1|AR+5ON6|1|AT, 5NDV|1|5+5NDV|1|8, 5NDW|1|1+5NDW|1|4, 5NDW|1|5+5NDW|1|8, 5NDG|1|5+5NDG|1|8, 5NDG|1|1+5NDG|1|4, 5TGM|1|1+5TGM|1|4, 5TGM|1|5+5TGM|1|8, 4V7R|1|B1+4V7R|1|B3, 4V7R|1|D1+4V7R|1|D3, 5DAT|1|5+5DAT|1|8, 5DGV|1|5+5DGV|1|8, 5DAT|1|1+5DAT|1|4, 5DGV|1|1+5DGV|1|4, 5DGE|1|5+5DGE|1|8, 5TGA|1|5+5TGA|1|8, 5DGF|1|5+5DGF|1|8, 5TGA|1|1+5TGA|1|4, 5DGF|1|1+5DGF|1|4, 5DGE|1|1+5DGE|1|4, 5DC3|1|5+5DC3|1|8, 5DC3|1|1+5DC3|1|4, 4U4R|1|1+4U4R|1|4, 4U4R|1|5+4U4R|1|8, 4U3U|1|5+4U3U|1|8, 4U3U|1|1+4U3U|1|4, 4U3M|1|1+4U3M|1|4, 4U4Q|1|5+4U4Q|1|8, 4U3M|1|5+4U3M|1|8, 4U4U|1|1+4U4U|1|4, 4U4Q|1|1+4U4Q|1|4, 4U4U|1|5+4U4U|1|8, 4U52|1|5+4U52|1|8, 4U52|1|1+4U52|1|4, 6Q8Y|1|BQ+6Q8Y|1|BS, 5M1J|1|14+5M1J|1|44, 4U6F|1|1+4U6F|1|4, 4U6F|1|5+4U6F|1|8, 6QIK|1|A+6QIK|1|y, 4U4N|1|5+4U4N|1|8, 4U4Z|1|5+4U4Z|1|8, 4U4N|1|1+4U4N|1|4, 4U4Z|1|1+4U4Z|1|4, 6RZZ|1|A+6RZZ|1|y, 5T62|1|A+5T62|1|C, 4U3N|1|5+4U3N|1|8, 4U4Y|1|5+4U4Y|1|8, 4U3N|1|1+4U3N|1|4, 4U55|1|5+4U55|1|8, 6R87|1|1+6R87|1|4, 4U4Y|1|1+4U4Y|1|4, 3JCT|1|1+3JCT|1|2, 6S47|1|AA+6S47|1|AC, 4U51|1|5+4U51|1|8, 4U51|1|1+4U51|1|4, 4U55|1|1+4U55|1|4, 4U50|1|5+4U50|1|8, 4U50|1|1+4U50|1|4, 5H4P|1|1+5H4P|1|4, 6R86|1|1+6R86|1|4, 5JUP|1|B+5JUP|1|C, 6HD7|1|1+6HD7|1|4, 6RI5|1|A+6RI5|1|y, 6QT0|1|A+6QT0|1|y, 6N8M|1|A+6N8M|1|C, 6N8O|1|A+6N8O|1|C, 4U53|1|1+4U53|1|4, 4U53|1|5+4U53|1|8, 6R84|1|1+6R84|1|4, 6N8L|1|1+6N8L|1|3, 6N8K|1|1+6N8K|1|3, 5APO|1|5+5APO|1|8, 6QTZ|1|A+6QTZ|1|y, 6N8J|1|1+6N8J|1|3, 4U56|1|1+4U56|1|4, 4U56|1|5+4U56|1|8, 6N8N|1|A+6N8N|1|C, 5MC6|1|BQ+5MC6|1|BS, 6GQB|1|1+6GQB|1|4, 5JUU|1|B+5JUU|1|C, 5JUT|1|B+5JUT|1|C, 5JUO|1|B+5JUO|1|C, 6GQV|1|1+6GQV|1|4, 6S05|1|A+6S05|1|y, 5JUS|1|B+5JUS|1|C, 6FT6|1|1+6FT6|1|2, 6ELZ|1|1+6ELZ|1|2, 5T6R|1|A+5T6R|1|C, 5APN|1|5+5APN|1|8, 4U4O|1|5+4U4O|1|8, 4U4O|1|1+4U4O|1|4, 4V8Y|1|B5+4V8Y|1|B8, 6GQ1|1|1+6GQ1|1|4, 5GAK|1|1+5GAK|1|4, 6EM1|1|1+6EM1|1|2, 6I7O|1|BQ, 6I7O|1|YQ, 6C0F|1|1+6C0F|1|2, 3J6Y|1|2S+3J6Y|1|8S, 3J6X|1|2S+3J6X|1|8S, 3J77|1|2S+3J77|1|8S, 3J78|1|2S+3J78|1|8S, 4V8Z|1|B5+4V8Z|1|B8, 6CB1|1|1+6CB1|1|2, 5Z3G|1|A+5Z3G|1|B, 4V8T|1|5+4V8T|1|8, 4V7F|1|1, 4V6I|1|DA+4V6I|1|DB, 5JCS|1|x, 5FL8|1|x
10NR_all_13728.1
Exact match
Tetrahymena thermophila
4V8P|1|D1+4V8P|1|C2 (4V8P)
  • 26S RRNA, 5.8S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): C2, D1; model(s): 1
3.5 Å3119(4) 4V8P|1|D1+4V8P|1|C2, 4V8P|1|A1+4V8P|1|B2, 4V8P|1|F1+4V8P|1|E2, 4V8P|1|H1+4V8P|1|G2
11NR_all_76090.2
Exact match
Mycobacterium smegmatis
5O60|1|A (5O60)
  • 23S rRNA, tRNA CCA-end acetylated (Phe),[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.2 Å3119(7) 5O60|1|A, 5ZET|1|A, 6DZP|1|A, 6DZI|1|A, 5ZEB|1|A, 5XYM|1|A, 5ZEP|1|A
12NR_all_94031.1
Exact match
Mycobacterium tuberculosis
5V7Q|1|A (5V7Q)
  • 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.7 Å3118(2) 5V7Q|1|A, 5V93|1|A
13NR_all_75645.1
Exact match
Toxoplasma gondii
5XXB|1|1+5XXB|1|4 (5XXB)
  • 25S RNA, 5.8S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1, 4; model(s): 1
3.2 Å3077(1) 5XXB|1|1+5XXB|1|4
14NR_all_94544.1
Exact match
Pyrococcus furiosus
4V6U|1|B1 (4V6U)
  • 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B1; model(s): 1
6.6 Å3049(1) 4V6U|1|B1
15NR_all_11665.1
Exact match
Methanocaldococcus jannaschii
4V4N|1|A1 (4V4N)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A1; model(s): 1
9.0 Å2969(1) 4V4N|1|A1
16NR_all_59982.1
Exact match
Lactococcus lactis
5MYJ|1|BA (5MYJ)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): BA; model(s): 1
5.6 Å2897(1) 5MYJ|1|BA
17NR_all_68844.1
Exact match
Escherichia coli
1ML5|1|a (1ML5)
  • 50S 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
14.0 Å2889(1) 1ML5|1|a
18NR_all_41610.4
Exact match
Bacillus subtilis
6HA1|1|A (6HA1)
  • 23S ribosomal RNA, 23S rRNA, ribosome RN[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.1 Å2887(6) 6HA1|1|A, 6HA8|1|A, 5NJT|1|U, 3J9W|1|BA, 3J3W|1|A, 3J3V|1|A
19NR_all_83717.49
Exact match
Escherichia coli
5J7L|1|DA (5J7L)
  • 23S rRNA, 23S ribosomal RNA, 23S ribsoma[...]
  • X-RAY DIFFRACTION
  • Chain(s): DA; model(s): 1
3.0 Å2886(234) 5J7L|1|DA, 5J8A|1|DA, 5JC9|1|DA, 4YBB|1|DA, 5IT8|1|DA, 4WOI|1|BA, 4WOI|1|CA, 6I7V|1|DA, 5J91|1|DA, 4V9P|1|EA, 5J88|1|DA, 4V9P|1|CA, 4V9P|1|GA, 4V9P|1|AA, 4V9D|1|CA, 4V9O|1|AA, 4V9O|1|EA, 4WWW|1|RA, 4V9O|1|CA, 4V6C|1|BA, 5J7L|1|CA, 4V7T|1|BA, 4U27|1|BA, 4WF1|1|BA, 5J8A|1|CA, 5JC9|1|CA, 4V7U|1|BA, 4V7V|1|BA, 4V52|1|DB, 4U24|1|BA, 4U25|1|BA, 4V9D|1|DA, 4U26|1|BA, 4V7S|1|BA, 4V57|1|DB, 4V52|1|BB, 4V57|1|BB, 4V9O|1|GA, 4U1U|1|BA, 4V85|1|BA, 4V54|1|DB, 4V64|1|DB, 4V50|1|DB, 4V54|1|BB, 4V64|1|BB, 6BY1|1|CA, 4V53|1|DB, 4V50|1|BB, 4YBB|1|CA, 4U1V|1|BA, 5J88|1|CA, 4V53|1|BB, 4V9C|1|DA, 4V56|1|DB, 4U20|1|BA, 4V56|1|BB, 6I7V|1|CA, 6BY1|1|DA, 4U27|1|DA, 4V55|1|DB, 4V4Q|1|DB, 4V55|1|BB, 4V4Q|1|BB, 4V6D|1|BA, 4U25|1|DA, 4U1U|1|DA, 4V9C|1|BA, 4U1V|1|DA, 4V89|1|BA, 5IT8|1|CA, 4V6E|1|BA, 4WF1|1|DA, 4U24|1|DA, 4U26|1|DA, 4U20|1|DA, 4V6C|1|DA, 4V5Y|1|DB, 5J91|1|CA, 4WWW|1|YA, 4V7T|1|DA, 4V5Y|1|BB, 4V6D|1|DA, 4V7V|1|DA, 4V7S|1|DA, 4V7U|1|DA, 4V6E|1|DA, 4V5B|1|CB, 4V5B|1|AB, 5J5B|1|DA, 4V4H|1|DB, 4V4H|1|BB, 5J5B|1|CA, 6HRM|1|1, 5AFI|1|A, 5NWY|1|N, 5H5U|1|A, 6ORE|1|1, 5MDV|1|1, 6H4N|1|A, 5MDW|1|1, 5MGP|1|A, 5MDZ|1|1, 5U9G|1|01, 5U9F|1|01, 5UYM|1|01, 6ENU|1|A, 6QUL|1|A, 5WFS|1|A, 5WE4|1|A, 3JBV|1|b, 4V80|1|BA, 6C4I|1|A, 4V80|1|DA, 5WDT|1|A, 6ENF|1|A, 5GAE|1|A, 3JCE|1|A, 5MDY|1|1, 5LZD|1|A, 5WE6|1|A, 6I0Y|1|A, 6BU8|1|01, 5WFK|1|A, 5O2R|1|A, 5LZE|1|A, 5U4I|1|A, 5UYL|1|01, 5IQR|1|1, 6OSQ|1|1, 3JBU|1|b, 5LZA|1|A, 5KCR|1|1A, 5JU8|1|BA, 5JTE|1|BA, 6ORL|1|1, 6OSK|1|1, 3J9Z|1|LA, 6DNC|1|B, 3JCJ|1|A, 5WF0|1|A, 5UYQ|1|01, 6ENJ|1|A, 6Q9A|1|1, 5L3P|1|A, 5GAD|1|A, 6GC8|1|A, 5UYP|1|01, 5UYK|1|01, 6GWT|1|A, 6OUO|1|1, 5KPW|1|27, 6GXM|1|A, 5GAG|1|A, 5GAH|1|A, 6GBZ|1|A, 5KPS|1|28, 5UYN|1|01, 6GC0|1|A, 3J9Y|1|A, 6GXO|1|A, 6GXN|1|A, 6O9K|1|A, 6O9J|1|B, 5KPX|1|27, 3JCD|1|A, 4UY8|1|A, 5KCS|1|1A, 6OT3|1|1, 6Q97|1|1, 3J7Z|1|A, 5NP6|1|Y, 5KPV|1|27, 5GAF|1|A, 6GXP|1|A, 6Q98|1|1, 3JA1|1|LA, 3JCN|1|A, 6OST|1|1, 6GC4|1|A, 5LZF|1|A, 5LZC|1|A, 5NCO|1|A, 6GC6|1|A, 6C4H|1|A, 6GC7|1|A, 5LZB|1|A, 4CSU|1|B, 4V5H|1|BB, 5U4J|1|A, 3J8G|1|B, 4V69|1|BB, 5AKA|1|B, 4V6M|1|B8, 4V7B|1|BA, 5ADY|1|B, 3J5L|1|A, 4V7C|1|BA, 4V7D|1|AA, 6H58|1|AA, 6H58|1|A, 4V6K|1|AB, 4V7A|1|BA, 4V65|1|BB, 4V66|1|BB, 4V6T|1|BA, 2J28|1|B, 2RDO|1|B, 4V6V|1|BA, 4V6R|1|BB, 4V6Q|1|BB, 4V7I|1|A8, 4V48|1|A0, 4V75|1|BA, 4V6Z|1|BA, 4V6Y|1|BA, 3BBX|1|B, 4V6N|1|AB, 4V47|1|A0, 4V72|1|BA, 4V6S|1|AB, 4V6L|1|BB, 4V6P|1|BB, 4V6O|1|BB, 4V73|1|BA, 4V79|1|BA, 4V4W|1|B0, 4V4V|1|B0, 4V76|1|BA, 4V70|1|BA, 4V74|1|BA, 4V77|1|BA, 1C2W|1|B, 4V78|1|BA, 4V71|1|BA
20NR_all_62810.1
Exact match
Saccharomyces cerevisiae
4V4B|1|B3 (4V4B)
  • 5.8S/25S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B3; model(s): 1
11.7 Å2863(1) 4V4B|1|B3
21NR_all_97519.45
Exact match
Thermus thermophilus
4Y4O|1|2A (4Y4O)
  • 23S Ribosomal RNA, T23S rRNA, 23S rRNA, [...]
  • X-RAY DIFFRACTION
  • Chain(s): 2A; model(s): 1
2.3 Å2856(374) 4Y4O|1|2A, 4Y4O|1|1A, 5HCQ|1|2A, 4V9H|1|BA, 5FDU|1|1A, 5FDV|1|1A, 5HCQ|1|1A, 4V8I|1|BA, 5FDV|1|2A, 5FDU|1|2A, 4WPO|1|AA, 5IBB|1|1H, 5IB7|1|1H, 6CAE|1|1A, 5E81|1|1H, 4V8I|1|DA, 6CFL|1|1A, 4WQR|1|1H, 4WQ1|1|1H, 5IBB|1|14, 6CFL|1|2A, 4WSM|1|1H, 6CAE|1|2A, 4WQ1|1|14, 5DFE|1|YA, 4V95|1|BA, 5E81|1|14, 5IB7|1|14, 4WQR|1|14, 4WSM|1|14, 5DFE|1|RA, 5HCR|1|2A, 5IB8|1|1H, 6CFK|1|1A, 4WPO|1|CA, 5EL7|1|1H, 4Z8C|1|2A, 5NDK|1|1H, 4WSD|1|1H, 6CFJ|1|1A, 5W4K|1|1A, 5HCR|1|1A, 4V6G|1|DA, 6CFK|1|2A, 4WQU|1|AA, 5J4B|1|2A, 5IB8|1|14, 6QNR|1|1H, 5EL7|1|14, 4V8D|1|BA, 1VY4|1|DA, 6OF1|1|1A, 5J4B|1|1A, 5EL6|1|14, 4WSD|1|14, 5NDK|1|14, 5J8B|1|A, 5EL6|1|1H, 4V9R|1|BA, 5EL4|1|1H, 5HD1|1|2A, 4V6G|1|BA, 5WIS|1|1A, 1VY4|1|BA, 5J4C|1|2A, 4Z8C|1|1A, 4LNT|1|YA, 4WQF|1|AA, 4V9R|1|DA, 5J4C|1|1A, 4V95|1|DA, 4W2G|1|DA, 5HCP|1|2A, 4W2H|1|DA, 6QNQ|1|1H, 5HD1|1|1A, 4V8D|1|DA, 5HCP|1|1A, 4V9S|1|BA, 6QNR|1|14, 4W2G|1|BA, 4V8G|1|BA, 6FKR|1|1A, 5W4K|1|2A, 6OF1|1|2A, 4V8B|1|BA, 4V8G|1|DA, 4V9S|1|DA, 4V5F|1|DA, 6CFJ|1|2A, 4Z3S|1|1A, 6QNQ|1|14, 5EL4|1|14, 4Z3S|1|2A, 4V5J|1|DA, 4W2H|1|BA, 4W2I|1|BA, 6ND5|1|1A, 4W2I|1|DA, 4V8H|1|DA, 4WT1|1|1H, 4V8H|1|BA, 4V5F|1|BA, 5HAU|1|1A, 5HAU|1|2A, 6C5L|1|DA, 4WT8|1|C1, 6C5L|1|BA, 4V7M|1|BA, 4WR6|1|1H, 4WT1|1|14, 4LNT|1|RA, 4WRA|1|1H, 5WIS|1|2A, 5E7K|1|1H, 6FKR|1|2A, 4WT8|1|D1, 4W2F|1|DA, 6ND5|1|2A, 4WR6|1|14, 5EL5|1|1H, 4W4G|1|YA, 4WQU|1|CA, 4W4G|1|RA, 4WRA|1|14, 4V9B|1|DA, 4WQF|1|CA, 4W2F|1|BA, 4WU1|1|1H, 4V8B|1|DA, 6O97|1|1A, 1VY7|1|BA, 5EL5|1|14, 4WU1|1|14, 4Y4P|1|1A, 5E7K|1|14, 4Y4P|1|2A, 4WQY|1|AA, 4V9B|1|BA, 4ZER|1|1A, 1VY5|1|DA, 5WIT|1|1A, 1VY7|1|DA, 1VY5|1|BA, 5V8I|1|1A, 5DOY|1|2A, 4V5J|1|BA, 5DOY|1|1A, 5NDJ|1|1H, 4WZO|1|1H, 4V7J|1|AA, 4ZER|1|2A, 6O97|1|2A, 4V7J|1|BA, 5WIT|1|2A, 4V5R|1|BA, 4V5R|1|DA, 1VY6|1|DA, 4L47|1|YA, 6ND6|1|1A, 1VY6|1|BA, 5NDJ|1|14, 4WZO|1|14, 4YPB|1|YA, 4V8C|1|AA, 4V87|1|AA, 5V8I|1|2A, 4WQY|1|CA, 4YPB|1|RA, 4V8A|1|BA, 4V8C|1|BA, 4WRO|1|1H, 4V5E|1|BA, 4V5E|1|DA, 4V6F|1|DA, 4YZV|1|RA, 4WRO|1|14, 4V5S|1|BA, 4V5S|1|DA, 4V8F|1|AA, 4V90|1|BA, 6ND6|1|2A, 5VPO|1|YA, 6GSK|1|1H, 4YZV|1|YA, 4L47|1|RA, 4V8E|1|AA, 4V8Q|1|AA, 4V51|1|BA, 4TUA|1|YA, 4V87|1|DA, 4V5P|1|BA, 4V5C|1|BA, 4V7K|1|AA, 4V5Q|1|BA, 4V5D|1|BA, 4ZSN|1|RA, 4TUD|1|YA, 4V51|1|DA, 4ZSN|1|YA, 4V5K|1|BA, 4P6F|1|YA, 4V7K|1|BA, 4V8E|1|CA, 4V9A|1|DA, 5F8K|1|1A, 4V9A|1|BA, 4TUD|1|RA, 4V5P|1|DA, 4V83|1|DA, 4V8A|1|AA, 4TUC|1|YA, 4TUA|1|RA, 4W2E|1|A, 4TUE|1|YA, 4V5Q|1|DA, 6GSK|1|14, 4V9I|1|BA, 4V8F|1|DA, 4LSK|1|YA, 4V6F|1|AA, 4V5C|1|DA, 4V5K|1|DA, 4V83|1|BA, 4V7Y|1|BA, 4TUE|1|RA, 4V5D|1|DA, 4V97|1|DA, 4V7Y|1|DA, 4TUC|1|RA, 5F8K|1|2A, 4LT8|1|YA, 4V5L|1|BA, 4TUB|1|YA, 5VPO|1|RA, 4P6F|1|RA, 4TUB|1|RA, 4V9I|1|DA, 1VVJ|1|YA, 4V9K|1|BA, 4V9K|1|DA, 4V7L|1|BA, 4V7M|1|DA, 4LSK|1|RA, 4LT8|1|RA, 4V9Q|1|CA, 4V97|1|BA, 4V7X|1|BA, 5DOX|1|2A, 1VVJ|1|RA, 5CZP|1|RA, 6B4V|1|B, 4V84|1|DA, 5CZP|1|YA, 4V9Q|1|AA, 4V84|1|BA, 4V7X|1|DA, 5DOX|1|1A, 4V67|1|BA, 4L71|1|YA, 4LFZ|1|YA, 4V7L|1|DA, 4V7W|1|BA, 6N9E|1|2A, 4V7W|1|DA, 6CZR|1|1A, 6N9F|1|1A, 6N9E|1|1A, 6N1D|1|A23S, 4P70|1|YA, 6B4V|1|FB, 4V67|1|DA, 4XEJ|1|B23S, 6N1D|1|B23S, 6N9F|1|2A, 4LFZ|1|RA, 4L71|1|RA, 4P70|1|RA, 4XEJ|1|A23S, 6CZR|1|2A, 4V9L|1|BA, 4V7P|1|BA, 4V7P|1|CA, 4V9L|1|DA, 4V9M|1|BA, 4V63|1|DA, 4V9M|1|DA, 4V63|1|BA, 4LEL|1|YA, 5D8B|1|ZC, 4V7Z|1|BA, 5D8B|1|VC, 4LEL|1|RA, 4V7Z|1|DA, 4V8J|1|DA, 4V8J|1|BA, 4V5G|1|DA, 4V5G|1|BA, 4V4J|1|w, 4W29|1|BA, 4V5A|1|DA, 4V5A|1|BA, 4W29|1|DA, 4V4I|1|w, 4V8O|1|BA, 4V4Z|1|BA, 4V4X|1|BA, 4V4R|1|BA, 4V4Y|1|BA, 4V4S|1|BA, 4V4T|1|BA, 4V4P|1|AA, 6GSJ|1|1H, 6GSJ|1|14, 4V6A|1|BA, 4V8X|1|DA, 4V8N|1|BA, 4V8X|1|BA, 4V9N|1|DA, 4V6A|1|DA, 4V8N|1|DA, 4V9N|1|BA, 4V8U|1|BA, 4V8U|1|DA, 4V9J|1|BA, 4V9J|1|DA, 6GSL|1|1H, 6GSL|1|14, 6BOK|1|B, 6BOK|1|EB, 6BOH|1|GB, 6BOH|1|B, 5VPP|1|YA, 5VPP|1|RA, 5J3C|1|YA, 6OTR|1|RA, 5J3C|1|RA, 6OTR|1|YA, 6BZ6|1|RA, 6BZ6|1|YA, 5J30|1|RA, 5J30|1|YA, 6GZQ|1|A1, 6OXA|1|RA, 6OXA|1|YA, 2JL6|1|A, 2JL8|1|A, 6OXI|1|RA, 6OXI|1|YA, 5UQ8|1|A, 6BUW|1|YA, 6BUW|1|RA, 6NDK|1|RA, 6NDK|1|YA, 6BZ7|1|RA, 6BZ8|1|RA, 6BZ8|1|YA, 6BZ7|1|YA, 5OT7|1|4, 6Q95|1|1, 5UQ7|1|A, 5ZLU|1|V, 6GZZ|1|A2, 6GZZ|1|A1, 6GZX|1|A1, 6GZX|1|A2, 5IMQ|1|D, 4V68|1|BA, 4V42|1|BA, 4V5N|1|BA, 4V5M|1|BA, 5IMR|1|D, 5A9Z|1|AA, 5AA0|1|AA
22NR_all_48361.1
Exact match
Escherichia coli
4V49|1|B0 (4V49)
  • 23S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): B0; model(s): 1
8.7 Å2825(2) 4V49|1|B0, 4V4A|1|B0
23NR_all_26150.2
Exact match
Haloarcula marismortui
4V9F|1|0 (4V9F)
  • 23S Ribosomal RNA, 23S RRNA, RNA (5'-R(*[...]
  • X-RAY DIFFRACTION
  • Chain(s): 0; model(s): 1
2.4 Å2803(66) 4V9F|1|0, 1S72|1|0, 1JJ2|1|0, 1YI2|1|0, 3CCU|1|0, 3CCL|1|0, 1YHQ|1|0, 1YIJ|1|0, 3CMA|1|0, 3CCV|1|0, 3G6E|1|0, 3G71|1|0, 3CD6|1|0, 2QEX|1|0, 3CCM|1|0, 3I56|1|0, 2OTL|1|0, 3CCS|1|0, 1YJN|1|0, 1YJ9|1|0, 3CC4|1|0, 3CCQ|1|0, 1YIT|1|0, 3CC2|1|0, 1KQS|1|0, 2OTJ|1|0, 3CCR|1|0, 3CC7|1|0, 3G4S|1|0, 3I55|1|0, 2QA4|1|0, 3CCJ|1|0, 3CCE|1|0, 3OW2|1|0, 1VQO|1|0, 1VQ8|1|0, 1VQP|1|0, 1VQK|1|0, 1VQN|1|0, 1VQ9|1|0, 1VQ7|1|0, 1VQ4|1|0, 1VQ6|1|0, 3CPW|1|0, 3CME|1|0, 1M90|1|A, 3CXC|1|0, 1QVG|1|0, 1NJI|1|A, 1VQ5|1|0, 1KC8|1|A, 1K73|1|A, 1Q81|1|A, 1Q82|1|A, 1QVF|1|0, 1K9M|1|A, 1KD1|1|A, 1K8A|1|A, 1M1K|1|A, 1Q86|1|A, 1Q7Y|1|A, 1FFK|1|0, 1FG0|1|A, 1FFZ|1|A, 1N8R|1|A, 1W2B|1|0
24NR_all_90633.13
Exact match
Staphylococcus aureus
4WF9|1|X (4WF9)
  • 23S ribosomal RNA, 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.4 Å2712(24) 4WF9|1|X, 5HL7|1|X, 4WFA|1|X, 5HKV|1|X, 4WCE|1|X, 4WFB|1|X, 5NRG|1|X, 6S0Z|1|A, 6HMA|1|A, 6S0X|1|A, 5NGM|1|AA, 6DDG|1|1, 6DDD|1|1, 6S12|1|A, 5T7V|1|B, 5ND8|1|A, 5ND9|1|A, 5LI0|1|A, 5TCU|1|B, 6S13|1|A, 5NG8|1|BA, 6FXC|1|BA, 5NG8|1|AA, 6FXC|1|AA
25NR_all_08470.1
Exact match
Saccharomyces cerevisiae
5MRC|1|A (5MRC)
  • 21S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.3 Å2709(4) 5MRC|1|A, 3J6B|1|A, 5MRE|1|A, 5MRF|1|A
26NR_all_20305.5
Exact match
Spinacia oleracea
6ERI|1|AA (6ERI)
  • 23S ribosomal RNA, 23S rRNA, 23S ribosom[...]
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
3.0 Å2696(8) 6ERI|1|AA, 5MMI|1|A, 5X8T|1|A, 5MMM|1|A, 5X8P|1|A, 5MLC|1|A, 5H1S|1|A, 4V61|1|BA
27NR_all_27655.1
Exact match
Methanothermobacter thermautotrophicus
4ADX|1|0 (4ADX)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 0; model(s): 1
6.6 Å2688(1) 4ADX|1|0
28NR_all_88987.6
Exact match
Deinococcus radiodurans
4IOA|1|X (4IOA)
  • 23S ribosomal RNA, 23s RNA, RIBOSOMAL 23[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.2 Å2686(45) 4IOA|1|X, 4IO9|1|X, 5JVG|1|X, 5DM6|1|X, 5JVH|1|X, 4IOC|1|X, 4U67|1|X, 4WFN|1|X, 3PIO|1|X, 5DM7|1|X, 3PIP|1|X, 3DLL|1|X, 1OND|1|0, 2AAR|1|0, 1Y69|1|0, 3JQ4|1|A, 3FWO|1|A, 2ZJR|1|X, 3CF5|1|X, 2ZJQ|1|X, 2OGM|1|0, 2ZJP|1|X, 2OGO|1|0, 2OGN|1|0, 5DM8|1|X, 1JZX|1|A, 1NKW|1|0, 1NWY|1|0, 1NJP|1|0, 1NWX|1|0, 1J5A|1|A, 1JZY|1|A, 1K01|1|A, 1NJM|1|0, 1NJN|1|0, 1NJO|1|0, 1SM1|1|0, 1P9X|1|0, 1JZZ|1|A, 1Z58|1|2, 2D3O|1|0, 1XBP|1|0, 2O44|1|A, 2O43|1|A, 2O45|1|A
29NR_all_94750.1
Exact match
Trichomonas vaginalis
5XY3|1|1+5XY3|1|4 (5XY3)
  • 25S ribosomal RNA, 5.8S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1, 4; model(s): 1
3.2 Å2544(1) 5XY3|1|1+5XY3|1|4
30NR_all_19224.1
Exact match
Canis lupus
4V5Z|1|B0 (4V5Z)
  • 28S Ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B0; model(s): 1
8.7 Å2407(1) 4V5Z|1|B0
31NR_all_20129.1
Exact match
6RM3|1|L50 (6RM3)
  • 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): L50; model(s): 1
3.4 Å2313(1) 6RM3|1|L50
32NR_all_30265.1
Exact match
Trypanosoma brucei
4V8M|1|AA (4V8M)
  • 18S RRNA OF THE SMALL RIBOSOMAL SUBUNIT
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
5.6 Å2227(1) 4V8M|1|AA
33NR_all_11765.1
Exact match
Trypanosoma cruzi
5OPT|1|E (5OPT)
  • 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
4.0 Å2022(1) 5OPT|1|E
34NR_all_33000.1
Exact match
Drosophila melanogaster
4V6W|1|B2 (4V6W)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B2; model(s): 1
6.0 Å1957(1) 4V6W|1|B2
35NR_all_57180.1
Exact match
Trypanosoma brucei
4V8M|1|BA+4V8M|1|BC (4V8M)
  • ALPHA CHAIN OF THE LARGE RIBOSOMAL SUBUN[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BA, BC; model(s): 1
5.6 Å1847(1) 4V8M|1|BA+4V8M|1|BC
36NR_all_21280.7
Exact match
Oryctolagus cuniculus
4KZY|1|i (4KZY)
  • 18S Ribosomal RNA, 18S rRNA, 18S RRNA 2
  • X-RAY DIFFRACTION
  • Chain(s): i; model(s): 1
7.0 Å1840(44) 4KZY|1|i, 4KZZ|1|i, 4KZX|1|i, 6R5Q|1|K, 6R6P|1|K, 6D9J|1|2, 5LZS|1|9, 1VX5|1|2, 3J74|1|S2, 6MTD|1|9, 5LZV|1|9, 6D90|1|2, 6MTC|1|9, 6MTE|1|9, 6GZ5|1|B1, 5LZZ|1|9, 5LZW|1|9, 5LZX|1|9, 6GZ3|1|B1, 6GZ4|1|B1, 5LZT|1|9, 6MTB|1|9, 6HCJ|1|A2, 1VX2|1|2, 3J73|1|S2, 6R6G|1|K, 5LZU|1|9, 6HCF|1|A1, 6R7Q|1|K, 3JAH|1|9, 5LZY|1|9, 5FLX|1|1, 3JAG|1|9, 3JAI|1|9, 5K0Y|1|A, 6HCQ|1|A2, 6HCM|1|A1, 4UJE|1|B1, 3JAN|1|S2, 3JAJ|1|S2, 4UJD|1|C1, 4D61|1|1, 4D5L|1|1, 4UJC|1|C1
37NR_all_03510.25
Exact match
Saccharomyces cerevisiae
4V88|1|A6 (4V88)
  • 18S rRNA, 18S ribosomal RNA, Saccharomyc[...]
  • X-RAY DIFFRACTION
  • Chain(s): A6; model(s): 1
3.0 Å1770(102) 4V88|1|A6, 5TBW|1|sR, 4V88|1|A2, 5TBW|1|A, 6HHQ|1|sR, 5OBM|1|6, 5I4L|1|6, 5MEI|1|6, 5NDW|1|6, 5LYB|1|6, 5I4L|1|2, 5OBM|1|2, 5MEI|1|A, 5ON6|1|6, 5NDW|1|2, 6HHQ|1|A, 5LYB|1|2, 5NDV|1|6, 5NDV|1|2, 5ON6|1|A, 5NDG|1|6, 5NDG|1|2, 5TGM|1|6, 5TGM|1|2, 4V7R|1|A1, 4V7R|1|C1, 5DAT|1|6, 5TGA|1|6, 5DGE|1|6, 5DGV|1|6, 5DGF|1|6, 5DC3|1|6, 5DAT|1|2, 5TGA|1|2, 5DGV|1|2, 5DGE|1|2, 5DGF|1|2, 5DC3|1|2, 4U4R|1|6, 4U4R|1|2, 4U3U|1|6, 4U3U|1|2, 4U3M|1|6, 4U4Q|1|6, 4U4U|1|6, 4U52|1|6, 4U3M|1|2, 4U52|1|2, 4U4U|1|2, 4U6F|1|6, 4U4Q|1|2, 4U4N|1|6, 6Q8Y|1|2, 4U6F|1|2, 4U4Z|1|6, 4U4Y|1|6, 4U3N|1|6, 4U4Z|1|2, 4U55|1|6, 5M1J|1|22, 4U4N|1|2, 4U50|1|6, 4U51|1|6, 4U3N|1|2, 6S47|1|BA, 4U4Y|1|2, 4U51|1|2, 4U55|1|2, 6FAI|1|2, 4U50|1|2, 5JUP|1|A, 4U53|1|6, 6RBD|1|2, 4U53|1|2, 4U56|1|6, 4U56|1|2, 5MC6|1|2, 6EML|1|2, 5JUO|1|A, 6RBE|1|2, 5JUT|1|A, 5JUU|1|A, 6GQB|1|2, 5JUS|1|A, 6GQV|1|2, 4U4O|1|6, 4U4O|1|2, 4V8Y|1|B2, 6GQ1|1|2, 5LL6|1|2, 5WLC|1|L1+5WLC|1|L0+5WLC|1|L2, 6I7O|1|2b, 5WYK|1|SA+5WYK|1|5A+5WYK|1|3A, 6I7O|1|2, 3J6Y|1|1S, 3J6X|1|1S, 3J77|1|1S, 3J78|1|1S, 4V8Z|1|B2, 5TZS|1|1, 5WYJ|1|SA+5WYJ|1|5A+5WYJ|1|3A, 4V6I|1|CA
38NR_all_60605.1
Exact match
Lachancea kluyveri
4UER|1|A (4UER)
  • 18S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
6.5 Å1768(1) 4UER|1|A
39NR_all_72076.7
Exact match
Kluyveromyces lactis
6FYY|1|2 (6FYY)
  • 18S ribosomal RNA, 18S rRNA, 18S rRNA (1[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.0 Å1768(11) 6FYY|1|2, 6FYX|1|2, 3JAM|1|2, 3J80|1|2, 3J81|1|2, 5IT9|1|2, 6GSM|1|2, 4V92|1|A2, 3JAP|1|2, 6GSN|1|2, 3JAQ|1|2
40NR_all_35120.1
Exact match
Triticum aestivum
4V7E|1|Ad (4V7E)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): Ad; model(s): 1
5.5 Å1762(2) 4V7E|1|Ad, 3IZ7|1|A
41NR_all_56644.1
Exact match
Thermomyces lanuginosus
4V7H|1|AA (4V7H)
  • 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
8.9 Å1761(1) 4V7H|1|AA
42NR_all_80911.1
Exact match
Tetrahymena thermophila
4V5O|1|BA (4V5O)
  • 18S RRNA, 18S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): BA; model(s): 1
3.9 Å1745(6) 4V5O|1|BA, 4V5O|1|AA, 4BTS|1|AA, 4BTS|1|CA, 4BTS|1|DA, 4BTS|1|BA
43NR_all_46995.8
Exact match
Homo sapiens
5VYC|1|i2 (5VYC)
  • Human 18S ribosomal RNA, 18S rRNA (1740-[...]
  • X-RAY DIFFRACTION
  • Chain(s): i2; model(s): 1
6.0 Å1742(34) 5VYC|1|i2, 5VYC|1|i3, 5VYC|1|i5, 5VYC|1|i1, 5VYC|1|i6, 5VYC|1|i4, 6QZP|1|S2, 6EK0|1|S2, 6OM0|1|S2, 6OLE|1|S2, 6OLG|1|B1, 6OLI|1|S2, 6G18|1|2, 6G5I|1|2, 4UG0|1|S2, 6IP8|1|2m, 6IP5|1|2m, 6G5H|1|2, 6OM7|1|S2, 6OLZ|1|B1, 5AJ0|1|B1, 6OLF|1|S2, 5A2Q|1|2, 6G51|1|2, 6G4S|1|2, 6IP6|1|2m, 5OA3|1|2, 5LKS|1|S2, 6G53|1|2, 6G4W|1|2, 4V6X|1|B2, 5T2C|1|AA, 6FEC|1|A, 5A8L|1|B
44NR_all_61505.1
Exact match
Sus scrofa
3J7P|1|S2 (3J7P)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): S2; model(s): 1
3.5 Å1742(2) 3J7P|1|S2, 3J7R|1|S2
45NR_all_90416.1
Exact match
Leishmania donovani
6AZ1|1|1 (6AZ1)
  • ribosomal RNA 18S, 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
2.7 Å1724(3) 6AZ1|1|1, 5T2A|1|2, 5OSG|1|2
46NR_all_48721.1
Exact match
Toxoplasma gondii
5XXU|1|2 (5XXU)
  • 18S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.4 Å1619(1) 5XXU|1|2
47NR_all_07053.1
Exact match
Plasmodium falciparum
3JBN|1|A (3JBN)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
4.7 Å1608(3) 3JBN|1|A, 3JBO|1|A, 3JBP|1|A
48NR_all_45231.1
Exact match
Plasmodium falciparum
3J7A|1|A (3J7A)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.2 Å1608(2) 3J7A|1|A, 6OKK|1|A
49NR_all_36683.2
Exact match
Leishmania donovani
6AZ3|1|1+6AZ3|1|7 (6AZ3)
  • rRNA alpha, rRNA 5.8S, LSU-alpha, 5.8S r[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 1, 7; model(s): 1
2.5 Å1595(3) 6AZ3|1|1+6AZ3|1|7, 5T2A|1|A+5T2A|1|C, 3JCS|1|1+3JCS|1|7
50NR_all_59155.1
Exact match
Chaetomium thermophilum
6RXU|1|C1+6RXU|1|C2 (6RXU)
  • 35S rRNA, U3 snoRNA, 35S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): C1, C2; model(s): 1
3.5 Å1575(6) 6RXU|1|C1+6RXU|1|C2, 5OQL|1|1+5OQL|1|2, 6RXV|1|C1+6RXV|1|C2, 6RXZ|1|C1+6RXZ|1|C2, 6RXY|1|C1+6RXY|1|C2, 6RXT|1|C1+6RXT|1|C2
51NR_all_06715.4
Exact match
Sus scrofa
6GAW|1|BA (6GAW)
  • 16S ribosomal RNA, mitochondrial, MITORI[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BA; model(s): 1
3.2 Å1549(5) 6GAW|1|BA, 6GB2|1|BA, 4V19|1|A, 5AJ4|1|BA, 4CE4|1|A
52NR_all_74023.3
Exact match
Staphylococcus aureus
6S0X|1|a (6S0X)
  • 16S ribosomal RNA, 16S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
2.4 Å1539(12) 6S0X|1|a, 5NGM|1|Aa, 6S13|1|a, 5ND8|1|a, 5ND9|1|a, 5LI0|1|a, 5T7V|1|A, 5TCU|1|A, 6FXC|1|Ba, 5NG8|1|Aa, 5NG8|1|Ba, 6FXC|1|Aa
53NR_all_88887.1
Exact match
Lactococcus lactis
5MYJ|1|AA (5MYJ)
  • 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
5.6 Å1535(1) 5MYJ|1|AA
54NR_all_94066.1
Exact match
Bacillus subtilis
6HA1|1|a (6HA1)
  • 16S ribosomal RNA, 16S rRNA, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
3.1 Å1533(4) 6HA1|1|a, 6HA8|1|a, 5NJT|1|A, 3J9W|1|AA
55NR_all_15400.1
Exact match
Escherichia coli
4V49|1|AA (4V49)
  • 16S RIBOSOMAL RNA, 30S 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): AA; model(s): 1
8.7 Å1527(3) 4V49|1|AA, 4V4A|1|AA, 1ML5|1|A
56NR_all_56726.45
Exact match
Escherichia coli
5J7L|1|AA (5J7L)
  • 16S rRNA, 16S ribosomal RNA, Messenger R[...]
  • X-RAY DIFFRACTION
  • Chain(s): AA; model(s): 1
3.0 Å1523(232) 5J7L|1|AA, 4YBB|1|AA, 5J8A|1|AA, 5JC9|1|AA, 4WOI|1|DA, 4WOI|1|AA, 5IT8|1|AA, 4V9P|1|FA, 4V9O|1|BA, 5J7L|1|BA, 4V9P|1|HA, 4V9P|1|DA, 4V9P|1|BA, 5J8A|1|BA, 4V9O|1|FA, 5J91|1|AA, 6I7V|1|AA, 4V6C|1|AA, 5JC9|1|BA, 4V52|1|CA, 4V9O|1|DA, 4V7T|1|AA, 4V57|1|CA, 4WWW|1|QA, 4V52|1|AA, 4V57|1|AA, 4U27|1|AA, 5J88|1|AA, 4V7V|1|AA, 4V54|1|CA, 4WF1|1|AA, 4YBB|1|BA, 4U1U|1|AA, 4V64|1|CA, 4U26|1|AA, 4V53|1|CA, 4V9D|1|AA, 6I7V|1|BA, 4U24|1|AA, 4V7S|1|AA, 4U25|1|AA, 5IT8|1|BA, 4V56|1|CA, 4V9D|1|BA, 4V54|1|AA, 4U27|1|CA, 4V64|1|AA, 4V53|1|AA, 4V56|1|AA, 4V7U|1|AA, 4V55|1|CA, 4V50|1|CA, 4V9O|1|HA, 4WWW|1|XA, 4V4Q|1|CA, 4U20|1|AA, 4V55|1|AA, 4U1U|1|CA, 4V50|1|AA, 4U1V|1|AA, 4U25|1|CA, 4V6C|1|CA, 6BY1|1|AA, 5J88|1|BA, 4V4Q|1|AA, 6BY1|1|BA, 4U26|1|CA, 4V85|1|AA, 5J91|1|BA, 4V7T|1|CA, 4WF1|1|CA, 4U24|1|CA, 4U1V|1|CA, 4V6D|1|AA, 4U20|1|CA, 4V89|1|AA, 4V7S|1|CA, 4V6D|1|CA, 4V7V|1|CA, 4V6E|1|AA, 4V5Y|1|CA, 4V9C|1|CA, 4V9C|1|AA, 4V5Y|1|AA, 4V7U|1|CA, 4V6E|1|CA, 4V5B|1|BA, 4V5B|1|DA, 5J5B|1|AA, 4V4H|1|CA, 4V4H|1|AA, 5J5B|1|BA, 5AFI|1|a, 5NWY|1|0, 3R8O|1|A, 3R8N|1|A, 6H4N|1|a, 6ORE|1|2, 5H5U|1|h, 5WDT|1|a, 5WFS|1|a, 5MDV|1|2, 5MGP|1|a, 6ENU|1|a, 5WE4|1|a, 6ENF|1|a, 5U9G|1|A, 5U9F|1|A, 3JCE|1|a, 5UYM|1|A, 5MDW|1|2, 5MDZ|1|2, 6C4I|1|a, 4V80|1|AA, 4V80|1|CA, 5O2R|1|a, 5WFK|1|a, 5LZD|1|a, 5WE6|1|a, 6BU8|1|A, 5LZE|1|a+5LZE|1|y+5LZE|1|v+5LZE|1|x, 5MDY|1|2, 5U4I|1|a, 5UYL|1|A, 5KCR|1|1a, 5IQR|1|2, 3JBV|1|A, 5WF0|1|a, 5LZA|1|a, 6OSQ|1|2, 5JTE|1|AA, 5JU8|1|AA, 3JCJ|1|g, 6ENJ|1|a, 3J9Z|1|SA, 3JCD|1|a, 5L3P|1|a, 6DNC|1|A, 6OSK|1|2, 6ORL|1|2, 5UYQ|1|A, 6GXM|1|a, 6GWT|1|a, 6Q9A|1|2, 6OUO|1|2, 5UYP|1|A, 6GXO|1|a, 6GXN|1|a, 5UYK|1|A, 6O9J|1|a, 5KPW|1|26, 3J9Y|1|a, 5KCS|1|1a, 5KPS|1|27, 5UYN|1|A, 6O9K|1|a, 5KPX|1|26, 6Q97|1|2, 3JBU|1|A, 6OT3|1|2, 5NP6|1|D, 6O7K|1|g, 5KPV|1|26, 3JA1|1|SA, 6GXP|1|a, 6NQB|1|A, 6OST|1|2, 6Q98|1|2, 3JCN|1|a, 5LZF|1|a, 5LZC|1|a, 5NO2|1|A, 5NO4|1|A, 5NO3|1|A, 5LZB|1|a, 4V5H|1|AA, 5U4J|1|a, 4V69|1|AA, 4V6M|1|AA, 4V7B|1|AA, 4V7C|1|AA, 4V7D|1|BA, 5MY1|1|A, 6H58|1|a, 6H58|1|aa, 6AWD|1|A, 4V6K|1|BA, 4V7A|1|AA, 4V65|1|A1, 4V66|1|A1, 4V6V|1|AA, 4V6T|1|AA, 4V7I|1|BA, 4V6R|1|AA, 4V6Q|1|AA, 4V48|1|BA, 4V6Y|1|AA, 4V75|1|AA, 4V6Z|1|AA, 4V6N|1|BA, 4V47|1|BA, 4V72|1|AA, 4V6S|1|BA, 4V6L|1|AA, 3J28|1|N, 4V6P|1|AA, 3J2A|1|N, 5ME1|1|A, 5ME0|1|A, 4ADV|1|A, 3J2B|1|N, 3J29|1|N, 4V6O|1|AA, 3J2C|1|N, 5UZ4|1|A, 4V73|1|AA, 4V79|1|AA, 4V4W|1|AA, 4V4V|1|AA, 3J2E|1|N, 4A2I|1|A, 4V77|1|AA, 4V74|1|AA, 4V70|1|AA, 4V76|1|AA, 3J2G|1|N, 3J2F|1|N, 3J2D|1|N, 3J2H|1|N, 2YKR|1|A, 4V78|1|AA, 4V71|1|AA
57NR_all_42860.1
Exact match
Mycobacterium tuberculosis
5V93|1|a (5V93)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
4.0 Å1519(1) 5V93|1|a
58NR_all_45673.1
Exact match
Mycobacterium smegmatis
5ZEB|1|a (5ZEB)
  • 16S rRNA, 16S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
3.4 Å1506(7) 5ZEB|1|a, 5ZEP|1|a, 6DZI|1|h, 5O5J|1|A, 5ZEU|1|a, 6DZK|1|A, 5XYU|1|A
59NR_all_67193.1
Exact match
Saccharomyces cerevisiae
5MRC|1|aa (5MRC)
  • 15S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): aa; model(s): 1
3.3 Å1501(3) 5MRC|1|aa, 5MRE|1|aa, 5MRF|1|aa
60NR_all_65795.50
Exact match
Thermus thermophilus
4LFB|1|A (4LFB)
  • 16S rRNA, 16S Ribosomal RNA rRNA, 5'-R(P[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å1498(491) 4LFB|1|A, 5WNV|1|A, 4DR6|1|A, 4LF8|1|A, 4LF7|1|A, 4X65|1|A, 5WNT|1|A, 4JI1|1|A, 4X64|1|A, 4DUY|1|A, 4DR2|1|A, 4LF9|1|A, 4Y4O|1|1a, 4LF6|1|A, 4LF4|1|A, 4Y4O|1|2a, 4DR5|1|A, 4KHP|1|A, 4V9H|1|AA, 4DV6|1|A, 4JI7|1|A, 5FDV|1|2a, 4X62|1|A, 5FDV|1|1a, 4DV7|1|A, 5FDU|1|2a, 5FDU|1|1a, 5WNU|1|A, 4DR3|1|A, 4JYA|1|A, 5HCQ|1|1a, 4JI3|1|A, 6CAE|1|1a, 5IBB|1|1G, 4JI6|1|A, 5WNP|1|A, 5IBB|1|13, 6CFL|1|1a, 4LFC|1|A, 5HCQ|1|2a, 4JI0|1|A, 4WQ1|1|13, 4WSM|1|13, 4WSM|1|1G, 4WQR|1|13, 5IB7|1|13, 6MPF|1|A, 5J4B|1|1a, 5E81|1|13, 4X66|1|A, 5EL7|1|13, 6CFK|1|1a, 5E81|1|1G, 6CFL|1|2a, 5EL7|1|1G, 4JI8|1|A, 4WQ1|1|1G, 6CAE|1|2a, 4DR1|1|A, 4WQR|1|1G, 5EL6|1|13, 4LFA|1|A, 5IB8|1|13, 4DV5|1|A, 5IB7|1|1G, 6CFJ|1|1a, 6OF1|1|1a, 6CFK|1|2a, 4DV0|1|A, 6MPI|1|A, 5J4C|1|1a, 5W4K|1|1a, 4DV3|1|A, 5EL6|1|1G, 5J4B|1|2a, 6QNR|1|13, 5DFE|1|XA, 5J8B|1|a, 4Z8C|1|1a, 6CAP|1|A, 5HCR|1|1a, 4DV4|1|A, 6QNR|1|1G, 4WSD|1|13, 5NDK|1|1G, 4Z8C|1|2a, 5WIS|1|1a, 6CAQ|1|A, 4V8I|1|AA, 5DFE|1|QA, 5IB8|1|1G, 2UXC|1|A, 5NDK|1|13, 6NY6|1|A, 4WPO|1|BA, 6OF1|1|2a, 4K0K|1|A, 1VY4|1|AA, 5EL4|1|13, 5HCR|1|2a, 6ND5|1|1a, 4V6G|1|CA, 4Z3S|1|1a, 4V5F|1|CA, 4JI2|1|A, 6CFJ|1|2a, 4WT8|1|Ab, 4LNT|1|XA, 4DR4|1|A, 4V8D|1|AA, 4V6G|1|AA, 5J4C|1|2a, 5EL4|1|1G, 6FKR|1|1a, 4JV5|1|A, 4NXN|1|A, 4W2I|1|AA, 5HD1|1|1a, 4DUZ|1|A, 4LNT|1|QA, 5HCP|1|1a, 4W2I|1|CA, 5W4K|1|2a, 6QNQ|1|13, 4LF5|1|A, 4W2G|1|AA, 4JI4|1|A, 4WPO|1|DA, 4V8D|1|CA, 4DV1|1|A, 6FKR|1|2a, 4V5R|1|AA, 6QNQ|1|1G, 6O97|1|1a, 4V5F|1|AA, 4Z3S|1|2a, 5E7K|1|13, 5IWA|1|A, 6MKN|1|A, 5EL5|1|13, 4WSD|1|1G, 5HCP|1|2a, 5HAU|1|1a, 4NXM|1|A, 4DV2|1|A, 4W2G|1|CA, 4GKK|1|A, 5E7K|1|1G, 4V5R|1|CA, 4WT8|1|Bb, 5HAU|1|2a, 5HD1|1|2a, 4W2H|1|AA, 6ND5|1|2a, 4V95|1|AA, 4WT1|1|13, 4V7M|1|AA, 4V8I|1|CA, 4W4G|1|XA, 4W2H|1|CA, 5WIS|1|2a, 4GKJ|1|A, 4V8B|1|AA, 4Y4P|1|1a, 5WIT|1|1a, 4JI5|1|A, 4W4G|1|QA, 4W2F|1|AA, 5DOY|1|1a, 1FJG|1|A, 5WNQ|1|A, 1VY4|1|CA, 5WNS|1|A, 4WRA|1|13, 4V9B|1|CA, 4WR6|1|13, 1IBL|1|A, 4V9B|1|AA, 4WRA|1|1G, 5DOY|1|2a, 4DR7|1|A, 4W2E|1|a, 6O97|1|2a, 6C5L|1|AA, 6C5L|1|CA, 4V8B|1|CA, 4V95|1|CA, 4V9S|1|AA, 4WU1|1|13, 1VY5|1|AA, 4WU1|1|1G, 4WR6|1|1G, 4V7J|1|Aa, 4YZV|1|XA, 4V9S|1|CA, 6DTI|1|A, 4WQU|1|BA, 4V7J|1|Ba, 4ZER|1|1a, 4V9R|1|CA, 4ZER|1|2a, 4WT1|1|1G, 5WIT|1|2a, 4V9R|1|AA, 5EL5|1|1G, 6ND6|1|1a, 4W2F|1|CA, 4WZO|1|1G, 1HNW|1|A, 4YPB|1|XA, 4V5J|1|CA, 4WZO|1|13, 4Y4P|1|2a, 4V5Q|1|AA, 4V5P|1|CA, 4V5S|1|AA, 1VY7|1|AA, 4ZSN|1|XA, 4YPB|1|QA, 4V5L|1|AA, 4YZV|1|QA, 4WQF|1|BA, 1VY6|1|AA, 4V5C|1|AA, 4V5P|1|AA, 4V5J|1|AA, 3OTO|1|A, 5NDJ|1|1G, 4WRO|1|13, 1XNR|1|A, 4V5S|1|CA, 4V6F|1|CA, 4ZSN|1|QA, 6ND6|1|2a, 5NDJ|1|13, 4L47|1|XA, 5V8I|1|1a, 1XMQ|1|A, 1VY5|1|CA, 4V6F|1|BA, 4V51|1|AA, 4V7M|1|CA, 4L47|1|QA, 4V8C|1|DA, 1HR0|1|A, 4V5Q|1|CA, 1VY6|1|CA, 1IBM|1|A, 4WQF|1|DA, 4V8C|1|CA, 4TUA|1|XA, 4V8Q|1|BA, 6CAO|1|A, 6GSK|1|1G, 4V5D|1|AA, 1HNZ|1|A, 4TUD|1|QA, 4V7K|1|Ba, 6GSK|1|13, 4TUA|1|QA, 4WQU|1|DA, 4V51|1|CA, 4V9A|1|AA, 6CAS|1|A, 6CAR|1|A, 1VY7|1|CA, 4V7K|1|Aa, 4V5K|1|AA, 4TUC|1|XA, 4V5E|1|CA, 2UXB|1|A, 5V8I|1|2a, 4WQY|1|BA, 4P6F|1|XA, 4TUD|1|XA, 4V5C|1|CA, 4WRO|1|1G, 4TUE|1|QA, 4V87|1|BA, 4V8E|1|DA, 1IBK|1|A, 4V5D|1|CA, 4TUE|1|XA, 1N32|1|A, 3T1H|1|A, 3T1Y|1|A, 4V87|1|CA, 5F8K|1|1a, 4V8E|1|BA, 4V5E|1|AA, 1XNQ|1|A, 4V90|1|AA, 4V8H|1|AA, 4P6F|1|QA, 4TUB|1|XA, 4V8F|1|CA, 4V9A|1|CA, 2HHH|1|A, 4LSK|1|XA, 4YY3|1|A, 4TUB|1|QA, 4V8H|1|CA, 4V83|1|AA, 4WQY|1|DA, 4V7L|1|AA, 5F8K|1|2a, 4V97|1|AA, 4V8F|1|BA, 4TUC|1|QA, 4V8G|1|CA, 4V9K|1|AA, 4V9K|1|CA, 4V97|1|CA, 4V9I|1|AA, 6N9F|1|2a, 6N9E|1|2a, 4LSK|1|QA, 5CZP|1|XA, 1VVJ|1|XA, 4LT8|1|QA, 4LT8|1|XA, 5CZP|1|QA, 4V9Q|1|BA, 4V7L|1|CA, 4V67|1|AA, 6N9F|1|1a, 4V9I|1|CA, 5VPO|1|XA, 4KVB|1|A, 6N9E|1|1a, 1VVJ|1|QA, 4OX9|1|A, 5VPO|1|QA, 4L71|1|XA, 6B4V|1|EB, 4LFZ|1|XA, 5WNR|1|A, 4V83|1|CA, 6B4V|1|A, 4P70|1|QA, 4V8A|1|DA, 1HNX|1|A, 6N1D|1|A16S, 4P70|1|XA, 4V8A|1|CA, 6N1D|1|B16S, 4L71|1|QA, 4LFZ|1|QA, 4V9Q|1|DA, 2UXD|1|A, 1N33|1|A, 4V67|1|CA, 4V8J|1|CA, 4XEJ|1|A16S, 4V8J|1|AA, 4XEJ|1|B16S, 4V7Y|1|CA, 4V9L|1|AA, 4V7Y|1|AA, 4V7P|1|AA, 4V7P|1|DA, 4V63|1|AA, 4V8G|1|AA, 4V9L|1|CA, 4V84|1|AA, 4LEL|1|XA, 5D8B|1|UC, 4V9M|1|AA, 5DOX|1|2a, 4V9M|1|CA, 4V5G|1|CA, 4V5G|1|AA, 4V63|1|CA, 4LEL|1|QA, 4V5K|1|CA, 5DOX|1|1a, 4V84|1|CA, 4V4J|1|y, 5D8B|1|YC, 4V7W|1|CA, 1XMO|1|A, 4V7X|1|CA, 4V7X|1|AA, 2E5L|1|A, 4V7W|1|AA, 4V7Z|1|AA, 4W29|1|AA, 4V7Z|1|CA, 4V5A|1|AA, 4W29|1|CA, 4V5A|1|CA, 2ZM6|1|A, 4V4I|1|y, 1N36|1|A, 4V8O|1|AA, 1N34|1|A, 4V4R|1|AA, 4V4T|1|AA, 4V4S|1|AA, 4V4X|1|AA, 4V4Z|1|AA, 4V4Y|1|AA, 4V4P|1|BA+4V4P|1|B1, 4B3M|1|A, 4B3T|1|A, 4B3R|1|A, 6GSJ|1|1G, 6GSJ|1|13, 4B3S|1|A, 5BR8|1|A, 1J5E|1|A, 4AQY|1|A, 4V8X|1|AA, 4V6A|1|CA, 4V6A|1|AA, 4V8U|1|AA, 4V8U|1|CA, 4V9N|1|AA, 4V8X|1|CA, 4V8N|1|AA, 4V8N|1|CA, 4V9J|1|AA, 4V9N|1|CA, 4V9J|1|CA, 6GSL|1|13, 6GSL|1|1G, 6BOK|1|DB, 6BOK|1|A, 6BOH|1|A, 6BOH|1|FB, 5VPP|1|QA, 5VPP|1|XA, 4BTC|1|A, 5J3C|1|XA, 5J3C|1|QA, 6OTR|1|QA, 6OTR|1|XA, 5UQ8|1|a+5UQ8|1|x, 6BZ6|1|XA, 6BZ6|1|QA, 5J30|1|XA, 6OXA|1|QA, 5J30|1|QA, 6OXA|1|XA, 1FKA|1|A, 2JL5|1|A, 2JL7|1|A, 5UQ7|1|a+5UQ7|1|x, 6OXI|1|XA, 6OXI|1|QA, 6GZQ|1|A2, 6BUW|1|XA, 6BUW|1|QA, 6NDK|1|XA, 1I94|1|A, 6BZ8|1|QA, 6BZ7|1|QA, 6BZ8|1|XA, 6BZ7|1|XA, 6NDK|1|QA, 5ZLU|1|G, 6Q95|1|2, 5OT7|1|1, 5LMN|1|A, 6GZZ|1|A3, 6GZZ|1|A4, 1I96|1|A, 1I95|1|A, 5LMQ|1|A, 5LMU|1|A, 5LMT|1|A, 6GZX|1|A3, 5LMO|1|A, 6GZX|1|A4, 2F4V|1|A, 5LMR|1|A, 5LMV|1|A, 5LMS|1|A, 5IMQ|1|A, 5LMP|1|A, 1I97|1|A, 4V68|1|AA, 1JGQ|1|A, 4V42|1|AA, 1JGO|1|A, 5IMR|1|A, 4V5N|1|AA, 4V5M|1|AA, 1JGP|1|A, 5A9Z|1|BA, 5AA0|1|BA
61NR_all_71582.1
Exact match
Pyrococcus furiosus
4V6U|1|A2 (4V6U)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A2; model(s): 1
6.6 Å1495(1) 4V6U|1|A2
62NR_all_77936.1
Exact match
Methanocaldococcus jannaschii
4V4N|1|B2 (4V4N)
  • 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B2; model(s): 1
9.0 Å1495(1) 4V4N|1|B2
63NR_all_93395.1
Exact match
Pyrococcus abyssi
5JB3|1|2 (5JB3)
  • 16S ribosomal RNA, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
5.3 Å1495(2) 5JB3|1|2, 5JBH|1|2
64NR_all_67394.1
Exact match
Trichomonas vaginalis
5XYI|1|2 (5XYI)
  • 18S
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.4 Å1490(1) 5XYI|1|2
65NR_all_98268.1
Exact match
Thermus thermophilus
6CZR|1|1a (6CZR)
  • 16S Ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 1a; model(s): 1
3.1 Å1488(2) 6CZR|1|1a, 6CZR|1|2a
66NR_all_96354.4
Exact match
Spinacia oleracea
6ERI|1|BA (6ERI)
  • 16S ribosomal RNA, 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): BA; model(s): 1
3.0 Å1481(6) 6ERI|1|BA, 5MMM|1|a, 5X8P|1|a, 5MMJ|1|a, 5X8R|1|a, 4V61|1|AA
67NR_all_88364.1
Exact match
Saccharomyces cerevisiae
4V4B|1|AA (4V4B)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
11.7 Å1466(1) 4V4B|1|AA
68NR_all_58693.1
Exact match
Trypanosoma brucei
4V8M|1|BB (4V8M)
  • BETA CHAIN OF THE LARGE RIBOSOMAL SUBUNI[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BB; model(s): 1
5.6 Å1465(1) 4V8M|1|BB
69NR_all_51632.1
Exact match
Bos taurus
2FTC|1|R (2FTC)
  • Mitochondrial 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
12.1 Å1443(1) 2FTC|1|R
70NR_all_12763.2
Exact match
Homo sapiens
5OOL|1|A (5OOL)
  • 16S ribosomal RNA, 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.1 Å1441(6) 5OOL|1|A, 3J9M|1|A, 5OOM|1|A, 3J7Y|1|A, 6NU2|1|A, 6NU3|1|A
71NR_all_29022.1
Exact match
Canis lupus
4V5Z|1|AA (4V5Z)
  • 18S Ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
8.7 Å1391(1) 4V5Z|1|AA
72NR_all_25467.1
Exact match
Trypanosoma cruzi
5T5H|1|A+5T5H|1|C (5T5H)
  • RNA LARGE SUBUNIT ALPHA, 5.8S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A, C; model(s): 1
2.5 Å1246(1) 5T5H|1|A+5T5H|1|C
73NR_all_04427.1
Exact match
6RM3|1|S60 (6RM3)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): S60; model(s): 1
3.4 Å1231(1) 6RM3|1|S60
74NR_all_70280.1
Exact match
Chaetomium thermophilum
6RXX|1|C1+6RXX|1|C2 (6RXX)
  • 35S ribosomal RNA, U3 snoRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C1, C2; model(s): 1
7.1 Å1221(1) 6RXX|1|C1+6RXX|1|C2
75NR_all_15716.2
Exact match
Dictyostelium discoideum
6QKL|1|N (6QKL)
  • 26S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): N; model(s): 1
3.3 Å1158(4) 6QKL|1|N, 5AN9|1|N, 5ANB|1|N, 5ANC|1|N
76NR_all_29429.1
Exact match
Leishmania donovani
5T2A|1|B (5T2A)
  • LSU-beta
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
2.9 Å1064(1) 5T2A|1|B
77NR_all_60178.1
Exact match
Leishmania donovani
6AZ3|1|2 (6AZ3)
  • rRNA beta, 26S delta ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
2.5 Å1041(2) 6AZ3|1|2, 3JCS|1|2
78NR_all_51668.1
Exact match
Leishmania tarentolae
3IY9|1|A (3IY9)
  • Leishmania Tarentolae Mitochondrial Larg[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
14.1 Å1027(1) 3IY9|1|A
79NR_all_19551.3
Exact match
Sus scrofa
6GAZ|1|AA (6GAZ)
  • 12S ribosomal RNA, mitochondrial, MITORI[...]
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
3.1 Å960(4) 6GAZ|1|AA, 6GAW|1|AA, 5AJ3|1|A, 5AJ4|1|AA
80NR_all_79353.1
Exact match
Bos taurus
6NEQ|1|A (6NEQ)
  • 28S ribosomal RNA, mitochondrial, 28S ri[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.3 Å952(3) 6NEQ|1|A, 6NF8|1|A, 3JD5|1|A
81NR_all_01048.1
Exact match
Homo sapiens
3J9M|1|AA (3J9M)
  • 12S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
3.5 Å923(3) 3J9M|1|AA, 6NU2|1|AA, 6NU3|1|AA
82NR_all_97060.1
Exact match
Trypanosoma cruzi
5T5H|1|B (5T5H)
  • RNA LARGE SUBUNIT BETA, srRNA3
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
2.5 Å910(1) 5T5H|1|B
83NR_all_26758.1
Exact match
Chaetomium thermophilum
5JPQ|1|2 (5JPQ)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
7.3 Å852(1) 5JPQ|1|2
84NR_all_26496.1
Exact match
6ME0|1|A (6ME0)
  • T.el4h RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.6 Å829(2) 6ME0|1|A, 6MEC|1|A
85NR_all_28269.1
Exact match
Lactococcus lactis
5G2X|1|A (5G2X)
  • GROUP II INTRON, 5'-R(*CP*AP*CP*AP*UP*CP[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.8 Å692(2) 5G2X|1|A, 5G2Y|1|A
86NR_all_18903.1
Exact match
Pylaiella littoralis
6CHR|1|A (6CHR)
  • RNA (621-MER), RNA (5'-R(P*UP*GP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.7 Å621(3) 6CHR|1|A, 6CIH|1|A, 4R0D|1|A
87NR_all_60828.2
Exact match
Trypanosoma brucei
6HIW|1|CA (6HIW)
  • 9S rRNA, RNA (143-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): CA; model(s): 1
3.4 Å621(4) 6HIW|1|CA, 6HIY|1|CA, 6HIZ|1|CA, 6HIV|1|CA
88NR_all_42813.1
Exact match
Trypanosoma brucei
6HIX|1|AA (6HIX)
  • 12S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
3.4 Å591(2) 6HIX|1|AA, 6HIV|1|AA
89NR_all_44994.1
Exact match
Leishmania tarentolae
3IY8|1|A (3IY8)
  • Leishmania tarentolae mitochondrial smal[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
14.1 Å540(1) 3IY8|1|A
90NR_all_39823.2
Exact match
Saccharomyces cerevisiae
5ZWN|1|P (5ZWN)
  • U1 snRNA, pre-mRNA, RNA
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
3.4 Å480(3) 5ZWN|1|P, 6N7X|1|R, 5UZ5|1|R
91NR_all_11905.1
Exact match
Escherichia coli
3J2C|1|M (3J2C)
  • 16S rRNA head domain
  • ELECTRON MICROSCOPY
  • Chain(s): M; model(s): 1
13.2 Å462(1) 3J2C|1|M
92NR_all_72470.1
Exact match
Saccharomyces cerevisiae
6ND4|1|0+6ND4|1|2 (6ND4)
  • 5'ETS rRNA, U3 snoRNA, 18S rRNA 5' domai[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 0, 2; model(s): 1
4.3 Å398(1) 6ND4|1|0+6ND4|1|2
93NR_all_35054.3
Exact match
3IGI|1|A (3IGI)
  • Group IIC intron, 5'-R(*CP*GP*CP*UP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å389(26) 3IGI|1|A, 5J02|1|A, 4FAX|1|A, 4FAR|1|A, 4E8N|1|A, 4FAU|1|A, 4FB0|1|A, 4E8K|1|A, 4E8Q|1|A, 4Y1O|1|A, 4Y1O|1|B, 4E8P|1|A, 4E8T|1|A, 5J01|1|A, 4FAW|1|A, 3EOH|1|A, 4FAQ|1|A, 4E8R|1|A, 4Y1N|1|B, 3G78|1|A, 4E8M|1|A, 4Y1N|1|A, 4DS6|1|A, 3EOG|1|A, 3BWP|1|A, 4E8V|1|A
94NR_all_19166.1
Exact match
Mycobacterium smegmatis
5ZEY|1|A (5ZEY)
  • tmRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
12.5 Å369(1) 5ZEY|1|A
95NR_all_27991.1
Exact match
Saccharomyces cerevisiae
6AGB|1|A (6AGB)
  • Ribonuclease P RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.5 Å369(2) 6AGB|1|A, 6AH3|1|A
96NR_all_45472.4
Exact match
Escherichia coli
6Q9A|1|4 (6Q9A)
  • tmRNA, transfer-messenger RNA (tmRNA), M[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
3.7 Å363(5) 6Q9A|1|4, 6Q97|1|4, 6Q98|1|4, 3IZ4|1|A, 4V6T|1|AV
97NR_all_37170.1
Exact match
3Q1Q|1|B (3Q1Q)
  • RNase P RNA, RNA subunit of RNase P
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.8 Å347(5) 3Q1Q|1|B, 3Q1R|1|B, 2A2E|1|A, 3OK7|1|B, 3OKB|1|B
98NR_all_24457.1
Exact match
Homo sapiens
6AHU|1|A (6AHU)
  • H1 RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.7 Å341(2) 6AHU|1|A, 6AHR|1|A
99NR_all_10403.1
Exact match
Thermus thermophilus
2OB7|1|A (2OB7)
  • transfer-messenger RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
13.6 Å328(1) 2OB7|1|A
100NR_all_33231.2
Exact match
Thermus thermophilus
6Q95|1|4 (6Q95)
  • transfer-messenger RNA (tmRNA), tmRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
3.7 Å319(3) 6Q95|1|4, 3IYQ|1|A, 3IYR|1|A
101NR_all_94132.1
Exact match
Influenza A virus
4BBL|1|Y (4BBL)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): Y; model(s): 1
18.0 Å308(2) 4BBL|1|Y, 4BBL|1|Z
102NR_all_03631.1
Exact match
2A64|1|A (2A64)
  • ribonuclease P RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.3 Å298(1) 2A64|1|A
103NR_all_64405.1
Exact match
Saccharomyces cerevisiae
6G90|1|1 (6G90)
  • U1 snRNA,U1 snRNA,U1 snRNA,U1 snRNA,U1 s[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
4.0 Å291(1) 6G90|1|1
104NR_all_44609.1
Exact match
Haloarcula marismortui
2J37|1|Z (2J37)
  • RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): Z; model(s): 1
8.7 Å280(1) 2J37|1|Z
105NR_all_38440.1
Exact match
Bacillus subtilis
4UE4|1|A (4UE4)
  • 6S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
7.0 Å266(1) 4UE4|1|A
106NR_all_05236.1
Exact match
Bluetongue virus
1H1K|1|K+1H1K|1|N (1H1K)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): K, N; model(s): 1
10.0 Å265(3) 1H1K|1|K+1H1K|1|N, 1H1K|1|I+1H1K|1|L, 1H1K|1|J+1H1K|1|M
107NR_all_03097.4
Exact match
Hepatitis C virus
5FLX|1|z (5FLX)
  • HCV-IRES, HCV IRES, IRES mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): z; model(s): 1
3.9 Å264(5) 5FLX|1|z, 5A2Q|1|3, 5OA3|1|3, 4UJD|1|BC, 4UJC|1|AC
108NR_all_50448.1
Exact match
Canis lupus
6FRK|1|1 (6FRK)
  • Canis lupus familiaris RNA, 7SL, cytopla[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
3.7 Å258(2) 6FRK|1|1, 4UE5|1|A
109NR_all_52299.1
Exact match
Methanocaldococcus jannaschii
6K0B|1|X (6K0B)
  • RPR
  • ELECTRON MICROSCOPY
  • Chain(s): X; model(s): 1
4.3 Å258(4) 6K0B|1|X, 6K0B|1|Y, 6K0A|1|X, 6K0A|1|Y
110NR_all_14458.1
Exact match
Enterobacteria phage MS2
5TC1|1|R (5TC1)
  • phage MS2 genome
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.6 Å242(1) 5TC1|1|R
111NR_all_88088.1
Exact match
Staphylococcus phage Twort
2RKJ|1|C (2RKJ)
  • RNA (238-MER), RNA (5'-R(P*GP*CP*UP*U)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
4.5 Å238(5) 2RKJ|1|C, 2RKJ|1|O, 2RKJ|1|K, 2RKJ|1|G, 1Y0Q|1|A
112NR_all_09979.1
Exact match
Saccharomyces cerevisiae
3J16|1|J (3J16)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): J; model(s): 1
7.2 Å233(1) 3J16|1|J
113NR_all_64446.1
Exact match
4C4Q|1|N (4C4Q)
  • INTERNAL RIBOSOMAL ENTRY SITE
  • ELECTRON MICROSCOPY
  • Chain(s): N; model(s): 1
8.5 Å233(1) 4C4Q|1|N
114NR_all_82016.1
Exact match
3DHS|1|A (3DHS)
  • RNase P RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å215(1) 3DHS|1|A
115NR_all_35965.1
Exact match
Oryctolagus cuniculus
3JAN|1|4 (3JAN)
  • SRP 7S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
3.8 Å212(2) 3JAN|1|4, 3JAJ|1|4
116NR_all_79955.1
Exact match
Canis lupus
6R6G|1|AF (6R6G)
  • 7S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): AF; model(s): 1
3.7 Å212(1) 6R6G|1|AF
117NR_all_34334.1
Exact match
Trypanosoma brucei
4V8M|1|BE (4V8M)
  • SHORT RRNA-I OF THE LARGE RIBOSOMAL SUBU[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BE; model(s): 1
5.6 Å210(1) 4V8M|1|BE
118NR_all_99969.1
Exact match
Taura syndrome virus
5JUP|1|EC (5JUP)
  • IRES, TSV IRES mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): EC; model(s): 1
3.5 Å198(7) 5JUP|1|EC, 5JUU|1|EC, 5JUO|1|EC, 5JUT|1|EC, 5JUS|1|EC, 3J6X|1|IR, 3J6Y|1|IR
119NR_all_30944.4
Exact match
1U6B|1|B (1U6B)
  • 197-MER, 5'-R(*AP*AP*GP*CP*CP*AP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å195(4) 1U6B|1|B, 3BO2|1|B, 3BO3|1|B, 1ZZN|1|B
120NR_all_26802.1
Exact match
marine metagenome
4GMA|1|Z (4GMA)
  • Adenosylcobalamin riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
3.9 Å192(1) 4GMA|1|Z
121NR_all_87892.4
Exact match
Cricket paralysis virus
5IT9|1|i (5IT9)
  • Cricket paralysis virus IRES RNA, CrPV-I[...]
  • ELECTRON MICROSCOPY
  • Chain(s): i; model(s): 1
3.8 Å192(6) 5IT9|1|i, 6D90|1|4, 4D61|1|j, 6D9J|1|4, 4D5N|1|X, 2NOQ|1|A
122NR_all_57460.3
Exact match
Didymium iridis
4P95|1|A (4P95)
  • RNA (192-MER), Lariat-capping ribozyme, [...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å191(4) 4P95|1|A, 6GYV|1|A, 4P9R|1|A, 6G7Z|1|A+6G7Z|1|B
123NR_all_28848.1
Exact match
Cricket paralysis virus
4V92|1|AZ (4V92)
  • RNA OF CRICKET-PARALYSIS-VIRUS-IRES
  • ELECTRON MICROSCOPY
  • Chain(s): AZ; model(s): 1
3.7 Å190(1) 4V92|1|AZ
124NR_all_86266.1
Exact match
Didymium iridis
4P8Z|1|A (4P8Z)
  • Didymium iridis partial IGS, 18S rRNA ge[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.9 Å188(1) 4P8Z|1|A
125NR_all_33922.2
Exact match
4R4V|1|A (4R4V)
  • VS ribozyme RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å185(3) 4R4V|1|A, 5V3I|1|A, 4R4P|1|A
126NR_all_40535.1
Exact match
Leishmania donovani
3JCS|1|3 (3JCS)
  • 26S gamma ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
2.8 Å184(1) 3JCS|1|3
127NR_all_01258.2
Exact match
Leishmania donovani
6AZ3|1|4 (6AZ3)
  • rRNA delta, srRNA2, 26S delta ribosomal [...]
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
2.5 Å182(3) 6AZ3|1|4, 5T2A|1|G, 3JCS|1|4
128NR_all_78383.1
Exact match
Trypanosoma brucei
4V8M|1|BG (4V8M)
  • SHORT RRNA-III OF THE LARGE RIBOSOMAL SU[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BG; model(s): 1
5.6 Å182(1) 4V8M|1|BG
129NR_all_30457.11
Exact match
Saccharomyces cerevisiae
6J6G|1|D (6J6G)
  • U5 snRNA, ACT1 pre-mRNA, RNA (34-MER), 5[...]
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
3.2 Å179(21) 6J6G|1|D, 6BK8|1|5, 5GMK|1|D, 5Y88|1|B, 6EXN|1|5, 5YLZ|1|B, 6J6H|1|D, 5LJ3|1|U, 5ZWM|1|B, 5GAN|1|U, 5MPS|1|5, 6J6N|1|D, 6J6Q|1|D, 5WSG|1|D, 5MQ0|1|5, 5GAM|1|U, 5ZWO|1|B, 3JCM|1|F, 5LQW|1|5, 5NRL|1|5, 5LJ5|1|U
130NR_all_22273.1
Exact match
Leishmania donovani
6AZ3|1|3 (6AZ3)
  • rRNA gamma, srRNA1
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
2.5 Å176(2) 6AZ3|1|3, 5T2A|1|E
131NR_all_20384.1
Exact match
Escherichia coli
3J5S|1|A (3J5S)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
7.5 Å174(1) 3J5S|1|A
132NR_all_29848.1
Exact match
3DIL|1|A (3DIL)
  • RNA (174-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å173(12) 3DIL|1|A, 3DIX|1|A, 3DIR|1|A, 3DIY|1|A, 3DIQ|1|A, 3DIO|1|X, 3DIG|1|X, 3DJ2|1|A, 3DIZ|1|A, 3DIS|1|A, 3DIM|1|A, 3DJ0|1|A
133NR_all_36867.1
Exact match
Fusobacterium nucleatum
3P49|1|A (3P49)
  • GLYCINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å169(1) 3P49|1|A
134NR_all_16704.1
Exact match
Chaetomium thermophilum
5JPQ|1|3 (5JPQ)
  • U3 RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
7.3 Å164(1) 5JPQ|1|3
135NR_all_33460.2
Exact match
Homo sapiens
3PGW|1|R (3PGW)
  • U1 snRNA, AdML pre-mRNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.4 Å163(7) 3PGW|1|R, 3PGW|1|N, 3CW1|1|x, 3CW1|1|w, 3CW1|1|V, 3CW1|1|v, 6QX9|1|1
136NR_all_81584.1
Exact match
Homo sapiens
6IP8|1|zz (6IP8)
  • HCV-IRES RNA
  • ELECTRON MICROSCOPY
  • Chain(s): zz; model(s): 1
3.9 Å163(2) 6IP8|1|zz, 6IP6|1|zz
137NR_all_06891.1
Exact match
Human respiratory syncytial virus
4BKK|1|A (4BKK)
  • RNA (161-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
161(1) 4BKK|1|A
138NR_all_22479.1
Exact match
3D0U|1|A (3D0U)
  • Lysine Riboswitch RNA, RNA (161-MER), Ly[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å161(4) 3D0U|1|A, 3D0X|1|A, 4ERL|1|A, 4ERJ|1|A
139NR_all_36514.1
Exact match
4GXY|1|A (4GXY)
  • Adenosylcobalamin riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å161(1) 4GXY|1|A
140NR_all_47162.1
Exact match
Bacillus subtilis
3PDR|1|X (3PDR)
  • M-box Riboswitch RNA, M-Box RNA, ykoK ri[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.9 Å161(3) 3PDR|1|X, 3PDR|1|A, 2QBZ|1|X
141NR_all_64125.1
Exact match
Thermus thermophilus
1EMI|1|B (1EMI)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
7.5 Å161(1) 1EMI|1|B
142NR_all_39627.3
Exact match
2R8S|1|R (2R8S)
  • P4-P6 RNA RIBOZYME DOMAIN, Group I self-[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.0 Å159(23) 2R8S|1|R, 6D8O|1|A, 6D8O|1|B, 1HR2|1|B, 6BJX|1|A, 6BJX|1|B, 1HR2|1|A, 6D8M|1|B, 6D8M|1|A, 6D8L|1|A, 6D8L|1|B, 6D8N|1|B, 6D8N|1|A, 1X8W|1|A, 1X8W|1|D, 1X8W|1|B, 1X8W|1|C, 1L8V|1|B, 1L8V|1|A, 1GID|1|B, 1GID|1|A, 1GRZ|1|A, 1GRZ|1|B
143NR_all_61875.1
Exact match
Tetrahymena thermophila
6D6V|1|B (6D6V)
  • RNA (159-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
4.8 Å159(1) 6D6V|1|B
144NR_all_61239.1
Exact match
Saccharomyces cerevisiae
6I7O|1|BS (6I7O)
  • 5.8S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): BS; model(s): 1
5.3 Å157(5) 6I7O|1|BS, 6I7O|1|YS, 4V7F|1|2, 5FL8|1|y, 5JCS|1|y
145NR_all_20398.1
Exact match
Saccharomyces cerevisiae
3J16|1|K (3J16)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): K; model(s): 1
7.2 Å155(1) 3J16|1|K
146NR_all_72627.1
Exact match
1U9S|1|A (1U9S)
  • RIBONUCLEASE P
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å155(1) 1U9S|1|A
147NR_all_92729.1
Exact match
Human immunodeficiency virus 1
2N1Q|5|A (2N1Q)
  • RNA_(155-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
155(1) 2N1Q|5|A
148NR_all_17064.1
Exact match
Saccharomyces cerevisiae
3IZD|1|A (3IZD)
  • rRNA expansion segment ES27L in an 'out'[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
8.6 Å151(1) 3IZD|1|A
149NR_all_20339.1
Exact match
Bacillus subtilis
1NBS|1|B (1NBS)
  • RIBONUCLEASE P RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å150(2) 1NBS|1|B, 1NBS|1|A
150NR_all_90840.2
Exact match
Homo sapiens
4ZDO|1|E (4ZDO)
  • selenocysteine tRNA, tRNASec
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.7 Å150(7) 4ZDO|1|E, 3A3A|1|A, 4RQE|1|B, 4RQE|1|D, 4ZDP|1|E, 4RQF|1|C, 3HL2|1|E
151NR_all_26892.1
Exact match
Trypanosoma cruzi
5T5H|1|E (5T5H)
  • srRNA1
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
2.5 Å146(1) 5T5H|1|E
152NR_all_41448.1
Exact match
Escherichia coli
3J2C|1|O (3J2C)
  • 16S rRNA body domain
  • ELECTRON MICROSCOPY
  • Chain(s): O; model(s): 1
13.2 Å144(1) 3J2C|1|O
153NR_all_08692.2
Exact match
synthetic construct
3G9C|1|Q (3G9C)
  • GLMS RIBOZYME, RNA (5'-R(*GP*CP*GP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.9 Å140(28) 3G9C|1|Q, 2NZ4|1|Q, 3G9C|1|R, 2NZ4|1|R, 3G9C|1|S, 2NZ4|1|P, 3G96|1|R, 3G8S|1|Q, 2NZ4|1|S, 3G9C|1|P, 3G96|1|Q, 3G8S|1|R, 3L3C|1|Q, 3L3C|1|R, 3G96|1|P, 3G96|1|S, 3L3C|1|P, 3G8S|1|P, 3L3C|1|S, 3G8S|1|S, 3G8T|1|R, 3G8T|1|Q, 3G8T|1|P, 3G8T|1|S, 3G95|1|Q, 3G95|1|R, 3G95|1|S, 3G95|1|P
154NR_all_90613.1
Exact match
Saccharomyces cerevisiae
6G90|1|2 (6G90)
  • U2 snRNA, Yeast UBC4 pre-mRNA (mutant)
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
4.0 Å140(1) 6G90|1|2
155NR_all_08831.2
Exact match
Methanocaldococcus jannaschii
3NDB|1|M (3NDB)
  • SRP RNA, RNA, RNA (101-MER), 7S RNA, 7S.[...]
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.0 Å136(7) 3NDB|1|M, 4XCO|1|M, 4XCO|1|E, 1Z43|1|A, 2V3C|1|N, 2V3C|1|M, 1LNG|1|B
156NR_all_66484.2
Exact match
3HHN|1|E (3HHN)
  • Class I ligase ribozyme, self-ligation p[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å136(6) 3HHN|1|E, 3HHN|1|C, 3R1L|1|C, 3R1L|1|F, 3R1H|1|F, 3R1H|1|C
157NR_all_18056.1
Exact match
Trypanosoma brucei
4V8M|1|BH (4V8M)
  • SHORT RRNA-IV OF THE LARGE RIBOSOMAL SUB[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BH; model(s): 1
5.6 Å135(1) 4V8M|1|BH
158NR_all_20829.7
Exact match
Saccharomyces cerevisiae
6BK8|1|2+6BK8|1|6+6BK8|1|i (6BK8)
  • U2 snRNA, U6 snRNA, RNA (59-MER), ACT1 p[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 2, 6, i; model(s): 1
3.3 Å135(12) 6BK8|1|2+6BK8|1|6+6BK8|1|i, 6J6G|1|L+6J6G|1|E, 6EXN|1|2+6EXN|1|6, 5LJ3|1|Z+5LJ3|1|V, 5ZWM|1|H+5ZWM|1|I+5ZWM|1|F, 6J6H|1|L+6J6H|1|E, 5MQ0|1|2+5MQ0|1|6, 6J6N|1|L+6J6N|1|E, 6J6Q|1|L+6J6Q|1|E, 5ZWO|1|H+5ZWO|1|I+5ZWO|1|F, 5NRL|1|2+5NRL|1|4+5NRL|1|6, 5LJ5|1|Z+5LJ5|1|V
159NR_all_39109.1
Exact match
Oryctolagus cuniculus
4CXG|1|1 (4CXG)
  • 18S RRNA - H44
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
8.7 Å135(2) 4CXG|1|1, 4CXH|1|1
160NR_all_47156.1
Exact match
2IL9|1|A (2IL9)
  • Ribosomal Binding Domain of the IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å135(2) 2IL9|1|A, 2IL9|1|M
161NR_all_53105.1
Exact match
Pyrococcus horikoshii
4UYK|1|R (4UYK)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å133(3) 4UYK|1|R, 4UYJ|1|S, 4UYJ|1|R
162NR_all_96573.1
Exact match
Methanothermobacter thermautotrophicus
4ADX|1|8 (4ADX)
  • 23S Ribosomal RNA EXPANSION SEGMENTS
  • ELECTRON MICROSCOPY
  • Chain(s): 8; model(s): 1
6.6 Å133(1) 4ADX|1|8
163NR_all_58564.1
Exact match
3IVK|1|M (3IVK)
  • class I ligase product
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.1 Å130(2) 3IVK|1|M, 3IVK|1|C
164NR_all_67479.1
Exact match
Canis sp.
2J37|1|A (2J37)
  • SRP RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
8.7 Å128(2) 2J37|1|A, 2GO5|1|A
165NR_all_49785.2
Exact match
Homo sapiens
1MFQ|1|A (1MFQ)
  • 7S RNA of human SRP, Human gene for smal[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å127(8) 1MFQ|1|A, 5M73|1|A, 5M73|1|E, 4P3E|1|A, 3KTV|1|C, 3KTV|1|A, 1L9A|1|B, 1RY1|1|A
166NR_all_47433.1
Exact match
Caldanaerobacter subterraneus
3V7E|1|C (3V7E)
  • SAM-I riboswitch aptamer with an enginee[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å126(2) 3V7E|1|C, 3V7E|1|D
167NR_all_68863.1
Exact match
Methanocaldococcus jannaschii
4V4N|1|A3 (4V4N)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A3; model(s): 1
9.0 Å126(1) 4V4N|1|A3
168NR_all_83672.1
Exact match
Pyrococcus furiosus
4V6U|1|B3 (4V6U)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B3; model(s): 1
6.6 Å126(1) 4V6U|1|B3
169NR_all_67328.2
Exact match
Homo sapiens
6QW6|1|4 (6QW6)
  • U4 snRNA, U6 snRNA, U4snRNA, U2snRNA, U6[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
2.9 Å125(6) 6QW6|1|4, 6QX9|1|4, 6AHD|1|I+6AHD|1|H+6AHD|1|F, 5O9Z|1|4+5O9Z|1|2+5O9Z|1|6, 6AH0|1|I+6AH0|1|H+6AH0|1|F, 3JCR|1|M
170NR_all_78025.1
Exact match
Bamboo mosaic virus
5A2T|1|Z (5A2T)
  • BAMBOO MOSAIC VIRUS
  • ELECTRON MICROSCOPY
  • Chain(s): Z; model(s): 1
5.6 Å125(1) 5A2T|1|Z
171NR_all_07902.2
Exact match
Saccharomyces cerevisiae
5GAN|1|V+5GAN|1|W (5GAN)
  • U4 snRNA, U6 snRNA, SNR14 snRNA, SNR6 sn[...]
  • ELECTRON MICROSCOPY
  • Chain(s): V, W, i; model(s): 1
3.7 Å124(3) 5GAN|1|V+5GAN|1|W, 3JCM|1|E, 5GAO|1|V
172NR_all_35133.4
Exact match
Caldanaerobacter subterraneus
2Z75|1|B (2Z75)
  • glmS ribozyme RNA, glmS ribozyme product[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å123(13) 2Z75|1|B, 2GCV|1|B, 2Z74|1|B, 2H0X|1|B, 2H0W|1|B, 2GCS|1|B, 3B4B|1|B, 2HO6|1|B, 2HO7|1|B, 3B4A|1|B, 4MEG|1|B, 3B4C|1|B, 4MEH|1|B
173NR_all_68441.1
Exact match
Escherichia coli
1ML5|1|b (1ML5)
  • 50S 5S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): b; model(s): 1
14.0 Å123(1) 1ML5|1|b
174NR_all_17405.6
Exact match
Deinococcus radiodurans
4IOA|1|Y (4IOA)
  • 5S ribosomal RNA, 5s RNA, rRNA-5S riboso[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
3.2 Å122(25) 4IOA|1|Y, 4IO9|1|Y, 5JVG|1|Y, 5DM6|1|Y, 4IOC|1|Y, 5JVH|1|Y, 4U67|1|Y, 3PIO|1|Y, 4WFN|1|Y, 3PIP|1|Y, 5DM7|1|Y, 3DLL|1|Z, 3JQ4|1|B, 1Y69|1|9, 3FWO|1|B, 2ZJR|1|Y, 3CF5|1|Z, 2ZJQ|1|Y, 2ZJP|1|Z, 5DM8|1|Y, 1SM1|1|9, 1NKW|1|9, 1NWY|1|9, 1XBP|1|9, 1NWX|1|9
175NR_all_25303.2
Exact match
Haloarcula marismortui
4V9F|1|9 (4V9F)
  • 5S Ribosomal RNA, 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): 9; model(s): 1
2.4 Å122(64) 4V9F|1|9, 1S72|1|9, 1YI2|1|9, 1JJ2|1|9, 3CCL|1|9, 3CCU|1|9, 1YIJ|1|9, 3G71|1|9, 1YHQ|1|9, 3CMA|1|9, 3G6E|1|9, 3I56|1|9, 3CCV|1|9, 3CD6|1|9, 2QEX|1|9, 3CCM|1|9, 1YJ9|1|9, 3CC4|1|9, 1YJN|1|9, 2OTL|1|9, 1YIT|1|9, 3CC2|1|9, 3CCS|1|9, 2OTJ|1|9, 3CCQ|1|9, 1KQS|1|9, 3CC7|1|9, 3CCR|1|9, 3G4S|1|9, 3I55|1|9, 3CCJ|1|9, 2QA4|1|9, 3CCE|1|9, 3OW2|1|9, 1VQ8|1|9, 1VQO|1|9, 1VQK|1|9, 1VQ9|1|9, 1VQP|1|9, 1VQ7|1|9, 1VQN|1|9, 1VQ4|1|9, 1VQ6|1|9, 3CME|1|9, 1M90|1|B, 1QVG|1|9, 1VQ5|1|9, 1NJI|1|B, 3CXC|1|9, 3CPW|1|9, 1Q81|1|B, 1Q86|1|B, 1KC8|1|B, 1K73|1|B, 1Q82|1|B, 1K9M|1|B, 1QVF|1|9, 1M1K|1|B, 1KD1|1|B, 1K8A|1|B, 1Q7Y|1|B, 1FFK|1|9, 1N8R|1|B, 1W2B|1|9
176NR_all_67779.1
Exact match
Saccharomyces cerevisiae
4V4B|1|B4 (4V4B)
  • 5S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B4; model(s): 1
11.7 Å122(1) 4V4B|1|B4
177NR_all_18586.29
Exact match
Saccharomyces cerevisiae
5TBW|1|AS (5TBW)
  • 5S ribosomal RNA, 5S rRNA, 5.8s rRNA, RD[...]
  • X-RAY DIFFRACTION
  • Chain(s): AS; model(s): 1
3.0 Å121(121) 5TBW|1|AS, 5TBW|1|3, 4V88|1|A3, 4V88|1|A7, 5I4L|1|7, 6HHQ|1|AS, 5MEI|1|AS, 5MEI|1|3, 5OBM|1|7, 6HHQ|1|3, 5LYB|1|7, 5ON6|1|3, 5I4L|1|3, 5ON6|1|AS, 5LYB|1|3, 5OBM|1|3, 5NDW|1|7, 5NDW|1|3, 5NDV|1|7, 5NDV|1|3, 5NDG|1|7, 5NDG|1|3, 5TGM|1|7, 5TGM|1|3, 4V7R|1|B2, 4V7R|1|D2, 5DAT|1|7, 5DGV|1|7, 5DGF|1|7, 5DAT|1|3, 5DGE|1|7, 5DGV|1|3, 5TGA|1|7, 5DC3|1|7, 5DGE|1|3, 5DC3|1|3, 5TGA|1|3, 5DGF|1|3, 4U4R|1|3, 4U3U|1|7, 4U4R|1|7, 4U3U|1|3, 4U4Q|1|7, 4U4Q|1|3, 4U3M|1|7, 4U52|1|7, 4U3M|1|3, 6QIK|1|x, 4U4U|1|7, 6Q8Y|1|BR, 4U6F|1|7, 4U52|1|3, 4U4U|1|3, 6RZZ|1|x, 4U4N|1|7, 4U6F|1|3, 3JCT|1|3, 4U3N|1|3, 4U4Z|1|7, 4U4N|1|3, 6RI5|1|x, 6S47|1|AB, 4U4Z|1|3, 4U55|1|7, 4U50|1|3, 5T62|1|B, 5M1J|1|34, 4U50|1|7, 4U3N|1|7, 4U4Y|1|7, 4U4Y|1|3, 4U51|1|7, 6QT0|1|x, 4U55|1|3, 5H4P|1|3, 4U53|1|3, 5APO|1|7, 6QTZ|1|x, 6R86|1|3, 6N8M|1|B, 4U51|1|3, 4U53|1|7, 6N8O|1|B, 6N8J|1|2, 6R87|1|3, 6HD7|1|3, 5JUP|1|D, 6N8K|1|2, 6N8L|1|2, 4U56|1|7, 6R84|1|3, 4U56|1|3, 6N8N|1|B, 6S05|1|x, 6GQB|1|3, 5MC6|1|BR, 5JUT|1|D, 6FT6|1|3, 5JUO|1|D, 5JUU|1|D, 6GQV|1|3, 5APN|1|7, 4U4O|1|7, 5JUS|1|D, 5T6R|1|B, 4U4O|1|3, 4V8Y|1|B7, 5GAK|1|3, 6GQ1|1|3, 6I7O|1|YR, 6I7O|1|BR, 3J6Y|1|5S, 3J6X|1|5S, 3J77|1|5S, 3J78|1|5S, 4V8Z|1|B7, 4V8T|1|7, 4V7F|1|3, 5FL8|1|z, 5JCS|1|z, 4V6I|1|DC
178NR_all_21882.1
Exact match
Methanothermobacter thermautotrophicus
4ADX|1|9 (4ADX)
  • 5S Ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 9; model(s): 1
6.6 Å121(1) 4ADX|1|9
179NR_all_70730.1
Exact match
Kluyveromyces lactis
4V91|1|3 (4V91)
  • 5S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
3.7 Å121(1) 4V91|1|3
180NR_all_10157.49
Exact match
Escherichia coli
5J7L|1|DB (5J7L)
  • 5S rRNA, 5S ribosomal RNA, RNA (118-MER)[...]
  • X-RAY DIFFRACTION
  • Chain(s): DB; model(s): 1
3.0 Å120(230) 5J7L|1|DB, 5JC9|1|DB, 5J8A|1|DB, 4YBB|1|DB, 6I7V|1|DB, 4WOI|1|BB, 5IT8|1|DB, 5J91|1|DB, 4U27|1|BB, 5J88|1|DB, 4WF1|1|BB, 4WOI|1|CB, 4V9D|1|CB, 4V9P|1|CB, 4V9P|1|EB, 4U24|1|BB, 4V9O|1|AB, 4WWW|1|RB, 4U26|1|BB, 4V9P|1|GB, 4V7T|1|BB, 4V9O|1|CB, 4V6C|1|BB, 4U25|1|BB, 4V9O|1|EB, 4V9P|1|AB, 4U1U|1|BB, 4V7U|1|BB, 4U20|1|BB, 4V7V|1|BB, 4V9C|1|DB, 4U1V|1|BB, 4V52|1|BA, 5J7L|1|CB, 4V52|1|DA, 4V7S|1|BB, 5J8A|1|CB, 4V9D|1|DB, 4V50|1|DA, 5JC9|1|CB, 4V85|1|BB, 6BY1|1|CB, 6I7V|1|CB, 4V57|1|DA, 4V64|1|DA, 4V64|1|BA, 4V57|1|BA, 4V6D|1|BB, 4V54|1|BA, 4V54|1|DA, 4V53|1|BA, 4V53|1|DA, 4V6E|1|BB, 4V9O|1|GB, 4U27|1|DB, 4V56|1|DA, 4V55|1|BA, 4WF1|1|DB, 5J88|1|CB, 4U25|1|DB, 6BY1|1|DB, 4V4Q|1|BA, 4U1V|1|DB, 4V55|1|DA, 4V50|1|BA, 4V56|1|BA, 4V89|1|BB, 4V4Q|1|DA, 4YBB|1|CB, 4U26|1|DB, 4U1U|1|DB, 4V9C|1|BB, 4V7T|1|DB, 4U20|1|DB, 5IT8|1|CB, 4U24|1|DB, 4WWW|1|YB, 5J91|1|CB, 4V6C|1|DB, 4V5Y|1|BA, 4V6D|1|DB, 4V7V|1|DB, 4V5Y|1|DA, 4V7S|1|DB, 4V7U|1|DB, 4V6E|1|DB, 4V5B|1|CA, 4V5B|1|AA, 5J5B|1|DB, 4V4H|1|BA, 4V4H|1|DA, 5J5B|1|CB, 5AFI|1|B, 6ORE|1|3, 5NWY|1|O, 5MDV|1|3, 5H5U|1|B, 6HRM|1|3, 6H4N|1|B, 6QUL|1|B, 5WFS|1|B, 5MDZ|1|3, 6ENU|1|B, 5MDW|1|3, 5MGP|1|B, 6ENF|1|B, 5U9G|1|02, 5U9F|1|02, 5UYM|1|02, 6C4I|1|B, 5WDT|1|B, 5WE4|1|B, 4V80|1|BB, 4V80|1|DB, 3JBV|1|a, 5GAE|1|B, 6I0Y|1|B, 5MDY|1|3, 5WFK|1|B, 5LZD|1|B, 3JCE|1|B, 5O2R|1|B, 5LZE|1|B, 6BU8|1|02, 6OSQ|1|3, 5U4I|1|B, 6ORL|1|3, 5KCR|1|1B, 5LZA|1|B, 5UYL|1|02, 5WE6|1|B, 5IQR|1|3, 5WF0|1|B, 6ENJ|1|B, 3JBU|1|a, 5L3P|1|B, 5GAD|1|B, 6OSK|1|3, 3J9Z|1|LB, 6Q9A|1|3, 6DNC|1|C, 5JU8|1|BB, 5JTE|1|BB, 3JCJ|1|0, 5UYQ|1|02, 5GAH|1|B, 6GWT|1|B, 6GXM|1|B, 6GBZ|1|B, 6OUO|1|3, 6GC8|1|B, 5GAG|1|B, 5UYP|1|02, 6GC0|1|B, 3J9Y|1|B, 5KPW|1|28, 5UYK|1|02, 5KPX|1|28, 6GXO|1|B, 6GXN|1|B, 3JCD|1|B, 5KPS|1|29, 5KCS|1|1B, 5UYN|1|02, 6OT3|1|3, 6Q97|1|3, 4UY8|1|B, 5NP6|1|Z, 6O9J|1|A, 6O9K|1|X, 3J7Z|1|B, 5KPV|1|28, 3JA1|1|LB, 5GAF|1|B, 6GC4|1|B, 6OST|1|3, 6Q98|1|3, 6GXP|1|B, 5LZF|1|B, 3JCN|1|B, 5LZC|1|B, 5NCO|1|B, 5LZB|1|B, 4CSU|1|A, 5AKA|1|A, 3J8G|1|A, 4V5H|1|BA, 4V69|1|BA, 5ADY|1|A, 4V7B|1|BB, 4V6M|1|B7, 3J5L|1|B, 4V7D|1|AB, 4V7C|1|BB, 6H58|1|BB, 6H58|1|B, 4V6K|1|AA, 4V6T|1|BB, 4V7A|1|BB, 4V65|1|BA, 4V66|1|BA, 2RDO|1|A, 2J28|1|A, 4V6V|1|Ba, 3BBX|1|A, 4V6Q|1|BA, 4V6R|1|BA, 4V48|1|A9, 4V6Z|1|BB, 4V6Y|1|BB, 4V75|1|BB, 4V6N|1|AA, 4V7I|1|A7, 4V47|1|A9, 4V72|1|BB, 4V6S|1|AA, 4V6L|1|BA, 1C2X|1|C, 4V6P|1|BA, 4V6O|1|BA, 4V79|1|BB, 4V73|1|BB, 4V4W|1|B9, 4V4V|1|B9, 4V70|1|BB, 4V77|1|BB, 4V76|1|BB, 4V74|1|BB, 4V78|1|BB, 4V71|1|BB
181NR_all_10255.9
Exact match
Oryctolagus cuniculus
6R5Q|1|7 (6R5Q)
  • 5S rRNA, 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.0 Å120(48) 6R5Q|1|7, 6R6P|1|7, 6D9J|1|7, 5LZS|1|7, 5LZV|1|7, 6MTD|1|7, 1VWY|1|7, 1VWW|1|7, 3J71|1|7, 3J72|1|7, 6MTE|1|7, 1VX3|1|7, 3J74|1|7, 5LZZ|1|7, 6MTC|1|7, 5LZW|1|7, 6D90|1|7, 5LZT|1|7, 5LZX|1|7, 6GZ5|1|A4, 6MTB|1|7, 6GZ3|1|A4, 6FRK|1|7, 5LZU|1|7, 6R6G|1|7, 6GZ4|1|A4, 6HCJ|1|71, 3JAH|1|7, 6R7Q|1|7, 1VX0|1|7, 3J73|1|7, 3J92|1|7, 5LZY|1|7, 3JAG|1|7, 3JAI|1|7, 6HCF|1|72, 6FTI|1|v, 6FTJ|1|v, 6HCQ|1|71, 6HCM|1|72, 4UJE|1|A4, 3JAN|1|7, 3JAJ|1|7, 6FTG|1|v, 4UJD|1|A4, 4D5Y|1|4, 4D67|1|4, 4UJC|1|A4
182NR_all_28349.1
Exact match
Drosophila melanogaster
4V6W|1|A7 (4V6W)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A7; model(s): 1
6.0 Å120(1) 4V6W|1|A7
183NR_all_37098.1
Exact match
Triticum aestivum
4V7E|1|Ab (4V7E)
  • 5S ribosomal RNA, 5.8S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): Ab; model(s): 1
5.5 Å120(2) 4V7E|1|Ab, 3IZ9|1|C
184NR_all_42622.45
Exact match
Thermus thermophilus
5FDV|1|1B (5FDV)
  • 5S ribosomal RNA, 5S rRNA, 5S rRNA (119-[...]
  • X-RAY DIFFRACTION
  • Chain(s): 1B; model(s): 1
2.8 Å120(374) 5FDV|1|1B, 5FDU|1|1B, 4Y4O|1|1B, 4Y4O|1|2B, 5IBB|1|16, 5HCQ|1|1B, 4WPO|1|AB, 5E81|1|16, 5DFE|1|YB, 6CFL|1|1B, 6CAE|1|1B, 4WQR|1|16, 5FDV|1|2B, 5IB7|1|16, 4V8I|1|BB, 5FDU|1|2B, 5IBB|1|1J, 5IB8|1|16, 5W4K|1|1B, 5E81|1|1J, 4V95|1|BB, 5DFE|1|RB, 6CFK|1|1B, 4WQU|1|AB, 4WSM|1|16, 4WQ1|1|1J, 5NDK|1|16, 4WSD|1|16, 5HCR|1|1B, 5EL7|1|16, 4WSM|1|1J, 5NDK|1|1J, 4WQ1|1|16, 6OF1|1|1B, 5J4B|1|1B, 6QNR|1|16, 4LNT|1|YB, 6CFJ|1|1B, 4WQF|1|AB, 5IB7|1|1J, 5EL6|1|16, 4V8D|1|BB, 4V8G|1|BB, 4WT1|1|16, 4W2G|1|BB, 5J4C|1|1B, 4Z8C|1|1B, 5J4B|1|2B, 6CFL|1|2B, 5EL4|1|16, 4V9R|1|BB, 5EL6|1|1J, 5HD1|1|1B, 5HCP|1|1B, 6FKR|1|1B, 4V9H|1|BB, 6ND5|1|1B, 4W2I|1|BB, 4V8D|1|DB, 4WQR|1|1J, 5WIS|1|1B, 4Z3S|1|1B, 5EL7|1|1J, 4WQY|1|AB, 4WR6|1|16, 6CAE|1|2B, 4Z8C|1|2B, 4LNT|1|RB, 1VY4|1|BB, 5HAU|1|1B, 4WPO|1|CB, 4V6G|1|DB, 4V8B|1|BB, 5J8B|1|B, 4V5J|1|DB, 4W2H|1|BB, 6O97|1|1B, 4WSD|1|1J, 5IB8|1|1J, 4WRA|1|16, 6CFK|1|2B, 5J4C|1|2B, 4V9S|1|BB, 6QNQ|1|16, 4ZER|1|1B, 5HAU|1|2B, 4WT8|1|Cs, 5HCQ|1|2B, 6OF1|1|2B, 4WRA|1|1J, 1VY7|1|BB, 4W2F|1|BB, 6C5L|1|DB, 5WIT|1|1B, 4V7M|1|BB, 6CFJ|1|2B, 4V8H|1|BB, 5NDJ|1|16, 5V8I|1|1B, 4V9B|1|BB, 6FKR|1|2B, 5E7K|1|1J, 4WU1|1|16, 5W4K|1|2B, 1VY5|1|BB, 6QNR|1|1J, 4W2I|1|DB, 4Y4P|1|1B, 5DOY|1|1B, 4V5F|1|DB, 4W4G|1|RB, 4V8G|1|DB, 4W2G|1|DB, 4V5F|1|BB, 5EL5|1|16, 4V6F|1|DB, 4W4G|1|YB, 4WZO|1|16, 4WQF|1|CB, 4WR6|1|1J, 5E7K|1|16, 4V8E|1|AB, 4WU1|1|1J, 4V9S|1|DB, 4V5R|1|DB, 5HCR|1|2B, 5NDJ|1|1J, 4V8A|1|BB, 4Z3S|1|2B, 4V9R|1|DB, 5EL4|1|1J, 6ND5|1|2B, 4V9B|1|DB, 6C5L|1|BB, 6O97|1|2B, 5VPO|1|YB, 4YZV|1|YB, 5HD1|1|2B, 6ND6|1|1B, 4V5R|1|BB, 6GSK|1|16, 4V95|1|DB, 4V8C|1|AB, 4W2F|1|DB, 4ZSN|1|YB, 4YZV|1|RB, 1VY6|1|BB, 5WIS|1|2B, 4LT8|1|YB, 4V8F|1|AB, 4WT1|1|1J, 4L47|1|YB, 4ZSN|1|RB, 4WQU|1|CB, 1VY4|1|DB, 4YPB|1|YB, 4V6G|1|BB, 4WQY|1|CB, 4V5Q|1|BB, 6QNQ|1|1J, 4TUA|1|YB, 4ZER|1|2B, 4V8C|1|BB, 4WRO|1|16, 4V8B|1|DB, 5F8K|1|1B, 5DOY|1|2B, 4V90|1|BB, 4V5P|1|BB, 5HCP|1|2B, 4Y4P|1|2B, 4YPB|1|RB, 4V7J|1|AB, 4TUD|1|RB, 4W2H|1|DB, 4V5E|1|DB, 4V5P|1|DB, 4V5S|1|BB, 4V9A|1|BB, 4V87|1|AB, 4V51|1|BB, 4TUC|1|YB, 4V5D|1|BB, 5EL5|1|1J, 4V7J|1|BB, 4WT8|1|Ds, 4V5C|1|BB, 4L47|1|RB, 1VY5|1|DB, 4V8H|1|DB, 4W2E|1|B, 4V5Q|1|DB, 4LSK|1|YB, 4V5S|1|DB, 4WZO|1|1J, 4TUA|1|RB, 6ND6|1|2B, 4V9I|1|BB, 4V87|1|DB, 6GSK|1|1J, 4P6F|1|YB, 4V8Q|1|AB, 4V51|1|DB, 5WIT|1|2B, 4V8E|1|CB, 4V8I|1|DB, 4V97|1|DB, 5CZP|1|YB, 4V7L|1|BB, 6CZR|1|1B, 4TUE|1|RB, 4TUD|1|YB, 1VY6|1|DB, 6N9E|1|2B, 6N9F|1|2B, 4TUB|1|YB, 4V5E|1|BB, 1VVJ|1|YB, 1VY7|1|DB, 5DOX|1|1B, 6N9F|1|1B, 5CZP|1|RB, 4TUE|1|YB, 4WRO|1|1J, 4V97|1|BB, 4V9Q|1|CB, 4V6F|1|AB, 4V5L|1|BB, 4LT8|1|RB, 4V5D|1|DB, 4V5K|1|BB, 6N9E|1|1B, 5V8I|1|2B, 4V5J|1|BB, 4V7L|1|DB, 4V7K|1|AB, 5DOX|1|2B, 4V83|1|DB, 5F8K|1|2B, 4V9A|1|DB, 4V7K|1|BB, 5VPO|1|RB, 4TUC|1|RB, 4P70|1|RB, 4V8F|1|DB, 4P70|1|YB, 4V83|1|BB, 1VVJ|1|RB, 4L71|1|YB, 4V9Q|1|AB, 6B4V|1|C, 4TUB|1|RB, 4V9K|1|BB, 4LSK|1|RB, 4V8A|1|AB, 4V5K|1|DB, 4V7Y|1|BB, 6B4V|1|GB, 4V9K|1|DB, 4V67|1|BB, 4P6F|1|RB, 4V9I|1|DB, 5D8B|1|AD, 4L71|1|RB, 4LEL|1|YB, 4V5C|1|DB, 4LFZ|1|YB, 4V7X|1|BB, 6CZR|1|2B, 4V7W|1|BB, 4LFZ|1|RB, 6N1D|1|B5S, 4V84|1|BB, 4V9L|1|BB, 4V9M|1|BB, 4V4J|1|x, 4V84|1|DB, 5D8B|1|WC, 4V63|1|BB, 4V9M|1|DB, 4XEJ|1|B5S, 4V63|1|DB, 4V7Y|1|DB, 4V8J|1|BB, 4V5G|1|DB, 4V9L|1|DB, 4V7P|1|BB, 4V5G|1|BB, 4V7P|1|CB, 4XEJ|1|A5S, 4LEL|1|RB, 4V67|1|DB, 6N1D|1|A5S, 4V7W|1|DB, 4V8J|1|DB, 4W29|1|BB, 4V7M|1|DB, 4V7X|1|DB, 4V5A|1|BB, 4W29|1|DB, 4V4I|1|x, 4V7Z|1|BB, 4V5A|1|DB, 4V8O|1|BB, 4V7Z|1|DB, 4V4R|1|BB, 4V4S|1|BB, 4V4T|1|BB, 4V4Z|1|BB, 4V4X|1|BB, 4V4Y|1|BB, 4V4P|1|AB, 6GSJ|1|16, 6GSJ|1|1J, 4V6A|1|BB, 4V8U|1|BB, 4V6A|1|DB, 4V8X|1|BB, 4V8U|1|DB, 4V9J|1|BB, 4V8N|1|BB, 4V9J|1|DB, 4V9N|1|DB, 4V9N|1|BB, 4V8X|1|DB, 4V8N|1|DB, 6GSL|1|16, 6GSL|1|1J, 6BOK|1|C, 6BOK|1|FB, 6BOH|1|HB, 6BOH|1|C, 5VPP|1|YB, 5VPP|1|RB, 6OTR|1|YB, 5J3C|1|RB, 6OTR|1|RB, 5J3C|1|YB, 5J30|1|RB, 6BZ6|1|RB, 6BZ6|1|YB, 6OXA|1|YB, 6GZQ|1|B1, 6OXA|1|RB, 5J30|1|YB, 2JL8|1|B, 2JL6|1|B, 5UQ8|1|B, 6OXI|1|YB, 6OXI|1|RB, 5ZLU|1|X, 6BUW|1|RB, 6BUW|1|YB, 6NDK|1|YB, 6BZ7|1|RB, 6NDK|1|RB, 5UQ7|1|B, 6BZ7|1|YB, 6BZ8|1|YB, 6BZ8|1|RB, 6Q95|1|3, 5OT7|1|5, 6GZZ|1|B1, 6GZZ|1|B2, 6GZX|1|B1, 6GZX|1|B2, 5IMQ|1|E, 4V42|1|BB, 4V68|1|BB, 5IMR|1|E, 4V5N|1|BB, 4V5M|1|BB, 5A9Z|1|AB, 5AA0|1|AB
185NR_all_42832.1
Exact match
Tetrahymena thermophila
4V8P|1|C3 (4V8P)
  • 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): C3; model(s): 1
3.5 Å120(4) 4V8P|1|C3, 4V8P|1|E3, 4V8P|1|B3, 4V8P|1|G3
186NR_all_52752.1
Exact match
Homo sapiens
6QZP|1|L7 (6QZP)
  • 5S rRNA (120-MER), 5S ribosomal RNA, 5S [...]
  • ELECTRON MICROSCOPY
  • Chain(s): L7; model(s): 1
2.9 Å120(17) 6QZP|1|L7, 6EK0|1|L7, 6OLE|1|E, 6OM0|1|E, 6OLG|1|A4, 6OLI|1|E, 5T2C|1|B, 4UG0|1|L7, 6OM7|1|E, 6OLF|1|E, 6IP5|1|1B, 6OLZ|1|A4, 6IP8|1|1B, 5LKS|1|L7, 5AJ0|1|A4, 6IP6|1|1B, 4V6X|1|A7
187NR_all_62824.1
Exact match
Sus scrofa
3J7O|1|7 (3J7O)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.4 Å120(4) 3J7O|1|7, 3J7Q|1|7, 3J7P|1|7, 3J7R|1|7
188NR_all_66230.1
Exact match
4QK8|1|A (4QK8)
  • C-di-AMP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å120(2) 4QK8|1|A, 4QKA|1|A
189NR_all_89898.1
Exact match
Canis lupus
4V5Z|1|BF (4V5Z)
  • RNA Expansion segment ES7 part III
  • ELECTRON MICROSCOPY
  • Chain(s): BF; model(s): 1
8.7 Å120(1) 4V5Z|1|BF
190NR_all_90150.1
Exact match
Trypanosoma cruzi
5T5H|1|G (5T5H)
  • srRNA2
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
2.5 Å120(1) 5T5H|1|G
191NR_all_90759.4
Exact match
Homo sapiens
6QDV|1|2+6QDV|1|6 (6QDV)
  • U2 snRNA, U6 snRNA, Intron lariat: MINX [...]
  • ELECTRON MICROSCOPY
  • Chain(s): 2, 6, i; model(s): 1
3.3 Å120(10) 6QDV|1|2+6QDV|1|6, 6ICZ|1|H+6ICZ|1|F, 6QX9|1|2, 6ID1|1|H+6ID1|1|F, 5XJC|1|H+5XJC|1|F, 5YZG|1|H+5YZG|1|F, 5Z58|1|H+5Z58|1|F, 5MQF|1|2+5MQF|1|6, 5Z56|1|H+5Z56|1|F, 5Z57|1|H+5Z57|1|F
192NR_all_35599.1
Exact match
Bacillus subtilis
4KQY|1|A (4KQY)
  • YitJ S box/SAM-I riboswitch, TL5 RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å119(2) 4KQY|1|A, 3NPB|1|A
193NR_all_61166.1
Exact match
Trypanosoma brucei
4V8M|1|BD (4V8M)
  • 5S RRNA CHAIN OF THE LARGE RIBOSOMAL SUB[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BD; model(s): 1
5.6 Å119(1) 4V8M|1|BD
194NR_all_17436.1
Exact match
Toxoplasma gondii
5XXB|1|3 (5XXB)
  • 5S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
3.2 Å118(1) 5XXB|1|3
195NR_all_17605.2
Exact match
Plasmodium falciparum
3J79|1|B (3J79)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.2 Å118(5) 3J79|1|B, 5UMD|1|B, 3JBN|1|AB, 3JBO|1|AB, 3JBP|1|AB
196NR_all_50314.5
Exact match
Spinacia oleracea
6ERI|1|Ax (6ERI)
  • 5S ribosomal RNA, 5S rRNA, 5S ribosomal [...]
  • ELECTRON MICROSCOPY
  • Chain(s): Ax; model(s): 1
3.0 Å118(8) 6ERI|1|Ax, 5MMI|1|B, 5MMM|1|B, 5X8T|1|B, 5X8P|1|B, 5MLC|1|B, 5H1S|1|B, 4V61|1|BB
197NR_all_50467.1
Exact match
Escherichia coli
3IZZ|1|B (3IZZ)
  • Helix 69, 71, 89, 92, 95 (Large Subunit)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
10.8 Å118(1) 3IZZ|1|B
198NR_all_59231.1
Exact match
Escherichia coli
4V49|1|B9 (4V49)
  • 5S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): B9; model(s): 1
8.7 Å118(2) 4V49|1|B9, 4V4A|1|B9
199NR_all_69984.2
Exact match
Leishmania donovani
6AZ3|1|8 (6AZ3)
  • rRNA 5S, 5S rRNA, 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 8; model(s): 1
2.5 Å118(3) 6AZ3|1|8, 5T2A|1|D, 3JCS|1|8
200NR_all_77670.1
Exact match
6RM3|1|L70 (6RM3)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): L70; model(s): 1
3.4 Å118(1) 6RM3|1|L70
201NR_all_46024.1
Exact match
Trichomonas vaginalis
5XY3|1|3 (5XY3)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
3.2 Å117(1) 5XY3|1|3
202NR_all_83043.1
Exact match
Mycobacterium smegmatis
5ZEB|1|B (5ZEB)
  • 5S rRNA, P-tRNAfMet
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.4 Å117(3) 5ZEB|1|B, 5ZEP|1|B, 5ZET|1|B
203NR_all_00500.1
Exact match
Mycobacterium smegmatis
5XYM|1|B (5XYM)
  • 5S RNA, 5S rRNA, 5S RNA (118-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.1 Å116(4) 5XYM|1|B, 5O60|1|B, 6DZP|1|B, 6DZI|1|B
204NR_all_91474.1
Exact match
4QK9|1|A (4QK9)
  • C-di-AMP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å116(1) 4QK9|1|A
205NR_all_15683.2
Exact match
Streptococcus pyogenes
6MCB|1|B (6MCB)
  • Single guide RNA (116-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.4 Å115(3) 6MCB|1|B, 5VZL|1|B, 6MCC|1|B
206NR_all_26536.1
Exact match
Mycobacterium tuberculosis
5V7Q|1|B (5V7Q)
  • 5S ribosomal RNA, 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.7 Å115(2) 5V7Q|1|B, 5V93|1|B
207NR_all_32617.1
Exact match
Canis lupus
4V5Z|1|BY (4V5Z)
  • 5S Ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): BY; model(s): 1
8.7 Å115(1) 4V5Z|1|BY
208NR_all_51824.1
Exact match
RNA transcription vector pBRDI1
5WTI|1|B (5WTI)
  • RNA (123-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å115(1) 5WTI|1|B
209NR_all_79308.1
Exact match
Lactococcus lactis
5MYJ|1|BB (5MYJ)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): BB; model(s): 1
5.6 Å115(1) 5MYJ|1|BB
210NR_all_94618.1
Exact match
Streptococcus pyogenes
5F9R|1|A (5F9R)
  • RNA (116-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.4 Å115(1) 5F9R|1|A
211NR_all_54575.1
Exact match
Trypanosoma cruzi
5T5H|1|D (5T5H)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
2.5 Å114(1) 5T5H|1|D
212NR_all_78370.1
Exact match
Saccharomyces cerevisiae
4V8T|1|1 (4V8T)
  • ES27 OF THE 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
8.1 Å114(1) 4V8T|1|1
213NR_all_83891.13
Exact match
Staphylococcus aureus
4WF9|1|Y (4WF9)
  • 5S ribosomal RNA, 5S rRNA, 5S rRNA CHAIN
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
3.4 Å114(24) 4WF9|1|Y, 5HKV|1|Y, 4WFA|1|Y, 5HL7|1|Y, 4WCE|1|Y, 4WFB|1|Y, 5NRG|1|Y, 6S0Z|1|B, 6S0X|1|B, 6HMA|1|B, 5NGM|1|AB, 6DDD|1|2, 6DDG|1|2, 5T7V|1|C, 6S12|1|B, 5ND8|1|B, 5ND9|1|B, 5LI0|1|B, 5TCU|1|C, 6S13|1|B, 5NG8|1|BB, 6FXC|1|BB, 6FXC|1|AB, 5NG8|1|AB
214NR_all_63615.1
Exact match
Canis lupus
4V5Z|1|BX (4V5Z)
  • RNA helices
  • ELECTRON MICROSCOPY
  • Chain(s): BX; model(s): 1
8.7 Å113(1) 4V5Z|1|BX
215NR_all_70001.1
Exact match
Thermomyces lanuginosus
4V7H|1|B3 (4V7H)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B3; model(s): 1
8.9 Å113(1) 4V7H|1|B3
216NR_all_05181.1
Exact match
Escherichia coli
5VT0|1|R (5VT0)
  • Escherichia coli 6S RNA derivative (112-[...]
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.8 Å112(1) 5VT0|1|R
217NR_all_11808.1
Exact match
Oryctolagus cuniculus
3J0O|1|2 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
9.0 Å112(4) 3J0O|1|2, 3J0L|1|2, 3J0P|1|2, 3J0Q|1|2
218NR_all_73375.1
Exact match
6E79|1|B (6E79)
  • RNA (112-MER), RNA (110-MER), RNA (122-M[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
112(6) 6E79|1|B, 6NY2|1|B, 6E5O|1|B, 6NY3|1|B, 6E7A|1|B, 6NY1|1|B
219NR_all_97435.1
Exact match
Bacillus subtilis
6HA1|1|B (6HA1)
  • 5S ribosomal RNA, 5S rRNA, ribosome RNA [...]
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.1 Å112(5) 6HA1|1|B, 6HA8|1|B, 5NJT|1|V, 3J9W|1|BB, 3J3V|1|B
220NR_all_23876.1
Exact match
Saccharomyces cerevisiae
2LKR|3|A (2LKR)
  • RNA (111-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
111(1) 2LKR|3|A
221NR_all_59615.1
Exact match
Oryctolagus cuniculus
3J0O|1|h (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): h; model(s): 1
9.0 Å111(4) 3J0O|1|h, 3J0L|1|h, 3J0P|1|h, 3J0Q|1|h
222NR_all_80225.1
Exact match
Human mastadenovirus C
6OL3|1|C (6OL3)
  • Adenovirus Virus-Associated (VA) RNA I a[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.7 Å111(1) 6OL3|1|C
223NR_all_40570.1
Exact match
6CK5|1|A (6CK5)
  • PRPP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å108(6) 6CK5|1|A, 6CK5|1|B, 6CK4|1|C, 6CK4|1|B, 6CK4|1|A, 6CK4|1|D
224NR_all_53735.1
Exact match
Caldanaerobacter subterraneus
4QLM|1|A (4QLM)
  • RNA (108-MER), RNA (117-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å108(2) 4QLM|1|A, 4QLN|1|A
225NR_all_59301.1
Exact match
synthetic construct
2NBX|1|A (2NBX)
  • IRES RNA (108-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
108(1) 2NBX|1|A
226NR_all_86022.1
Exact match
Escherichia coli
3J45|1|5 (3J45)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
9.5 Å108(2) 3J45|1|5, 3J46|1|4
227NR_all_47203.1
Exact match
3F2X|1|X (3F2X)
  • FMN riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.1 Å107(6) 3F2X|1|X, 3F30|1|X, 3F2Y|1|X, 3F2W|1|X, 3F2Q|1|X, 3F2T|1|X
228NR_all_83641.1
Exact match
Escherichia coli
4Y1M|1|B (4Y1M)
  • E. coli yybP-ykoY riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å107(2) 4Y1M|1|B, 4Y1M|1|A
229NR_all_05530.5
Exact match
Spinacia oleracea
6ERI|1|AB (6ERI)
  • 4.5S ribosomal RNA, 4.8S rRNA, 4.8S ribo[...]
  • ELECTRON MICROSCOPY
  • Chain(s): AB; model(s): 1
3.0 Å106(8) 6ERI|1|AB, 5MMI|1|W, 5MMM|1|W, 5X8T|1|W, 5X8P|1|W, 5MLC|1|C, 5H1S|1|C, 4V61|1|BC
230NR_all_98802.1
Exact match
6DLR|1|A (6DLR)
  • PRPP Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å106(5) 6DLR|1|A, 6DLT|1|A, 6DLS|1|A, 6DLQ|1|A, 6DNR|1|A
231NR_all_27096.1
Exact match
Bacillus subtilis
4WFL|1|A (4WFL)
  • RNA, Bacillus subtilis small cytoplasmic[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å105(3) 4WFL|1|A, 4WFM|1|A, 4WFM|1|B
232NR_all_87230.1
Exact match
Schizosaccharomyces pombe
3JB9|1|C (3JB9)
  • U5 snRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
3.6 Å105(1) 3JB9|1|C
233NR_all_51660.3
Exact match
Escherichia coli
5NCO|1|1 (5NCO)
  • 4.5S SRP RNA (Ffs), SRP 4.5S RNA, ESRP 4[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
4.8 Å104(6) 5NCO|1|1, 5GAH|1|1, 5GAD|1|1, 5GAG|1|1, 5GAF|1|1, 2IY3|1|B
234NR_all_73286.10
Exact match
Homo sapiens
6QW6|1|5 (6QW6)
  • U5 snRNA, Ligated exons: MINX mRNA, U5sn[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
2.9 Å104(18) 6QW6|1|5, 6QX9|1|5, 6QDV|1|5, 6ICZ|1|B, 6FF4|1|5, 6ID0|1|B, 5XJC|1|B, 6ID1|1|B, 5YZG|1|B, 6AHD|1|B, 5O9Z|1|5, 6FF7|1|5, 5Z58|1|B, 5Z56|1|B, 6AH0|1|B, 5MQF|1|5, 5Z57|1|B, 3JCR|1|H
235NR_all_75087.1
Exact match
Saccharomyces cerevisiae
5TZS|1|2 (5TZS)
  • U3 snoRNA, 5' external transcribed space[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
5.1 Å103(1) 5TZS|1|2
236NR_all_26576.1
Exact match
Oceanobacillus iheyensis
4LCK|1|F (4LCK)
  • T-BOX RIBOSWITCH STEM I, T-box Stem I RN[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å102(10) 4LCK|1|F, 4LCK|1|C, 4TZZ|1|C, 4TZZ|1|F, 4TZZ|1|I, 4TZZ|1|L, 4TZV|1|C, 4TZW|1|C, 4TZP|1|C, 4TZP|1|F
237NR_all_57933.1
Exact match
Deinococcus radiodurans
2XXA|1|F (2XXA)
  • 4.5S RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.9 Å102(2) 2XXA|1|F, 2XXA|1|G
238NR_all_80875.1
Exact match
Turnip crinkle virus
2KRL|10|A (2KRL)
  • RNA (102-MER)
  • SOLUTION SCATTERING, SOLUTION NMR
  • Chain(s): A; model(s): 10
102(1) 2KRL|10|A
239NR_all_95082.1
Exact match
marine metagenome
4FRN|1|B (4FRN)
  • Cobalamin riboswitch aptamer domain
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.4 Å102(2) 4FRN|1|B, 4FRN|1|A
240NR_all_00626.1
Exact match
Bacillus subtilis
4W90|1|C (4W90)
  • riboswitch a pseudo-dimeric RNA, C-di-AM[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.1 Å101(2) 4W90|1|C, 4W92|1|C
241NR_all_57918.1
Exact match
1YSH|1|B (1YSH)
  • RNA (101-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
9.5 Å101(1) 1YSH|1|B
242NR_all_79426.1
Exact match
Turnip yellow mosaic virus
6MJ0|1|B (6MJ0)
  • RNA (101-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å101(2) 6MJ0|1|B, 6MJ0|1|A
243NR_all_86572.1
Exact match
1S9S|4|A (1S9S)
  • MLV Psi encapsidation site
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
101(1) 1S9S|4|A
244NR_all_16356.1
Exact match
Escherichia coli
3IZZ|1|E (3IZZ)
  • Helix 44 (Small Subunit), Helix 44 of 16[...]
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
10.8 Å100(2) 3IZZ|1|E, 1MVR|1|B
245NR_all_20814.1
Exact match
[Eubacterium] siraeum
3SUX|1|X (3SUX)
  • Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.9 Å100(3) 3SUX|1|X, 3SUH|1|X, 3SUY|1|X
246NR_all_45478.1
Exact match
1U6P|16|B (1U6P)
  • 101-MER
  • SOLUTION NMR
  • Chain(s): B; model(s): 16
100(1) 1U6P|16|B
247NR_all_86427.1
Exact match
Sulfobacillus acidophilus
6DME|1|A (6DME)
  • ppGpp Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å100(5) 6DME|1|A, 6DMC|1|B, 6DMC|1|A, 6DMD|1|A, 6DMD|1|B
248NR_all_18848.1
Exact match
Lactococcus lactis
6CB3|1|B (6CB3)
  • RNA (99-MER), yybP-ykoY riboswitch, RNA [...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å99(10) 6CB3|1|B, 6CB3|1|A, 4Y1J|1|A, 4Y1J|1|B, 6CC3|1|A, 4Y1I|1|A, 4Y1I|1|B, 6CC3|1|B, 6CC1|1|B, 6CC1|1|A
249NR_all_32399.1
Exact match
2GTT|1|W (2GTT)
  • RNA (99-MER)
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
3.5 Å99(1) 2GTT|1|W
250NR_all_50424.1
Exact match
Alicyclobacillus acidoterrestris
5U30|1|B (5U30)
  • sgRNA, RNA (60-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å99(5) 5U30|1|B, 5U31|1|B, 5U33|1|B, 5U34|1|B, 5WQE|1|B
251NR_all_79669.1
Exact match
Mus musculus
5Y36|1|B (5Y36)
  • single-guide RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
5.2 Å99(1) 5Y36|1|B
252NR_all_80684.1
Exact match
2GTT|1|X (2GTT)
  • RNA (99-MER)
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.5 Å99(1) 2GTT|1|X
253NR_all_37714.1
Exact match
Faecalibacterium prausnitzii
4RZD|1|A (4RZD)
  • PreQ1-III Riboswitch (Class 3)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å98(1) 4RZD|1|A
254NR_all_44691.1
Exact match
Aquifex aeolicus
3W3S|1|B (3W3S)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å98(1) 3W3S|1|B
255NR_all_12869.1
Exact match
4OQU|1|A (4OQU)
  • SAM-I/IV riboswitch, SAM-I/IV variant ri[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å97(2) 4OQU|1|A, 4L81|1|A
256NR_all_27219.1
Exact match
Canis lupus
4V5Z|1|B1 (4V5Z)
  • 5.8S Ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B1; model(s): 1
8.7 Å97(1) 4V5Z|1|B1
257NR_all_41222.1
Exact match
Leishmania donovani
6AZ3|1|5 (6AZ3)
  • rRNA epsilon, srRNA4
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
2.5 Å97(2) 6AZ3|1|5, 5T2A|1|H
258NR_all_62996.1
Exact match
Bacillus phage phi29
6JXM|1|B (6JXM)
  • RNA (97-mer)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.3 Å97(1) 6JXM|1|B
259NR_all_31222.1
Exact match
Caldanaerobacter subterraneus
5FJC|1|A (5FJC)
  • SAM-I RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å96(13) 5FJC|1|A, 5FK4|1|A, 4B5R|1|A, 5FK3|1|A, 5FK2|1|A, 5FKF|1|A, 5FK6|1|A, 5FK1|1|A, 5FKD|1|A, 5FKH|1|A, 5FKG|1|A, 5FKE|1|A, 5FK5|1|A
260NR_all_32874.1
Exact match
Sulfolobus solfataricus
3KTW|1|C (3KTW)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.2 Å96(2) 3KTW|1|C, 3KTW|1|D
261NR_all_45092.1
Exact match
Thermus thermophilus
2OM7|1|C (2OM7)
  • Fragment of 16S rRNA (h44), RNA (130-MER[...]
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
7.3 Å96(4) 2OM7|1|C, 1X1L|1|A, 1ZC8|1|Z, 2OB7|1|D
262NR_all_62361.1
Exact match
6JOO|1|B (6JOO)
  • Guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å96(1) 6JOO|1|B
263NR_all_80967.1
Exact match
Escherichia coli
2XKV|1|B (2XKV)
  • 4.5S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
13.5 Å96(1) 2XKV|1|B
264NR_all_52614.1
Exact match
Haloarcula marismortui
5ML7|1|B (5ML7)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.3 Å95(2) 5ML7|1|B, 5ML7|1|A
265NR_all_57834.1
Exact match
Homo sapiens
6FF4|1|6 (6FF4)
  • U6 snRNA, U2 snRNA, pre mRNA, U6snRNA, U[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
3.4 Å95(4) 6FF4|1|6, 6ID0|1|F+6ID0|1|H, 6FF7|1|6, 3JCR|1|N
266NR_all_89968.1
Exact match
synthetic construct
6DVK|1|H (6DVK)
  • RNA (95-MER)
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.6 Å95(1) 6DVK|1|H
267NR_all_77464.1
Exact match
Caldanaerobacter subterraneus
4AOB|1|A (4AOB)
  • SAM-I RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å94(2) 4AOB|1|A, 4AEB|1|A
268NR_all_82809.4
Exact match
Caldanaerobacter subterraneus
2YGH|1|A (2YGH)
  • SAM-I RIBOSWITCH, RNA (94-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å94(11) 2YGH|1|A, 3GX5|1|A, 3GX3|1|A, 3IQR|1|A, 3IQP|1|A, 3GX7|1|A, 3IQN|1|A, 2GIS|1|A, 2YDH|1|A, 3GX2|1|A, 3GX6|1|A
269NR_all_25458.1
Exact match
3IWN|1|A (3IWN)
  • C-di-GMP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å93(2) 3IWN|1|A, 3IWN|1|B
270NR_all_60079.1
Exact match
Campylobacter jejuni
5X2G|1|B (5X2G)
  • sgRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å93(2) 5X2G|1|B, 5X2H|1|B
271NR_all_90160.4
Exact match
synthetic construct
5B2P|1|B (5B2P)
  • Guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å93(3) 5B2P|1|B, 5B2O|1|B, 5B2Q|1|B
272NR_all_20392.1
Exact match
Caldanaerobacter subterraneus
3W1K|1|F (3W1K)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
7.5 Å92(5) 3W1K|1|F, 3W1K|1|I, 3W1K|1|J, 3W1K|1|G, 3W1K|1|H
273NR_all_22001.1
Exact match
2N7M|4|X (2N7M)
  • RNA (92-MER)
  • SOLUTION NMR
  • Chain(s): X; model(s): 4
92(1) 2N7M|4|X
274NR_all_88154.1
Exact match
synthetic construct
4RUM|1|A (4RUM)
  • NiCo riboswitch RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å92(1) 4RUM|1|A
275NR_all_12260.3
Exact match
3MXH|1|R (3MXH)
  • c-di-GMP riboswitch, G20A mutant c-di-GM[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.3 Å91(11) 3MXH|1|R, 3MUM|1|R, 3UCZ|1|R, 4YB1|1|R, 3MUR|1|R, 3MUV|1|R, 3UD4|1|R, 3UD3|1|R, 3MUT|1|R, 3IRW|1|R, 3UCU|1|R
276NR_all_49553.1
Exact match
3CUL|1|C (3CUL)
  • RNA (92-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å91(4) 3CUL|1|C, 3CUN|1|C, 3CUL|1|D, 3CUN|1|D
277NR_all_60628.1
Exact match
6MWN|1|B (6MWN)
  • HAV dV RNA (92-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å91(2) 6MWN|1|B, 6MWN|1|A
278NR_all_75326.1
Exact match
1M5K|1|B (1M5K)
  • RNA HAIRPIN RIBOZYME, RNA INHIBITOR SUBS[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å91(8) 1M5K|1|B, 1M5K|1|E, 1M5O|1|B, 1M5P|1|B, 1M5O|1|E, 1M5V|1|B, 1M5P|1|E, 1M5V|1|E
279NR_all_76892.1
Exact match
Escherichia coli
5LZD|1|y (5LZD)
  • Sec-tRNASec, fMetSec-tRNASec, SECIS mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): y; model(s): 1
3.4 Å91(4) 5LZD|1|y, 5LZF|1|y, 5LZC|1|y, 5LZB|1|y
280NR_all_79575.1
Exact match
Trypanosoma cruzi
5T5H|1|H (5T5H)
  • srRNA4
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
2.5 Å91(1) 5T5H|1|H
281NR_all_20250.1
Exact match
Triticum sp.
2GO5|1|9 (2GO5)
  • ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 9; model(s): 1
7.4 Å90(1) 2GO5|1|9
282NR_all_76442.1
Exact match
Schizosaccharomyces pombe
3JB9|1|N+3JB9|1|P (3JB9)
  • U6 snRNA, U2 snRNA, RNA (5'-R(P*UP*UP*UP[...]
  • ELECTRON MICROSCOPY
  • Chain(s): N, P, i; model(s): 1
3.6 Å90(1) 3JB9|1|N+3JB9|1|P
283NR_all_91539.1
Exact match
Sulfobacillus acidophilus
5T83|1|A (5T83)
  • RNA (95-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å90(1) 5T83|1|A
284NR_all_78797.2
Exact match
4LVW|1|A (4LVW)
  • THF riboswitch, Tetrahydrofolate riboswi[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å89(8) 4LVW|1|A, 4LVX|1|A, 4LVY|1|A, 4LW0|1|A, 4LVV|1|A, 4LVZ|1|A, 3SD3|1|A, 3SD1|1|A
285NR_all_06977.1
Exact match
Escherichia coli
3ZN8|1|G (3ZN8)
  • 4.5 S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
12.0 Å88(1) 3ZN8|1|G
286NR_all_46102.1
Exact match
1WZ2|1|D (1WZ2)
  • tRNA, tRNA-Leu, 5'-R(*AP*UP*UP*GP*UP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å88(3) 1WZ2|1|D, 1WZ2|1|C, 3J5Y|1|D
287NR_all_63789.1
Exact match
Methanopyrus kandleri
3ADD|1|C (3ADD)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å88(6) 3ADD|1|C, 3ADD|1|D, 3ADB|1|D, 3ADB|1|C, 3ADC|1|C, 3ADC|1|D
288NR_all_19099.1
Exact match
3K0J|1|E (3K0J)
  • RNA (87-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.1 Å87(2) 3K0J|1|E, 3K0J|1|F
289NR_all_69172.1
Exact match
Saccharomyces cerevisiae
4V8Y|1|CN (4V8Y)
  • EUKARYOTIC RIBOSOMAL L1_RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): CN; model(s): 1
4.3 Å87(1) 4V8Y|1|CN
290NR_all_19932.1
Exact match
Homo sapiens
1E8S|1|C (1E8S)
  • 7SL RNA, 88-MER
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
4.0 Å86(1) 1E8S|1|C
291NR_all_32185.1
Exact match
3OXE|1|A (3OXE)
  • domain II of glycine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å86(18) 3OXE|1|A, 3OXB|1|A, 3OXB|1|B, 3OXE|1|B, 3OXD|1|A, 3OXD|1|B, 3OXM|1|A, 3OXM|1|B, 3OWI|1|A, 3OWZ|1|A, 3OWI|1|B, 3OWW|1|A, 3OWW|1|B, 3OX0|1|A, 3OXJ|1|A, 3OX0|1|B, 3OXJ|1|B, 3OWZ|1|B
292NR_all_57598.2
Exact match
Mus musculus
3RG5|1|B (3RG5)
  • tRNA(Sec)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å86(2) 3RG5|1|B, 3RG5|1|A
293NR_all_59099.1
Exact match
synthetic construct
5AOX|1|C (5AOX)
  • ALU JO CONSENSUS RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å86(2) 5AOX|1|C, 5AOX|1|F
294NR_all_69455.1
Exact match
3Q1Q|1|C (3Q1Q)
  • TRNA (PHE)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.8 Å86(4) 3Q1Q|1|C, 3Q1R|1|C, 3OK7|1|C, 3OKB|1|C
295NR_all_11210.1
Exact match
Thermus thermophilus
486D|1|F (486D)
  • PENULTIMATE STEM OF 16S RRNA IN THE 70S [...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
7.5 Å85(1) 486D|1|F
296NR_all_19112.1
Exact match
4MGN|1|A (4MGN)
  • glyQS T box riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å85(2) 4MGN|1|A, 4MGN|1|C
297NR_all_71214.1
Exact match
Escherichia coli
3EQ4|1|Y (3EQ4)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): Y; model(s): 1
12.0 Å85(1) 3EQ4|1|Y
298NR_all_01779.1
Exact match
marine metagenome
4FRG|1|B (4FRG)
  • cobalamin riboswitch aptamer domain
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å84(2) 4FRG|1|B, 4FRG|1|X
299NR_all_04754.1
Exact match
Dickeya dadantii
5U3G|1|B (5U3G)
  • ykkC riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å84(1) 5U3G|1|B
300NR_all_98075.1
Exact match
2ZZM|1|B (2ZZM)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å84(1) 2ZZM|1|B
301NR_all_02656.1
Exact match
Turnip yellow mosaic virus
4P5J|1|A (4P5J)
  • Turnip yellow mosaic virus mRNA for the [...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å83(1) 4P5J|1|A
302NR_all_27557.1
Exact match
4KZD|1|R (4KZD)
  • RNA (84-MER), RNA (86-MER), RNA (83-MER)[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.2 Å83(4) 4KZD|1|R, 6B14|1|R, 6B3K|1|R, 4KZE|1|R
303NR_all_31480.1
Exact match
4YAZ|1|R (4YAZ)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.0 Å83(4) 4YAZ|1|R, 4YAZ|1|A, 4YB0|1|R, 4YB0|1|A
304NR_all_40189.1
Exact match
Hepatitis C virus
3T4B|1|A (3T4B)
  • HCV IRES pseudoknot domain plus crystall[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å83(1) 3T4B|1|A
305NR_all_73216.1
Exact match
Escherichia coli
4WSM|1|1K (4WSM)
  • tRNA-Leu, mRNA, P-tRNA, P-site tRNA
  • X-RAY DIFFRACTION
  • Chain(s): 1K; model(s): 1
3.3 Å83(14) 4WSM|1|1K, 4WSM|1|2K, 4WSM|1|2L, 4WSM|1|1L, 4V87|1|BB, 4V87|1|CB, 4V8B|1|AB, 4V8C|1|CB, 4V8C|1|DB, 4V8B|1|CB, 6HA1|1|x, 6D9J|1|3, 6D90|1|3, 5KCR|1|1x
306NR_all_92081.6
Exact match
synthetic construct
5FQ5|1|A (5FQ5)
  • SGRNA, RNA (95-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å83(10) 5FQ5|1|A, 5FW2|1|A, 4UN4|1|A, 6AEG|1|A, 4UN5|1|A, 5FW3|1|A, 4UN3|1|A, 5FW1|1|A, 6AEB|1|A, 6AEB|1|E
307NR_all_11709.1
Exact match
Escherichia coli
3ZGZ|1|B (3ZGZ)
  • TRNA-LEU UAA ISOACCEPTOR, E. COLI TRNALE[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å82(21) 3ZGZ|1|B, 4AQ7|1|B, 5OMW|1|B, 3ZGZ|1|E, 4AS1|1|B, 4ARI|1|B, 4AQ7|1|E, 4CQN|1|B, 3ZJT|1|B, 5OMW|1|E, 5ON2|1|B, 3ZJU|1|B, 5ONH|1|B, 5ON2|1|E, 5ONH|1|E, 4ARC|1|B, 5ON3|1|B, 4CQN|1|E, 3ZJV|1|B, 5ON3|1|E, 2NQP|1|F
308NR_all_18859.1
Exact match
synthetic construct
6JQ5|1|B+6JQ5|1|A (6JQ5)
  • RNA (82-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A, B, i; model(s): 1
2.1 Å82(1) 6JQ5|1|B+6JQ5|1|A
309NR_all_79104.1
Exact match
Escherichia coli
2VAZ|1|A (2VAZ)
  • RPSO MRNA OPERATOR
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
10.0 Å82(1) 2VAZ|1|A
310NR_all_85745.1
Exact match
synthetic construct
6JQ6|1|U (6JQ6)
  • RNA (81-MER)
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.6 Å82(1) 6JQ6|1|U
311NR_all_09775.1
Exact match
Agrobacterium tumefaciens
5AH5|1|D (5AH5)
  • TRNA-LEU TAA ISOACCEPTOR
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å81(2) 5AH5|1|D, 5AH5|1|C
312NR_all_13919.1
Exact match
3AM1|1|B (3AM1)
  • ASL-truncated tRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å81(1) 3AM1|1|B
313NR_all_14663.1
Exact match
2NR0|1|E (2NR0)
  • leucyl tRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.9 Å81(5) 2NR0|1|E, 2NR0|1|F, 2NR0|1|H, 2NR0|1|G, 2NRE|1|F
314NR_all_33394.4
Exact match
Streptococcus pyogenes
5B2T|1|A (5B2T)
  • Guide RNA, RNA (97-MER), RNA (81-MER), R[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å81(9) 5B2T|1|A, 5B2R|1|A, 5B2S|1|A, 4OO8|1|B, 4OO8|1|E, 6AI6|1|B, 5XBL|1|B, 6IFO|1|C, 6IFO|1|D
315NR_all_02825.1
Exact match
Saccharomyces cerevisiae
6AH3|1|T (6AH3)
  • pre-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): T; model(s): 1
3.5 Å80(1) 6AH3|1|T
316NR_all_13221.1
Exact match
Thermus thermophilus
1H3E|1|B (1H3E)
  • WILD-TYPE TRNATYR(GUA)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å80(1) 1H3E|1|B
317NR_all_35448.1
Exact match
Leishmania donovani
3JCS|1|5 (3JCS)
  • 26S epsilon ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
2.8 Å80(1) 3JCS|1|5
318NR_all_73731.2
Exact match
Thermus thermophilus
3U4M|1|B (3U4M)
  • RNA (80-MER), fragment of 23S rRNA, 23S [...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å80(6) 3U4M|1|B, 4QVI|1|B, 3UMY|1|B, 4QG3|1|B, 3U56|1|B, 5NPM|1|B
319NR_all_75310.1
Exact match
Salmonella enterica
6CU1|1|A (6CU1)
  • YrlA effector-binding module
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å79(1) 6CU1|1|A
320NR_all_23989.1
Exact match
Thermus thermophilus
2BTE|1|B (2BTE)
  • TRNALEU TRANSCRIPT WITH ANTICODON CAG, T[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å78(6) 2BTE|1|B, 2BTE|1|E, 2BYT|1|B, 2BYT|1|E, 2V0G|1|B, 2V0G|1|F
321NR_all_26354.1
Exact match
Escherichia coli
4XJN|1|N (4XJN)
  • RNA (78-MER)
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
3.1 Å78(1) 4XJN|1|N
322NR_all_42241.1
Exact match
2GDI|1|X (2GDI)
  • TPP riboswitch, thiM TPP riboswitch, thi[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.1 Å78(14) 2GDI|1|X, 2GDI|1|Y, 4NYA|1|A, 2HOJ|1|A, 2HOM|1|A, 2HOL|1|A, 4NYC|1|A, 4NYD|1|A, 4NYA|1|B, 4NYB|1|A, 2HOO|1|A, 2HOK|1|A, 4NYG|1|A, 2HOP|1|A
323NR_all_56041.1
Exact match
Archaeoglobus fulgidus
3AMU|1|B (3AMU)
  • RNA (78-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å78(2) 3AMU|1|B, 3AMT|1|B
324NR_all_61055.1
Exact match
Canis lupus
4V5Z|1|BN (4V5Z)
  • RNA Expansion segment ES27
  • ELECTRON MICROSCOPY
  • Chain(s): BN; model(s): 1
8.7 Å78(1) 4V5Z|1|BN
325NR_all_72172.1
Exact match
Homo sapiens
5CCB|1|N (5CCB)
  • tRNA3Lys
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.0 Å78(4) 5CCB|1|N, 5CCX|1|N, 5CD1|1|N, 5CD1|1|M
326NR_all_02142.1
Exact match
Haloarcula marismortui
4V8N|1|CV (4V8N)
  • E-SITE TRNA ILE2 AGMATIDINE OR P-SITE TR[...]
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.1 Å77(6) 4V8N|1|CV, 4V8N|1|AY, 4V8N|1|AV, 4V8N|1|CY, 4V8N|1|AW, 4V8N|1|CW
327NR_all_27756.1
Exact match
Arabidopsis thaliana
3D2V|1|A (3D2V)
  • TPP-specific riboswitch, NUCLEIC ACID
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å77(8) 3D2V|1|A, 3D2X|1|A, 3D2V|1|B, 3D2G|1|A, 3D2X|1|B, 2CKY|1|A, 3D2G|1|B, 2CKY|1|B
328NR_all_29909.1
Exact match
Alcaligenes sp.
4V9Q|1|DV (4V9Q)
  • tRNA, mRNA
  • X-RAY DIFFRACTION
  • Chain(s): DV; model(s): 1
3.4 Å77(4) 4V9Q|1|DV, 4V9Q|1|BV, 4V9Q|1|DW, 4V9Q|1|BW
329NR_all_31177.1
Exact match
Saccharomyces cerevisiae
6I7O|1|mb (6I7O)
  • P/E hybrid tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): mb; model(s): 1
5.3 Å77(1) 6I7O|1|mb
330NR_all_32990.2
Exact match
Saccharomyces cerevisiae
6HD7|1|B (6HD7)
  • P-site tRNA, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.4 Å77(3) 6HD7|1|B, 5MC6|1|n, 5GAK|1|B
331NR_all_35945.1
Exact match
Escherichia coli
6Q97|1|7 (6Q97)
  • tRNA-Val, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.9 Å77(1) 6Q97|1|7
332NR_all_45098.1
Exact match
Escherichia coli
5O2R|1|x (5O2R)
  • P-site Ile-tRNA, mRNA, P-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): x; model(s): 1
3.4 Å77(2) 5O2R|1|x, 5KCS|1|1x
333NR_all_52282.1
Exact match
1J2B|1|C (1J2B)
  • tRNA(Val)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.3 Å77(2) 1J2B|1|C, 1J2B|1|D
334NR_all_52833.1
Exact match
Bacillus subtilis
3J9W|1|AX (3J9W)
  • tRNA-Asp, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): AX; model(s): 1
3.9 Å77(1) 3J9W|1|AX
335NR_all_56633.4
Exact match
Escherichia coli
6I0Y|1|V (6I0Y)
  • Proline tRNA, glycine-tRNA, RNA, P-site [...]
  • ELECTRON MICROSCOPY
  • Chain(s): V; model(s): 1
3.2 Å77(6) 6I0Y|1|V, 3JBU|1|v, 4UY8|1|V, 5NP6|1|B, 4V5H|1|AV, 4V6M|1|AV
336NR_all_62210.1
Exact match
Escherichia coli
5VPP|1|QV (5VPP)
  • P-site tRNA SufA6, messenger RNA
  • X-RAY DIFFRACTION
  • Chain(s): QV; model(s): 1
3.9 Å77(2) 5VPP|1|QV, 5VPP|1|XV
337NR_all_64485.1
Exact match
Methanocaldococcus jannaschii
4V4N|1|B1 (4V4N)
  • E-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B1; model(s): 1
9.0 Å77(1) 4V4N|1|B1
338NR_all_65114.1
Exact match
3A2K|1|C (3A2K)
  • bacterial tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.7 Å77(2) 3A2K|1|C, 3A2K|1|D
339NR_all_65284.1
Exact match
2ZUE|1|B (2ZUE)
  • tRNA-Arg
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å77(2) 2ZUE|1|B, 2ZUF|1|B
340NR_all_72820.1
Exact match
Limbella pachyloma
4TUE|1|QV (4TUE)
  • P-site tRNA-fMet, A-site ASL-SufJ, messe[...]
  • X-RAY DIFFRACTION
  • Chain(s): QV; model(s): 1
3.5 Å77(2) 4TUE|1|QV, 4TUE|1|XV
341NR_all_72919.2
Exact match
1P5P|1|A (1P5P)
  • 77-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
77(2) 1P5P|1|A, 1P5O|2|A
342NR_all_76789.1
Exact match
Oryctolagus cuniculus
3J0P|1|W (3J0P)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): W; model(s): 1
10.6 Å77(3) 3J0P|1|W, 3J0Q|1|Y, 3J0Q|1|W
343NR_all_78233.2
Exact match
Escherichia coli
4V9K|1|AW (4V9K)
  • transfer RNA, messenger RNA, tRNA, mRNA,[...]
  • X-RAY DIFFRACTION
  • Chain(s): AW; model(s): 1
3.5 Å77(12) 4V9K|1|AW, 4V9K|1|CW, 4V9M|1|CW, 4V9M|1|AW, 4V9L|1|AW, 4V9L|1|CW, 4W29|1|AW, 4W29|1|CW, 4V9J|1|AW, 4V9J|1|CW, 6Q97|1|8, 4V7B|1|AW
344NR_all_86561.1
Exact match
Escherichia coli
5MGP|1|x (5MGP)
  • P-site tRNA, mRNA, Proline tRNA, RNA (5'[...]
  • ELECTRON MICROSCOPY
  • Chain(s): x; model(s): 1
3.1 Å77(5) 5MGP|1|x, 6ENU|1|x, 6ENF|1|x, 6ENJ|1|x, 6ENJ|1|9
345NR_all_98554.1
Exact match
Pyrococcus furiosus
4V6U|1|A1 (4V6U)
  • E-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A1; model(s): 1
6.6 Å77(1) 4V6U|1|A1
346NR_all_01147.1
Exact match
Oryctolagus cuniculus
6GZ4|1|Bw (6GZ4)
  • pe/E-site-tRNA, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): Bw; model(s): 1
3.6 Å76(1) 6GZ4|1|Bw
347NR_all_04887.1
Exact match
Salmonella enterica
5IMQ|1|5 (5IMQ)
  • E site tRNA, E site- tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
3.8 Å76(2) 5IMQ|1|5, 5IMR|1|5
348NR_all_12290.1
Exact match
Spinacia oleracea
5MMM|1|z (5MMM)
  • tRNA-Phe
  • ELECTRON MICROSCOPY
  • Chain(s): z; model(s): 1
3.4 Å76(1) 5MMM|1|z
349NR_all_21015.1
Exact match
Saccharomyces cerevisiae
6R84|1|B (6R84)
  • tRNA-Ala
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.6 Å76(2) 6R84|1|B, 6R87|1|B
350NR_all_25652.1
Exact match
Saccharomyces cerevisiae
5MRC|1|bb (5MRC)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): bb; model(s): 1
3.3 Å76(3) 5MRC|1|bb, 5MRE|1|bb, 5MRF|1|bb
351NR_all_26520.1
Exact match
Escherichia coli
3J46|1|p (3J46)
  • P-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): p; model(s): 1
10.1 Å76(1) 3J46|1|p
352NR_all_27306.1
Exact match
Lactobacillus rhamnosus
4JF2|1|A (4JF2)
  • PreQ1-II Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å76(1) 4JF2|1|A
353NR_all_28207.1
Exact match
Homo sapiens
6OLE|1|v (6OLE)
  • PE RNA, mRNA, tRNA, A/A site tRNA, P/E t[...]
  • ELECTRON MICROSCOPY
  • Chain(s): v; model(s): 1
3.1 Å76(7) 6OLE|1|v, 6OM0|1|v, 6OLI|1|v, 6OM7|1|v, 3J73|1|S6, 1VX2|1|6, 6OLF|1|v
354NR_all_42401.1
Exact match
Thermus thermophilus
4RDX|1|C (4RDX)
  • tRNA(his)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å76(1) 4RDX|1|C
355NR_all_45609.2
Exact match
Saccharomyces cerevisiae
6HD7|1|A (6HD7)
  • tRNA, A-site tRNA, mRNA, The A-site tRNA[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.4 Å76(3) 6HD7|1|A, 5MC6|1|m, 5GAK|1|A
356NR_all_47349.1
Exact match
Mitsuaria sp. 67
4WT8|1|D4 (4WT8)
  • tRNA (76-MER), mRNA
  • X-RAY DIFFRACTION
  • Chain(s): D4; model(s): 1
3.4 Å76(1) 4WT8|1|D4
357NR_all_52612.1
Exact match
Pyrococcus furiosus
4V6U|1|A0 (4V6U)
  • P-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A0; model(s): 1
6.6 Å76(1) 4V6U|1|A0
358NR_all_55964.1
Exact match
Lactobacillus rhamnosus
5D5L|1|A (5D5L)
  • PreQ1-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å76(4) 5D5L|1|A, 5D5L|1|D, 5D5L|1|B, 5D5L|1|C
359NR_all_58975.1
Exact match
Bos taurus
3IZY|1|N (3IZY)
  • tRNA-Phe
  • ELECTRON MICROSCOPY
  • Chain(s): N; model(s): 1
10.8 Å76(1) 3IZY|1|N
360NR_all_66347.1
Exact match
Escherichia coli
4W29|1|AX (4W29)
  • tRNA, mRNA
  • X-RAY DIFFRACTION
  • Chain(s): AX; model(s): 1
3.8 Å76(1) 4W29|1|AX
361NR_all_68467.6
Exact match
Oryctolagus cuniculus
5LZS|1|2 (5LZS)
  • tRNA, mRNA, P-site tRNA, mRNA (UGA stop [...]
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.3 Å76(21) 5LZS|1|2, 5LZS|1|ii, 5LZV|1|2, 6GZ5|1|Bv, 5LZZ|1|2, 5LZW|1|2, 6GZ4|1|Bv, 6GZ3|1|Bv, 6MTB|1|2, 5LZX|1|2, 5LZT|1|2, 6FRK|1|2, 3JAH|1|2, 6HCF|1|23, 3JAG|1|2, 3JAI|1|2, 6FTI|1|q, 5LZU|1|2, 6HCM|1|23, 3JAJ|1|3, 3JAN|1|3
362NR_all_71445.1
Exact match
Yersinia pseudotuberculosis
5AJ0|1|Bv (5AJ0)
  • tRNA, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): Bv; model(s): 1
3.5 Å76(2) 5AJ0|1|Bv, 5AJ0|1|Bw
363NR_all_73703.1
Exact match
Saccharomyces cerevisiae
6R6P|1|2 (6R6P)
  • A/P-tRNA, mRNA, P-tRNA, messenger RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.1 Å76(4) 6R6P|1|2, 6R6G|1|2, 6R7Q|1|2, 6R5Q|1|2
364NR_all_73795.1
Exact match
Pseudomonas aeruginosa
4WJ3|1|S (4WJ3)
  • 76mer-tRNA
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
3.7 Å76(4) 4WJ3|1|S, 4WJ3|1|R, 4WJ3|1|T, 4WJ3|1|Q
365NR_all_74018.1
Exact match
Staphylococcus aureus
5TCU|1|D (5TCU)
  • E-site tRNA CHAIN, P-site tRNA CHAIN, mR[...]
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
3.9 Å76(2) 5TCU|1|D, 5TCU|1|E
366NR_all_83547.1
Exact match
Sus scrofa
3J7R|1|S6 (3J7R)
  • P/E tRNA, Messenger RNA
  • ELECTRON MICROSCOPY
  • Chain(s): S6; model(s): 1
3.9 Å76(1) 3J7R|1|S6
367NR_all_90554.1
Exact match
Homo sapiens
6OLE|1|u (6OLE)
  • AP RNA, mRNA, tRNA, P/E site tRNA, PE tR[...]
  • ELECTRON MICROSCOPY
  • Chain(s): u; model(s): 1
3.1 Å76(7) 6OLE|1|u, 6OM0|1|u, 6OLG|1|Bv, 6OLI|1|u, 6OM7|1|u, 6OLZ|1|Bv, 6OLF|1|u
368NR_all_91690.1
Exact match
Pseudomonas aeruginosa
4WJ4|1|B (4WJ4)
  • 76mer-tRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.3 Å76(1) 4WJ4|1|B
369NR_all_95556.5
Exact match
Thermus thermophilus
4V90|1|AV (4V90)
  • RNA (77-MER), 5'-R(*UP*AP*AP*AP*AP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): AV; model(s): 1
3.0 Å76(16) 4V90|1|AV, 4WT8|1|C3, 5J8B|1|y, 5J8B|1|w, 4WT8|1|D3, 4V5A|1|CV+4V5A|1|CX, 4V5A|1|AV+4V5A|1|AX, 4WT8|1|C2, 4V8U|1|AV, 4V8U|1|CV, 3J9Z|1|S7, 4V68|1|AW, 5AA0|1|BC, 3BBV|1|z, 5AA0|1|BE, 5AA0|1|BD
370NR_all_97621.1
Exact match
Escherichia coli
6Q9A|1|7 (6Q9A)
  • P-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.7 Å76(1) 6Q9A|1|7
371NR_all_03715.1
Exact match
Staphylococcus aureus
1QU2|1|T (1QU2)
  • ISOLEUCYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.2 Å75(3) 1QU2|1|T, 1QU3|1|T, 1FFY|1|T
372NR_all_10787.1
Exact match
Methanocaldococcus jannaschii
5X6B|1|P (5X6B)
  • tRNACys
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å75(1) 5X6B|1|P
373NR_all_23520.1
Exact match
Homo sapiens
6IP8|1|zy (6IP8)
  • P-site tRNA, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): zy; model(s): 1
3.9 Å75(4) 6IP8|1|zy, 6IP5|1|zy, 6IP5|1|zu, 6IP6|1|zy
374NR_all_24366.1
Exact match
Saccharomyces cerevisiae
6R5Q|1|3 (6R5Q)
  • E-tRNA, P/E-tRNA, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
3.0 Å75(4) 6R5Q|1|3, 6R6P|1|3, 6R6G|1|3, 6R7Q|1|3
375NR_all_29085.1
Exact match
1N78|1|C (1N78)
  • tRNA(Glu), tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å75(14) 1N78|1|C, 1N78|1|D, 2DXI|1|C, 1N77|1|C, 2DXI|1|D, 2CV2|1|C, 1N77|1|D, 2CV2|1|D, 2CV1|1|D, 2CV1|1|C, 2CV0|1|C, 2CV0|1|D, 1G59|1|B, 1G59|1|D
376NR_all_33313.1
Exact match
Bos taurus
4UJE|1|AW (4UJE)
  • TRNA-PHE, Messenger RNA
  • ELECTRON MICROSCOPY
  • Chain(s): AW; model(s): 1
6.9 Å75(1) 4UJE|1|AW
377NR_all_33997.1
Exact match
Oryctolagus cuniculus
6MTC|1|4 (6MTC)
  • Z-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
3.4 Å75(2) 6MTC|1|4, 6MTB|1|4
378NR_all_34987.1
Exact match
Triticum aestivum
4V7E|1|Ae (4V7E)
  • P-site tRNA, 5'-R(*AP*AP*AP*AP*GP*AP*CP*[...]
  • ELECTRON MICROSCOPY
  • Chain(s): Ae; model(s): 1
5.5 Å75(1) 4V7E|1|Ae
379NR_all_34999.1
Exact match
Thermus thermophilus
4V4J|1|2 (4V4J)
  • E-site tRNA, E-TRNA, tRNA Phe (unmodifie[...]
  • X-RAY DIFFRACTION
  • Chain(s): 2; model(s): 1
3.8 Å75(5) 4V4J|1|2, 4V4I|1|0, 4V4P|1|BC, 4V4P|1|BB, 4V68|1|AY
380NR_all_36843.1
Exact match
Oryctolagus cuniculus
5LZS|1|3 (5LZS)
  • E-site tRNA, tRNA, tRNA(Lys)
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
3.3 Å75(12) 5LZS|1|3, 5LZV|1|3, 5LZZ|1|3, 5LZW|1|3, 5LZX|1|3, 5LZT|1|3, 5LZU|1|3, 5LZY|1|2, 5LZY|1|3, 3JAI|1|3, 3JAH|1|3, 3JAG|1|3
381NR_all_40314.1
Exact match
Escherichia coli
4V9I|1|AY (4V9I)
  • A-SITE tRNA
  • X-RAY DIFFRACTION
  • Chain(s): AY; model(s): 1
3.3 Å75(2) 4V9I|1|AY, 4V9I|1|CY
382NR_all_51862.1
Exact match
Oceanobacillus iheyensis
4LCK|1|B (4LCK)
  • tRNA-Gly, engineered tRNAGly, engineered[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å75(10) 4LCK|1|B, 4LCK|1|E, 4TZZ|1|H, 4TZZ|1|E, 4TZZ|1|B, 4TZZ|1|K, 4TZV|1|B, 4TZW|1|B, 4TZP|1|B, 4TZP|1|E
383NR_all_55925.1
Exact match
Escherichia coli
4WSM|1|3L (4WSM)
  • tRNA-Leu
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.3 Å75(2) 4WSM|1|3L, 4WSM|1|3K
384NR_all_57348.1
Exact match
1GAX|1|D (1GAX)
  • TRNA(VAL), tRNA (Val)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å75(4) 1GAX|1|D, 1GAX|1|C, 1IVS|1|C, 1IVS|1|D
385NR_all_57792.1
Exact match
Escherichia coli
6HA8|1|x (6HA8)
  • P-tRNA(Leu), mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): x; model(s): 1
3.5 Å75(1) 6HA8|1|x
386NR_all_58761.1
Exact match
2CSX|1|C (2CSX)
  • RNA (75-MER), RNA (74-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.7 Å75(4) 2CSX|1|C, 2CT8|1|D, 2CT8|1|C, 2CSX|1|D
387NR_all_63319.1
Exact match
Kluyveromyces lactis
3JAP|1|1 (3JAP)
  • Met-tRNAi (U31:A39 variant), mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
4.9 Å75(1) 3JAP|1|1
388NR_all_69638.1
Exact match
Archaeoglobus fulgidus
3WQY|1|C (3WQY)
  • RNA (75-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.3 Å75(2) 3WQY|1|C, 3WQZ|1|C
389NR_all_73165.2
Exact match
4PRF|1|B (4PRF)
  • Hepatitis Delta virus ribozyme, HDV RIBO[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å75(15) 4PRF|1|B, 2OJ3|1|B, 1SJF|1|B, 1VC0|1|B, 1VC6|1|B, 1VBZ|1|B, 1SJ4|1|R, 1SJ3|1|R, 2OIH|1|B, 1VC5|1|B, 1VBY|1|B, 1VBX|1|B, 1CX0|1|B, 1VC7|1|B, 1DRZ|1|B
390NR_all_79672.1
Exact match
Pectobacterium parmentieri
4V7M|1|AY (4V7M)
  • tRNA-Gln
  • X-RAY DIFFRACTION
  • Chain(s): AY; model(s): 1
3.5 Å75(2) 4V7M|1|AY, 4V7M|1|CY
391NR_all_79851.1
Exact match
Oryctolagus cuniculus
6HCJ|1|33 (6HCJ)
  • P/E tRNA, mRNA, tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 33; model(s): 1
3.8 Å75(3) 6HCJ|1|33, 5K0Y|1|N, 6HCQ|1|33
392NR_all_82709.1
Exact match
Saccharomyces cerevisiae
6Q8Y|1|m (6Q8Y)
  • E-site tRNA, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): m; model(s): 1
3.1 Å75(2) 6Q8Y|1|m, 6I7O|1|m
393NR_all_86924.1
Exact match
2IHX|1|B (2IHX)
  • uPsi RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
75(1) 2IHX|1|B
394NR_all_95482.1
Exact match
Drosophila melanogaster
4V6W|1|BC (4V6W)
  • E-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): BC; model(s): 1
6.0 Å75(1) 4V6W|1|BC
395NR_all_96269.6
Exact match
Homo sapiens
4KZZ|1|j (4KZZ)
  • initiator Met-RNA-i, mRNA, E site tRNA ([...]
  • X-RAY DIFFRACTION
  • Chain(s): j; model(s): 1
7.0 Å75(7) 4KZZ|1|j, 6QZP|1|S6, 6EK0|1|S6, 5T2C|1|An, 4UG0|1|S6, 4V6X|1|BC, 6FEC|1|N
396NR_all_97214.1
Exact match
Escherichia coli
3JBV|1|W (3JBV)
  • RNA (75-MER), RNA (5'-R(P*CP*UP*GP*GP*CP[...]
  • ELECTRON MICROSCOPY
  • Chain(s): W; model(s): 1
3.3 Å75(1) 3JBV|1|W
397NR_all_03720.1
Exact match
Sus scrofa
3J92|1|2 (3J92)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.6 Å74(1) 3J92|1|2
398NR_all_04935.1
Exact match
synthetic construct
3AL0|1|E (3AL0)
  • tRNAGln, tRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.4 Å74(8) 3AL0|1|E, 3AKZ|1|E, 3AKZ|1|F, 3AKZ|1|H, 3AKZ|1|G, 4YVI|1|C, 4YVJ|1|C, 4YVK|1|C
399NR_all_09431.1
Exact match
4PR6|1|B (4PR6)
  • HDV RIBOZYME SELF-CLEAVED
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å74(1) 4PR6|1|B
400NR_all_10263.1
Exact match
Escherichia coli
5AKA|1|7 (5AKA)
  • 4.5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
5.7 Å74(1) 5AKA|1|7
401NR_all_10425.1
Exact match
Escherichia coli
2J28|1|8 (2J28)
  • 4.5S SIGNAL RECOGNITION PARTICLE RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 8; model(s): 1
9.5 Å74(1) 2J28|1|8
402NR_all_12548.1
Exact match
Escherichia coli
6GSL|1|3L (6GSL)
  • tRNAArg
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.2 Å74(2) 6GSL|1|3L, 6GSL|1|3K
403NR_all_19951.30
Exact match
Escherichia coli
4YCO|1|D (4YCO)
  • tRNAphe, tRNA(Phe), Phenylalanine specif[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å74(242) 4YCO|1|D, 4YCO|1|E, 4YCO|1|F, 3FOZ|1|C, 4WOI|1|DW, 5NDK|1|X1, 4V9H|1|AV, 3L0U|1|A, 2ZM5|1|C, 5NDK|1|X4, 4V5R|1|CV, 4V9D|1|BV, 4V5R|1|AV, 6QNR|1|2K, 4V5P|1|AV, 4V5P|1|CV, 2ZXU|1|C, 4V6F|1|CC, 5NDJ|1|X1, 3FOZ|1|D, 6QNR|1|2L, 5NDJ|1|X4, 4WQU|1|BW, 4V5S|1|CV, 4W2E|1|w, 4V5Q|1|AV, 4WQF|1|BW, 4V5S|1|AV, 4V5E|1|CV, 5J4B|1|1y, 6C5L|1|AV, 6CFJ|1|1w, 4V5E|1|AV, 5W4K|1|1y, 4V5J|1|CV, 4V5Q|1|CV, 5WIT|1|1w, 6C5L|1|CV, 6CFJ|1|1y, 6CFJ|1|2w, 5J4C|1|1w, 5WIS|1|1y, 5J4C|1|1y, 4V6F|1|BC, 4WQU|1|DW, 4V5D|1|CV, 4V5D|1|AV, 6CFJ|1|2y, 5WIS|1|1w, 4WT1|1|1K, 5J4B|1|1w, 5NDK|1|W1, 5J4C|1|2w, 4V51|1|AW, 4WQF|1|DW, 5J4B|1|2w, 4WT1|1|3K, 4V5J|1|AV, 4V9C|1|AV, 5J4B|1|2y, 5J4C|1|2y, 5W4K|1|1w, 5NDK|1|W4, 6ND5|1|1y, 4WOI|1|AX, 4W2G|1|AW, 4WQR|1|3K, 5WIS|1|2y, 5WIT|1|2w, 5DOY|1|1y, 5W4K|1|2y, 2ZM5|1|D, 4Y4P|1|1y, 4V9D|1|AV, 4Z3S|1|1y, 4WSD|1|1K, 5DOY|1|1w, 4WT1|1|3L, 4V5S|1|AW, 5DOY|1|2y, 4V51|1|CW, 6ND5|1|1w, 4W2I|1|AW, 4WSD|1|3L, 4V6F|1|BD, 4W2I|1|CW, 4Z3S|1|2y, 4Z3S|1|1w, 5W4K|1|2w, 4WQR|1|3L, 1VY4|1|AW, 4V5S|1|CW, 6ND5|1|2y, 4WPO|1|BY, 4Y4P|1|2y, 4WRO|1|1K, 4W2G|1|CW, 4V5D|1|CW, 4V5L|1|AV, 4WSD|1|3K, 4W2I|1|AY, 4V5D|1|AW, 4W2F|1|AW, 4Y4P|1|1w, 5NDJ|1|W1, 4Z3S|1|2w, 4WT1|1|1L, 4W2I|1|CY, 1VY4|1|AY, 4V5D|1|AY, 4V5E|1|CW, 6QNR|1|1K, 5NDJ|1|W4, 4WZO|1|3K, 4WPO|1|DY, 4W2G|1|AY, 4V5J|1|CW, 4V5G|1|AV, 5WIS|1|2w, 4V5G|1|CV, 4V5D|1|CY, 6QNR|1|3L, 4V5J|1|AW, 2ZXU|1|D, 4V5Q|1|AW, 4V5Q|1|CW, 6QNR|1|1L, 4WQR|1|1K, 5NDK|1|V4, 4W2G|1|CY, 4V6F|1|CD, 5NDJ|1|V4, 5WIT|1|1y, 6QNR|1|5K, 4WZO|1|3L, 6QNR|1|3K, 6ND5|1|2w, 4V5G|1|AW, 4W2F|1|AY, 4Y4P|1|2w, 1VY7|1|AY, 6C5L|1|CW, 6C5L|1|AW, 5DOY|1|2w, 1VY5|1|AW, 1VY4|1|CY, 4V6F|1|CB, 5WIT|1|2y, 4WSD|1|1L, 4WRO|1|3L, 5NDK|1|V1, 4V5C|1|AW, 4V5G|1|CW, 4W2F|1|CW, 4WRO|1|1L, 4V5P|1|AW, 4W2F|1|CY, 4V5R|1|CW, 4V5C|1|CY, 4WPO|1|BW, 4WRO|1|3K, 4V5R|1|AW, 4V5C|1|AY, 4V6F|1|BB, 4V5P|1|CW, 1VY7|1|CY, 5NDJ|1|V1, 1VY5|1|AY, 4P6F|1|QW, 1VY4|1|CW, 4V5E|1|AW, 4V97|1|AW, 4V4I|1|z, 4P6F|1|XW, 1VY5|1|CW, 4V5C|1|CW, 1VY5|1|CY, 4WQR|1|1L, 4V9I|1|AW, 4V9I|1|CW, 4WPO|1|DW, 4V97|1|CW, 4V5L|1|AW, 4W2H|1|AY, 4V9C|1|CV, 4V8J|1|AW, 4WQU|1|BY, 4W2H|1|CY, 4V8J|1|CW, 4W2E|1|x, 4V4Y|1|AD, 4WQU|1|DY, 4V4Y|1|AC, 4WQF|1|BY, 4WQF|1|DY, 4V4Y|1|AB, 6AZ1|1|2, 6AZ1|1|4, 3R8O|1|V, 3R8N|1|V, 5AFI|1|y, 5UYM|1|Y, 5UQ8|1|z, 5WDT|1|y, 5WFS|1|y, 5WE4|1|y, 2JL7|1|V, 2JL5|1|V, 2JL7|1|W, 2JL5|1|W, 3JCE|1|6, 6BU8|1|Y, 5UQ7|1|z, 5UYL|1|Y, 5IQR|1|4, 5WE6|1|y, 5WFK|1|y, 5WF0|1|y, 6O9J|1|v, 5UYK|1|Y, 5OT7|1|2, 5KPX|1|30, 5KPW|1|30, 3J73|1|S5, 1VX2|1|5, 6Q95|1|8, 3JCE|1|9, 5KPV|1|30, 5IQR|1|6, 3JCD|1|8, 3JCD|1|9, 3JBV|1|V, 4V69|1|AW, 4V7D|1|BV, 4V7D|1|BW, 4V7C|1|AW, 4V7C|1|AV, 4V6K|1|BB, 4V6K|1|BE, 3J46|1|a, 4V6L|1|AE, 4V6L|1|AB
404NR_all_22323.2
Exact match
Oryctolagus cuniculus
6HCJ|1|q3 (6HCJ)
  • A/P RNA, mRNA, A/P tRNA, TRNA-LYS, Messe[...]
  • ELECTRON MICROSCOPY
  • Chain(s): q3; model(s): 1
3.8 Å74(12) 6HCJ|1|q3, 6HCQ|1|q3, 4UJE|1|AV, 3J0O|1|V, 3J0O|1|W, 3J0O|1|Y, 4UJD|1|BA, 3J0L|1|V, 3J0L|1|W, 3J0L|1|Y, 4UJC|1|AA, 3J0P|1|Y
405NR_all_30486.2
Exact match
Plasmodium falciparum
6OKK|1|g (6OKK)
  • E-site tRNA, tRNA, E-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): g; model(s): 1
3.3 Å74(3) 6OKK|1|g, 3J7A|1|7, 3JBP|1|7
406NR_all_31819.2
Exact match
Escherichia coli
1QTQ|1|B (1QTQ)
  • RNA (TRNA GLN II ), RNA (71-MER), Glutam[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å74(23) 1QTQ|1|B, 4JXX|1|B, 1ZJW|1|B, 4V7M|1|AW, 4V7M|1|CW, 4V7L|1|AW, 4V7L|1|CW, 1EUY|1|B, 4V7L|1|AY, 4V7L|1|CY, 1EUQ|1|B, 1QRS|1|B, 1QRT|1|B, 1QRU|1|B, 1GTR|1|B, 2RD2|1|B, 1GTS|1|B, 5NWY|1|M, 2RE8|1|B, 1GSG|1|T, 1O0C|1|B, 1O0B|1|B, 1EXD|1|B
407NR_all_37008.1
Exact match
Homo sapiens
4PLX|1|A (4PLX)
  • Core ENE hairpin and A-rich tract from M[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å74(3) 4PLX|1|A, 4PLX|1|B, 4PLX|1|C
408NR_all_39569.1
Exact match
Saccharomyces cerevisiae
4YYE|1|C (4YYE)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å74(2) 4YYE|1|C, 4YYE|1|D
409NR_all_62940.1
Exact match
2D6F|1|F (2D6F)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å74(2) 2D6F|1|F, 2D6F|1|E
410NR_all_64404.1
Exact match
Thermus thermophilus
3TUP|1|T (3TUP)
  • Thermus thermophilus tRNAPhe, TRNAPHE, T[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.1 Å74(7) 3TUP|1|T, 2IY5|1|T, 1EIY|1|C, 3B0V|1|A, 4V4Z|1|AD, 3B0V|1|B, 4V4X|1|AD
411NR_all_65073.1
Exact match
Clostridium acetobutylicum
3Q3Z|1|V (3Q3Z)
  • c-di-GMP-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.5 Å74(2) 3Q3Z|1|V, 3Q3Z|1|A
412NR_all_70420.1
Exact match
1J1U|1|B (1J1U)
  • tRNA(Tyr)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å74(1) 1J1U|1|B
413NR_all_73958.1
Exact match
Sus scrofa
3J7R|1|S5 (3J7R)
  • A/P tRNA, Messenger RNA
  • ELECTRON MICROSCOPY
  • Chain(s): S5; model(s): 1
3.9 Å74(1) 3J7R|1|S5
414NR_all_77709.2
Exact match
Saccharomyces cerevisiae
4V8Y|1|CW (4V8Y)
  • EUKARYOTIC RIBOSOMAL P_E TRNA, A/P hybri[...]
  • ELECTRON MICROSCOPY
  • Chain(s): CW; model(s): 1
4.3 Å74(3) 4V8Y|1|CW, 6I7O|1|nb, 4V8Z|1|CW
415NR_all_83386.1
Exact match
Escherichia coli
1U0B|1|A (1U0B)
  • Cysteinyl-tRNA synthetase
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å74(1) 1U0B|1|A
416NR_all_89906.2
Exact match
Thermotoga maritima
3WFS|1|A (3WFS)
  • RNA (74-MER), tRNAphe, RNA (73-MER), RNA[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.3 Å74(22) 3WFS|1|A, 3WFS|1|B, 5HC9|1|D, 3WFQ|1|B, 3WFQ|1|A, 4WC2|1|B, 5HC9|1|C, 4WC3|1|B, 1VFG|1|D, 3WFQ|1|C, 1VFG|1|C, 3WFQ|1|D, 4X0B|1|B, 4WC7|1|B, 3WFR|1|C, 4WC5|1|B, 3WFR|1|A, 4WC4|1|B, 4WC6|1|B, 4X0A|1|B, 3WFR|1|B, 3WFR|1|D
417NR_all_98299.1
Exact match
Staphylococcus aureus
5T7V|1|D (5T7V)
  • E-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
3.6 Å74(1) 5T7V|1|D
418NR_all_98593.1
Exact match
Methanocaldococcus jannaschii
5D8H|1|A (5D8H)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å74(1) 5D8H|1|A
419NR_all_06496.1
Exact match
Homo sapiens
5E6M|1|C (5E6M)
  • tRNA(Gly), Gly-tRNA-CCC
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å73(4) 5E6M|1|C, 5E6M|1|E, 4KR3|1|C, 4KR2|1|C
420NR_all_07733.2
Exact match
Escherichia coli
5EL4|1|3L (5EL4)
  • tRNA-Lys, tRNALys, mRNA
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.2 Å73(14) 5EL4|1|3L, 5EL5|1|3K, 5E7K|1|3L, 5EL6|1|3L, 5E7K|1|3K, 5IB8|1|3L, 5IB7|1|3L, 5EL4|1|3K, 5EL5|1|3L, 5EL7|1|3K, 5EL6|1|3K, 5EL7|1|3L, 5IB7|1|3K, 5IB8|1|3K
421NR_all_18068.1
Exact match
Trypanosoma brucei
4V8M|1|BF (4V8M)
  • SHORT RRNA-II OF THE LARGE RIBOSOMAL SUB[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BF; model(s): 1
5.6 Å73(1) 4V8M|1|BF
422NR_all_43299.1
Exact match
Listeria monocytogenes
5VW1|1|C (5VW1)
  • sgRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å73(1) 5VW1|1|C
423NR_all_45659.1
Exact match
synthetic construct
4ZNP|1|A (4ZNP)
  • pfI Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å73(2) 4ZNP|1|A, 4ZNP|1|B
424NR_all_55021.1
Exact match
Trypanosoma brucei
4V8M|1|AB (4V8M)
  • E-SITE TRNA
  • ELECTRON MICROSCOPY
  • Chain(s): AB; model(s): 1
5.6 Å73(1) 4V8M|1|AB
425NR_all_87467.1
Exact match
3WC1|1|P (3WC1)
  • 75-mer tRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
4.2 Å73(2) 3WC1|1|P, 3WC1|1|Q
426NR_all_90313.1
Exact match
Thermus thermophilus
2OM7|1|J (2OM7)
  • Fragment of23S rRNA (H76)
  • ELECTRON MICROSCOPY
  • Chain(s): J; model(s): 1
7.3 Å73(1) 2OM7|1|J
427NR_all_96162.1
Exact match
Staphylococcus aureus
5CZZ|1|B (5CZZ)
  • RNA (73-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å73(2) 5CZZ|1|B, 5AXW|1|B
428NR_all_12494.1
Exact match
Salmonella enterica
6CFJ|1|1x (6CFJ)
  • P-site tRNA, mRNA, P- site tRNA, P site-[...]
  • X-RAY DIFFRACTION
  • Chain(s): 1x; model(s): 1
2.8 Å72(4) 6CFJ|1|1x, 6CFJ|1|2x, 5IMQ|1|4, 5IMR|1|4
429NR_all_14079.1
Exact match
2MF0|6|G (2MF0)
  • RNA_(72-MER)
  • SOLUTION NMR
  • Chain(s): G; model(s): 6
72(1) 2MF0|6|G
430NR_all_17314.1
Exact match
2MF1|16|G (2MF1)
  • RNA_(72-MER)
  • SOLUTION NMR
  • Chain(s): G; model(s): 16
72(1) 2MF1|16|G
431NR_all_20721.8
Exact match
Thermus thermophilus
5E81|1|2K (5E81)
  • tRNA-fMet, mRNA, P-site tRNA, P-site fMe[...]
  • X-RAY DIFFRACTION
  • Chain(s): 2K; model(s): 1
3.0 Å72(45) 5E81|1|2K, 5J8B|1|x, 4V95|1|AV, 4V7J|1|Av, 4V9B|1|AC, 4V7J|1|Bv, 5E81|1|2L, 4V9B|1|CC, 4V95|1|CV, 4V7K|1|Bv, 4V7K|1|Av, 4WT8|1|C4, 4V9A|1|AC, 4L47|1|XV, 4V7K|1|Bw, 4L47|1|QV, 4V7K|1|Aw, 4V9A|1|CC, 4V7J|1|Aw, 4V7J|1|Bw, 4V9B|1|CD, 4V4J|1|z, 4V9B|1|AD, 4V5A|1|AW, 4V5A|1|CW, 4V8X|1|AV, 4V9N|1|CW, 4V8X|1|CV, 4V9N|1|AW, 4V8U|1|CW, 4V8U|1|AW, 4V8X|1|CW, 4V8X|1|AW, 6BOK|1|IA, 6BOK|1|LC, 6BOK|1|D, 6BOK|1|GB, 3J9Z|1|S6, 5ZLU|1|DD, 3JA1|1|S2, 5LMT|1|Z, 5LMR|1|Z, 4V68|1|AV, 4V5N|1|AV, 4V5M|1|AV
432NR_all_30153.5
Exact match
Saccharomyces cerevisiae
5AXM|1|P (5AXM)
  • RNA (75-MER), TRANSFER-RNA, PHE, TRNAPHE[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.2 Å72(23) 5AXM|1|P, 5AXN|1|P, 1OB2|1|B, 4TNA|1|A, 1EHZ|1|A, 1I9V|1|A, 6GZ5|1|Bw, 6GZ3|1|Bw, 1TN1|1|A, 1TN2|1|A, 5M1J|1|A3, 6GQV|1|AY, 4TRA|1|A, 6TNA|1|A, 6GQB|1|AX, 6GQ1|1|AX, 1TRA|1|A, 1LS2|1|B, 1FCW|1|A, 1FCW|1|D, 1FCW|1|B, 1FCW|1|E, 1FCW|1|C
433NR_all_30925.1
Exact match
Streptococcus pyogenes
4ZT0|1|D (4ZT0)
  • single-guide RNA, single guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å72(7) 4ZT0|1|D, 4ZT0|1|B, 4ZT9|1|D, 4ZT9|1|B, 6O0X|1|B, 6O0Y|1|B, 6O0Z|1|B
434NR_all_32332.1
Exact match
Thermus thermophilus
5E81|1|3L (5E81)
  • tRNA-Lys
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.0 Å72(2) 5E81|1|3L, 5E81|1|3K
435NR_all_49359.1
Exact match
Pyrococcus furiosus
4BY9|1|A (4BY9)
  • SSR26, 5'-R(*UP*CP*GP*CP*CP*CP*AP*UP*CP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
72(2) 4BY9|1|A, 4BY9|1|B
436NR_all_52699.1
Exact match
Bos taurus
2AKE|1|B (2AKE)
  • transfer RNA-Trp
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å72(2) 2AKE|1|B, 2DR2|1|B
437NR_all_61171.1
Exact match
Escherichia coli
6GSK|1|3L (6GSK)
  • tRNAThr
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.4 Å72(4) 6GSK|1|3L, 6GSK|1|3K, 6GSJ|1|3L, 6GSJ|1|3K
438NR_all_62804.1
Exact match
Homo sapiens
6AHU|1|T (6AHU)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): T; model(s): 1
3.7 Å72(1) 6AHU|1|T
439NR_all_76698.1
Exact match
Canis lupus
4V5Z|1|BZ (4V5Z)
  • E site t-RNA
  • ELECTRON MICROSCOPY
  • Chain(s): BZ; model(s): 1
8.7 Å72(1) 4V5Z|1|BZ
440NR_all_76729.1
Exact match
2ZNI|1|C (2ZNI)
  • bacterial tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.1 Å72(2) 2ZNI|1|C, 2ZNI|1|D
441NR_all_93250.1
Exact match
Canis lupus
4V5Z|1|BI (4V5Z)
  • RNA Expansion segment ES15 part I
  • ELECTRON MICROSCOPY
  • Chain(s): BI; model(s): 1
8.7 Å72(1) 4V5Z|1|BI
442NR_all_98033.1
Exact match
2AZX|1|D (2AZX)
  • 72-MER
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å72(2) 2AZX|1|D, 2AZX|1|C
443NR_all_99471.1
Exact match
Homo sapiens
5WWT|1|C (5WWT)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.2 Å72(6) 5WWT|1|C, 5WWS|1|C, 5WWR|1|C, 5WWR|1|D, 5WWT|1|D, 5WWS|1|D
444NR_all_01439.1
Exact match
Zika virus
5TPY|1|A (5TPY)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å71(1) 5TPY|1|A
445NR_all_28348.1
Exact match
synthetic construct
4JXZ|1|B (4JXZ)
  • RNA (71-MER), RNA (72-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å71(2) 4JXZ|1|B, 4JYZ|1|B
446NR_all_30586.1
Exact match
Rattus norvegicus
2L3J|1|B (2L3J)
  • RNA (71-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
71(1) 2L3J|1|B
447NR_all_31699.1
Exact match
4MGN|1|B (4MGN)
  • tRNA-glycine, tRNA glycine
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å71(4) 4MGN|1|B, 4MGN|1|D, 4MGM|1|B, 4MGM|1|A
448NR_all_33389.1
Exact match
2DU3|1|D (2DU3)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å71(4) 2DU3|1|D, 2DU4|1|C, 2DU5|1|D, 2DU6|1|D
449NR_all_35542.63
Exact match
Escherichia coli
5L4O|1|A (5L4O)
  • tRNA (76-MER), P-site tRNA, mRNA, TRNA F[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å71(391) 5L4O|1|A, 5HCQ|1|1x, 4V6G|1|CC, 4WQ1|1|2K, 5IBB|1|2K, 6CAE|1|1x, 4WQR|1|2K, 5HCQ|1|2x, 4V5F|1|CV, 5IB7|1|2K, 4V8D|1|CC, 5HCR|1|1x, 4Z8C|1|1x, 5J4B|1|1x, 4WQ1|1|2L, 5EL7|1|2K, 4WSD|1|2L, 4V8D|1|AC, 5IBB|1|2L, 5J4B|1|2x, 4Z8C|1|2x, 4WSD|1|2K, 6CAE|1|2x, 4WT1|1|2L, 4WQR|1|2L, 5J4C|1|1x, 4WPO|1|BX, 5W4K|1|1x, 4V6G|1|AC, 1VY4|1|AX, 6OF1|1|1x, 5DFE|1|XV, 6QNQ|1|2K, 4W2H|1|AX, 5HCR|1|2x, 5EL7|1|2L, 4LNT|1|XV, 5HD1|1|1x, 5HCP|1|1x, 6OF1|1|2x, 5HAU|1|1w, 5J4C|1|2x, 4W2I|1|AX, 5WIS|1|1x, 5IB7|1|2L, 5EL6|1|2K, 4WT1|1|2K, 5IB8|1|2K, 4W2G|1|CX, 4LNT|1|QV, 6ND5|1|1x, 4V7M|1|AX, 4W2H|1|CX, 4YZV|1|XV, 5W4K|1|2x, 4V5F|1|AV, 5DFE|1|QV, 4WRA|1|2K, 4WRA|1|2L, 5EL6|1|2L, 5HAU|1|2w, 5E7K|1|2K, 4V9S|1|AX, 5IB8|1|2L, 4Y4P|1|1x, 4W2G|1|AX, 4WR6|1|2K, 6O97|1|1x, 4WR6|1|2L, 3CW5|1|A, 5EL4|1|2K, 5HCP|1|2x, 4W4G|1|XV, 5DOY|1|1x, 4ZER|1|1x, 5WIT|1|1x, 5EL5|1|2K, 6QNQ|1|2L, 5HD1|1|2x, 4V9S|1|CX, 4W2I|1|CX, 6ND5|1|2x, 5E7K|1|2L, 1VY7|1|AX, 4Z3S|1|1x, 4YZV|1|QV, 1VY4|1|CX, 4W2F|1|AX, 4V8Q|1|BV, 1VY5|1|AX, 4V51|1|CV, 4WPO|1|DX, 4ZSN|1|XV, 4YPB|1|XV, 4W4G|1|QV, 4V9R|1|AX, 4V9R|1|CX, 4WZO|1|2K, 5EL4|1|2L, 4W2F|1|CX, 5WIS|1|2x, 4V8E|1|DC, 4WRO|1|2K, 4V51|1|AV, 4V5C|1|AV, 6ND6|1|1x, 6O97|1|2x, 4Y4P|1|2x, 1VY6|1|AX, 4Z3S|1|2x, 4ZER|1|2x, 4ZSN|1|QV, 1VY6|1|CX, 4WQY|1|BX, 5DOY|1|2x, 4V8F|1|BC, 4WRO|1|2L, 5WIT|1|2x, 4V5C|1|CV, 5F8K|1|1x, 4V87|1|CC, 4WZO|1|2L, 4TUC|1|QV, 6ND6|1|2x, 4YPB|1|QV, 1VY5|1|CX, 4V8B|1|AC, 4P6F|1|XV, 4LT8|1|XV, 4V87|1|BC, 4V8C|1|DC, 4TUC|1|XV, 4V7M|1|CX, 4V8E|1|BC, 5EL5|1|2L, 4V5F|1|AW, 4V5F|1|CW, 4TUA|1|XV, 4V9I|1|AV, 4TUA|1|QV, 6GSK|1|2L, 4V67|1|AY, 4TUB|1|XV, 4V7L|1|CX, 6N9E|1|1x, 4V7P|1|DW, 4V8B|1|CC, 4TUB|1|QV, 4V7L|1|AX, 4TUD|1|QV, 4LT8|1|QV, 4P6F|1|QV, 6N9E|1|2x, 4P70|1|XV, 4V8C|1|CC, 6N9F|1|1x, 4V5K|1|AV, 4V7P|1|AW, 5F8K|1|2x, 4V67|1|CY, 4P70|1|QV, 4TUD|1|XV, 1VVJ|1|XV, 6QNQ|1|3K, 4WQY|1|DX, 1VY7|1|CX, 6N9F|1|2x, 5CZP|1|XV, 6GSK|1|2K, 5CZP|1|QV, 4V9I|1|CV, 4V8F|1|CC, 4LSK|1|XV, 4V6G|1|CD, 4V63|1|AY, 4LFZ|1|XV, 4LSK|1|QV, 4V63|1|CY, 1VVJ|1|QV, 4LFZ|1|QV, 3CW6|1|A, 3QSY|1|D, 4L71|1|XV, 6QNQ|1|3L, 5D8B|1|FD, 6B4V|1|HB, 4V97|1|AV, 4LEL|1|XV, 4V6G|1|AD, 4V8C|1|DD, 4WZO|1|1K, 4L71|1|QV, 5D8B|1|ED, 6B4V|1|IA, 6B4V|1|D, 4V5K|1|CV, 6B4V|1|MC, 4LEL|1|QV, 4V8C|1|CD, 4V97|1|CV, 4V8B|1|AD, 4V87|1|BD, 6QNQ|1|1K, 4W4G|1|XW, 4W4G|1|QW, 4V87|1|CD, 4V63|1|CZ, 4V8B|1|CD, 4V67|1|AZ, 4V63|1|AZ, 5D8B|1|XC, 4V8J|1|CV, 4V6G|1|CB, 4V8O|1|AV, 5D8B|1|BD, 4V8J|1|AV, 4V67|1|CZ, 4V5K|1|AW, 4V5K|1|CW, 3V11|1|D, 4YPB|1|XW, 4YPB|1|QW, 4V4Z|1|AC, 4V8Q|1|BW, 4V4X|1|AC, 6GSJ|1|2L, 6GSJ|1|2K, 4V6A|1|CW, 4V6A|1|AW, 6GSL|1|2L, 6GSL|1|2K, 6BOH|1|NC, 6BOH|1|IA, 6BOH|1|D, 6BOH|1|IB, 6AZ1|1|3, 4BTC|1|V, 5AFI|1|v, 5AFI|1|w, 6H4N|1|w, 5H5U|1|5, 5J3C|1|XV, 5WFS|1|v, 5WDT|1|v, 5WDT|1|w, 5WFS|1|w, 5J3C|1|QV, 6ORE|1|5, 6OTR|1|XV, 6OTR|1|QV, 6OTR|1|QW, 6OTR|1|XW, 5MDV|1|5, 6BZ6|1|QV, 5WE4|1|v, 5WE4|1|w, 5U9G|1|W, 5UYM|1|W, 5U9F|1|W, 5UQ8|1|y, 5U9F|1|X, 5UYM|1|X, 5U9G|1|X, 6BZ6|1|XV, 5MDW|1|5, 6C4I|1|y, 6C4I|1|x, 6OXA|1|XV, 6OXA|1|QW, 5J30|1|QV, 5J30|1|XV, 5MDZ|1|5, 6OXA|1|QV, 2FMT|1|D, 2FMT|1|C, 6OXA|1|XW, 5ZEB|1|v, 5ZEP|1|w, 3JCE|1|8, 5LZD|1|v, 5WE6|1|v, 5WFK|1|v, 5WFK|1|w, 5WE6|1|w, 6BU8|1|X, 6BU8|1|W, 5UQ7|1|y, 5U4I|1|y, 5U4I|1|x, 5MDY|1|5, 6OXI|1|XV, 6OXI|1|QV, 6BUW|1|XV, 5UYL|1|X, 5UYL|1|W, 6BUW|1|QV, 5LZA|1|v, 5WF0|1|v, 5WF0|1|w, 5ZEU|1|v, 6DNC|1|D, 6DNC|1|LA, 6OSQ|1|5, 6OSK|1|5, 6BZ7|1|XV, 5L3P|1|x, 3JCJ|1|v, 6Q95|1|7, 5UYQ|1|X, 6GXM|1|x, 5UYQ|1|W, 6GWT|1|x, 6BZ8|1|QV, 6BZ8|1|XV, 6NDK|1|XV, 6BZ7|1|QV, 6ORL|1|5, 5KPS|1|31, 5KPW|1|31, 5UYK|1|W, 5UYP|1|W, 6GXN|1|x, 5UYK|1|X, 5UYP|1|X, 6GXO|1|x, 6NDK|1|QV, 5KPX|1|31, 5KPS|1|32, 3J9Y|1|v, 5UYN|1|X, 5UYN|1|W, 6O9K|1|y, 5IQR|1|5, 6BZ7|1|XW, 5KPW|1|32, 6BZ8|1|XW, 6OUO|1|5, 6BZ7|1|QW, 5KPV|1|31, 6BZ8|1|QW, 5KPX|1|32, 6O7K|1|v, 6OT3|1|5, 5KPV|1|32, 6OST|1|5, 5LMU|1|Z, 5LZF|1|v, 3JCN|1|v, 3JBN|1|7, 5LZC|1|v, 5U4J|1|x+5U4J|1|z, 5LZB|1|v, 5LMV|1|Z, 3JBO|1|7, 5LMQ|1|Z, 3J77|1|PT, 3J78|1|ET, 3J78|1|PT, 5LMS|1|Z, 5JBH|1|4, 5JB3|1|4, 4V69|1|AV, 4V7B|1|AV, 3J5S|1|E, 6H58|1|w, 6H58|1|ww, 4V6V|1|A3, 4V6T|1|AX, 3DEG|1|B, 4V6R|1|AD, 4V6Q|1|AD, 1EG0|1|O, 4V6Y|1|A3, 4V6Z|1|A3, 4V75|1|A3, 4V6N|1|BD, 5ZEY|1|B, 4V72|1|A3, 4V6S|1|BC, 4V6P|1|AD, 5ME1|1|X, 4V6O|1|AD, 4V79|1|A3, 4V73|1|A3, 5ME0|1|X, 4V74|1|A3, 4V70|1|A3, 4V77|1|A3, 4V76|1|A3, 4V71|1|A3, 4V78|1|A3
450NR_all_36247.1
Exact match
2OIU|1|Q (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å71(1) 2OIU|1|Q
451NR_all_43244.1
Exact match
Murine leukemia virus
2MS0|8|B (2MS0)
  • tRNApro
  • SOLUTION NMR
  • Chain(s): B; model(s): 8
71(1) 2MS0|8|B
452NR_all_45079.1
Exact match
Murine leukemia virus
2MS1|1|B (2MS1)
  • tRNApro
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
71(1) 2MS1|1|B
453NR_all_59689.4
Exact match
Vibrio vulnificus
4XNR|1|X (4XNR)
  • Vibrio Vulnificus Adenine Riboswitch, RN[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.2 Å71(5) 4XNR|1|X, 4TZY|1|X, 4TZX|1|X, 5UZA|1|X, 5SWE|1|X
454NR_all_60142.1
Exact match
2OIU|1|P (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å71(1) 2OIU|1|P
455NR_all_63265.1
Exact match
Bacillus subtilis
3LA5|1|A (3LA5)
  • Adenosine RIboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å71(1) 3LA5|1|A
456NR_all_65635.2
Exact match
Homo sapiens
6GAZ|1|AV (6GAZ)
  • P-site fMet-tRNAMet, mitochondrial, MT-C[...]
  • ELECTRON MICROSCOPY
  • Chain(s): AV; model(s): 1
3.1 Å71(3) 6GAZ|1|AV, 6GB2|1|AV, 6GAW|1|AV
457NR_all_69516.1
Exact match
Vibrio vulnificus
1Y26|1|X (1Y26)
  • Vibrio vulnificus A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.1 Å71(1) 1Y26|1|X
458NR_all_73445.1
Exact match
Vibrio vulnificus
4LX6|1|A (4LX6)
  • Mutated adenine riboswitch aptamer
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å71(2) 4LX6|1|A, 4LX5|1|A
459NR_all_74174.1
Exact match
unidentified
5KPY|1|A (5KPY)
  • 5-hydroxytryptophan RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å71(1) 5KPY|1|A
460NR_all_79254.1
Exact match
Thermus thermophilus
3KFU|1|L (3KFU)
  • tRNA-Asn
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.0 Å71(4) 3KFU|1|L, 3KFU|1|K, 3KFU|1|N, 3KFU|1|M
461NR_all_79496.3
Exact match
2DER|1|D (2DER)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å71(5) 2DER|1|D, 2DER|1|C, 2DET|1|C, 2DEU|1|D, 2DEU|1|C
462NR_all_90969.1
Exact match
2ZZN|1|D (2ZZN)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å71(2) 2ZZN|1|D, 2ZZN|1|C
463NR_all_91296.1
Exact match
Leishmania donovani
6AZ3|1|6 (6AZ3)
  • rRNA zeta, srRNA3
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
2.5 Å71(2) 6AZ3|1|6, 5T2A|1|F
464NR_all_11986.2
Exact match
Escherichia coli
2YHM|1|K (2YHM)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): K; model(s): 1
3.6 Å70(6) 2YHM|1|K, 5FVC|1|K, 4V5V|1|AK, 4V5V|1|BR, 4V5V|1|AM, 4V5V|1|BX
465NR_all_18034.1
Exact match
Escherichia coli
3DEG|1|G (3DEG)
  • 50S RNA helix 42-44
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
10.9 Å70(1) 3DEG|1|G
466NR_all_26998.1
Exact match
1KXK|1|A (1KXK)
  • ai5g group II Self-splicing intron
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å70(1) 1KXK|1|A
467NR_all_42502.1
Exact match
Escherichia coli
5HR7|1|D (5HR7)
  • tRNA Glu
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å70(2) 5HR7|1|D, 5HR7|1|C
468NR_all_53587.1
Exact match
Escherichia coli
5JTE|1|AX (5JTE)
  • P-site tRNA Aspartate, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): AX; model(s): 1
3.6 Å70(2) 5JTE|1|AX, 5JU8|1|AX
469NR_all_65561.1
Exact match
Escherichia coli
6GSK|1|1K (6GSK)
  • tRNAThr, mRNA, RNA (27-MER)
  • X-RAY DIFFRACTION
  • Chain(s): 1K; model(s): 1
3.4 Å70(4) 6GSK|1|1K, 6GSK|1|1L, 6GSJ|1|1K, 6GSJ|1|1L
470NR_all_82460.1
Exact match
Apis mellifera
2N8V|1|X (2N8V)
  • RNA (70-MER)
  • SOLUTION NMR
  • Chain(s): X; model(s): 1
70(1) 2N8V|1|X
471NR_all_93427.1
Exact match
Methanosarcina mazei
5UD5|1|C (5UD5)
  • RNA (70-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å70(4) 5UD5|1|C, 5UD5|1|D, 5V6X|1|C, 5V6X|1|D
472NR_all_24979.1
Exact match
Bacillus phage phi29
6QYZ|1|A (6QYZ)
  • the prohead RNA (71-MER) in bacteriophag[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
4.6 Å69(10) 6QYZ|1|A, 6QYZ|1|D, 6QYZ|1|E, 6QYZ|1|B, 6QYZ|1|C, 1FOQ|1|B, 1FOQ|1|A, 1FOQ|1|C, 1FOQ|1|E, 1FOQ|1|D
473NR_all_42461.1
Exact match
3HAY|1|E (3HAY)
  • H/ACA RNA, 5'-R(*AP*UP*AP*AP*UP*UP*(FHU)[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
5.0 Å69(1) 3HAY|1|E
474NR_all_45040.1
Exact match
3EPH|1|E (3EPH)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å69(8) 3EPH|1|E, 3EPK|1|E, 3EPH|1|F, 3EPK|1|F, 3EPJ|1|E, 3EPL|1|F, 3EPJ|1|F, 3EPL|1|E
475NR_all_54761.1
Exact match
Thermus thermophilus
4V5G|1|AY (4V5G)
  • A-SITE TRNA THR, MRNA
  • X-RAY DIFFRACTION
  • Chain(s): AY; model(s): 1
3.6 Å69(2) 4V5G|1|AY, 4V5G|1|CY
476NR_all_56118.6
Exact match
Saccharomyces cerevisiae
6ASO|1|I (6ASO)
  • Saccharomyces cerevisiae strain HB_S_GIM[...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.7 Å69(8) 6ASO|1|I, 5VSU|1|I, 5MPS|1|6, 5YLZ|1|D, 5Y88|1|D, 5GMK|1|E+5GMK|1|L, 5WSG|1|E, 5LQW|1|6+5LQW|1|2
477NR_all_66984.1
Exact match
Bacillus subtilis
3IVN|1|A (3IVN)
  • A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å69(2) 3IVN|1|A, 3IVN|1|B
478NR_all_85174.1
Exact match
Escherichia coli
1QF6|1|B (1QF6)
  • THREONINE TRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å69(1) 1QF6|1|B
479NR_all_88566.1
Exact match
Escherichia coli
3MOJ|1|A (3MOJ)
  • RNA (69-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å69(1) 3MOJ|1|A
480NR_all_92167.1
Exact match
synthetic construct
5OB3|1|A (5OB3)
  • RNA aptamer (69-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å69(1) 5OB3|1|A
481NR_all_03559.1
Exact match
1PN8|1|D (1PN8)
  • E-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
10.8 Å68(1) 1PN8|1|D
482NR_all_03710.1
Exact match
Escherichia coli
1C0A|1|B (1C0A)
  • ASPARTYL TRNA, ASPARTYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å68(3) 1C0A|1|B, 1EFW|1|D, 1EFW|1|C
483NR_all_10877.1
Exact match
Neisseria meningitidis
2N6W|6|A (2N6W)
  • RNA (68-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
68(1) 2N6W|6|A
484NR_all_19188.1
Exact match
Homo sapiens
4QEI|1|C (4QEI)
  • tRNA-Gly-CCC-2-2
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å68(1) 4QEI|1|C
485NR_all_40252.1
Exact match
2QUS|1|A (2QUS)
  • Hammerhead ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.4 Å68(2) 2QUS|1|A, 2QUS|1|B
486NR_all_56345.1
Exact match
Vibrio vulnificus
5SWD|1|B (5SWD)
  • Vibrio vulnificus strain 93U204 chromoso[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å68(4) 5SWD|1|B, 5E54|1|B, 5E54|1|A, 5SWD|1|A
487NR_all_61343.1
Exact match
1JGQ|1|D (1JGQ)
  • tRNA(Phe), p/E-tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
5.0 Å68(5) 1JGQ|1|D, 4V42|1|AD, 1JGO|1|D, 1JGP|1|D, 2OM7|1|M
488NR_all_65615.1
Exact match
Escherichia coli
5HR6|1|C (5HR6)
  • tRNA Glu
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å68(2) 5HR6|1|C, 5HR6|1|D
489NR_all_66174.1
Exact match
Murine leukemia virus
2MQT|2|A (2MQT)
  • RNA (68-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
68(1) 2MQT|2|A
490NR_all_68566.1
Exact match
Homo sapiens
4WZJ|1|XXX (4WZJ)
  • U4 small nuclear RNA variant: Native seq[...]
  • X-RAY DIFFRACTION
  • Chain(s): XXX; model(s): 1
3.6 Å68(24) 4WZJ|1|XXX, 4WZJ|1|VV, 4WZJ|1|YY, 4WZJ|1|VVV, 4WZJ|1|YYYY, 4WZJ|1|XX, 4WZJ|1|V, 4WZJ|1|XXXX, 4WZJ|1|YYY, 4WZJ|1|VVVV, 4WZJ|1|X, 4WZJ|1|Y, 4V5U|1|AX, 4V5U|1|AY, 4V5U|1|BY, 4V5U|1|DV, 4V5U|1|BV, 4V5U|1|CX, 4V5U|1|BX, 4V5U|1|CV, 4V5U|1|CY, 4V5U|1|DY, 4V5U|1|AV, 4V5U|1|DX
491NR_all_70496.1
Exact match
Bacillus subtilis
1Y27|1|X (1Y27)
  • Bacillus subtilis xpt
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.4 Å68(1) 1Y27|1|X
492NR_all_72021.1
Exact match
Murray Valley encephalitis virus
4PQV|1|A (4PQV)
  • XRN1-resistant flaviviral RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å68(1) 4PQV|1|A
493NR_all_88351.1
Exact match
Murine leukemia virus
2MQV|1|B (2MQV)
  • RNA (68-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
68(1) 2MQV|1|B
494NR_all_04451.1
Exact match
synthetic construct
2NC1|1|A (2NC1)
  • IRES RNA (67-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
67(1) 2NC1|1|A
495NR_all_15463.1
Exact match
Saccharomyces cerevisiae
6R5K|1|E (6R5K)
  • poly(A) RNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
4.8 Å67(1) 6R5K|1|E
496NR_all_17350.1
Exact match
Sus scrofa
6GAW|1|BB (6GAW)
  • tRNA-Phe, mitochondrial, CP tRNAPhe, mit[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BB; model(s): 1
3.2 Å67(2) 6GAW|1|BB, 6GB2|1|BB
497NR_all_23063.1
Exact match
Escherichia coli
6GSL|1|1L (6GSL)
  • tRNAArg, mRNA
  • X-RAY DIFFRACTION
  • Chain(s): 1L; model(s): 1
3.2 Å67(2) 6GSL|1|1L, 6GSL|1|1K
498NR_all_24819.2
Exact match
Saccharomyces cerevisiae
1IL2|1|C (1IL2)
  • ASPARTYL TRANSFER RNA, TRNAASP, T-RNA (7[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å67(12) 1IL2|1|C, 1IL2|1|D, 2TRA|1|A, 3TRA|1|A, 1ASZ|1|S, 1ASY|1|S, 1ASZ|1|R, 1ASY|1|R, 1VTQ|1|A, 3IZ7|1|B, 3J16|1|L, 4V6I|1|CB
499NR_all_27778.1
Exact match
Pyrococcus abyssi
5WT1|1|C (5WT1)
  • RNA (76-MER), RNA (73-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å67(3) 5WT1|1|C, 5WT1|1|F, 5WT3|1|C
500NR_all_61479.1
Exact match
Thermus thermophilus
5IBB|1|1L (5IBB)
  • tRNAVal, mRNA
  • X-RAY DIFFRACTION
  • Chain(s): 1L; model(s): 1
3.0 Å67(1) 5IBB|1|1L
501NR_all_69813.7
Exact match
Escherichia coli
6OF1|1|1w (6OF1)
  • A-site and E-site tRNAs, mRNA, tRNAVal, [...]
  • X-RAY DIFFRACTION
  • Chain(s): 1w; model(s): 1
2.8 Å67(40) 6OF1|1|1w, 5IBB|1|1K, 6CAE|1|1y, 6O97|1|1w, 6OF1|1|1y, 6BY1|1|AW, 6OF1|1|2w, 6O97|1|1y, 6ND6|1|1y, 6BY1|1|BW, 5IBB|1|3L, 6CAE|1|1w, 6BY1|1|BV, 6BY1|1|AV, 6OF1|1|2y, 6CAE|1|2y, 6ND6|1|1w, 6CAE|1|2w, 6O97|1|2y, 5IBB|1|3K, 6ND6|1|2y, 6O97|1|2w, 6ND6|1|2w, 6N1D|1|BPTN, 6N1D|1|APTN, 6BY1|1|AY, 4V7A|1|A1, 4V6Y|1|A1, 4V75|1|A1, 4V6Z|1|A1, 4V72|1|A1, 4V73|1|A1, 4V79|1|A1, 4V70|1|A1, 4V76|1|A1, 4V77|1|A1, 4V74|1|A1, 4V78|1|A1, 4V71|1|A1, 2K4C|1|A
502NR_all_76114.1
Exact match
3RKF|1|C (3RKF)
  • Guanine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å67(4) 3RKF|1|C, 3RKF|1|B, 3RKF|1|A, 3RKF|1|D
503NR_all_76703.4
Exact match
Escherichia coli
5E81|1|1K (5E81)
  • tRNA-Lys, mRNA, tRNALys, A-site Lysine t[...]
  • X-RAY DIFFRACTION
  • Chain(s): 1K; model(s): 1
3.0 Å67(19) 5E81|1|1K, 5EL6|1|1L, 5EL4|1|1K, 5IB8|1|1K, 5IB7|1|1K, 5E7K|1|1K, 5EL4|1|1L, 5EL6|1|1K, 5EL7|1|1K, 5E81|1|1L, 5E7K|1|1L, 5IB7|1|1L, 5EL7|1|1L, 5EL5|1|1K, 5EL5|1|1L, 5UYQ|1|Y, 5UYP|1|Y, 5JTE|1|AW, 5UYN|1|Y
504NR_all_89185.1
Exact match
Saccharomyces cerevisiae
5GAP|1|V (5GAP)
  • U4 snRNA, 5' region, nucleotides 1-67, U[...]
  • ELECTRON MICROSCOPY
  • Chain(s): V; model(s): 1
3.6 Å67(1) 5GAP|1|V
505NR_all_89292.4
Exact match
Escherichia coli
4WQ1|1|3K (4WQ1)
  • tRNA-Tyr, mRNA, A tRNA, tRNA
  • X-RAY DIFFRACTION
  • Chain(s): 3K; model(s): 1
3.1 Å67(31) 4WQ1|1|3K, 4WU1|1|3L, 4WQ1|1|1K, 4WU1|1|3K, 4V8D|1|CD, 4WQ1|1|3L, 4WR6|1|3K, 4WRA|1|3K, 4WU1|1|2L, 4WR6|1|3L, 4WR6|1|1K, 4V8D|1|AD, 4WU1|1|2K, 4WRA|1|1K, 4WRA|1|3L, 4V8D|1|AB, 4WQ1|1|1L, 4V8E|1|BD, 4WR6|1|1L, 4V8E|1|DD, 4V8F|1|CD, 4V8F|1|BD, 4WRA|1|1L, 4V8D|1|CB, 4V8E|1|BB, 4V8E|1|DB, 4V8F|1|BB, 6N1D|1|BATN, 4V8F|1|CB, 6K0B|1|V, 6K0B|1|U
506NR_all_89429.3
Exact match
4FEN|1|B (4FEN)
  • A24U/U25A/A46G mutant of the B. subtilis[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å67(29) 4FEN|1|B, 4FEO|1|B, 4FEL|1|B, 4FEP|1|B, 4FEJ|1|B, 4FE5|1|B, 2XNZ|1|A, 2XNW|1|A, 3GOT|1|A, 2G9C|1|A, 3GAO|1|A, 3GER|1|A, 2EES|1|A, 3GOG|1|A, 3DS7|1|A, 2EET|1|A, 3FO4|1|A, 2EEV|1|A, 3DS7|1|B, 5C7U|1|B, 3FO6|1|A, 3G4M|1|A, 3GES|1|A, 2B57|1|A, 2EEW|1|A, 2EEU|1|A, 5C7W|1|C, 2XO1|1|A, 1U8D|1|A
507NR_all_14758.1
Exact match
3R4F|1|A (3R4F)
  • pRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.5 Å66(1) 3R4F|1|A
508NR_all_21705.1
Exact match
3SKI|1|A (3SKI)
  • RNA (68-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å66(8) 3SKI|1|A, 3SKI|1|B, 3SLM|1|B, 3SKZ|1|A, 3SLM|1|A, 3SLQ|1|A, 3SKZ|1|B, 3SLQ|1|B
509NR_all_33831.1
Exact match
Murine leukemia virus
2L1F|1|B (2L1F)
  • RNA (66-MER), RNA (65-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
66(2) 2L1F|1|B, 2L1F|1|A
510NR_all_34221.1
Exact match
Escherichia coli
1B23|1|R (1B23)
  • CYSTEINYL TRNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.6 Å66(1) 1B23|1|R
511NR_all_34846.1
Exact match
Escherichia coli
5L3P|1|y (5L3P)
  • deacylated A/R-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): y; model(s): 1
3.7 Å66(1) 5L3P|1|y
512NR_all_06870.1
Exact match
Escherichia coli
5JU8|1|AY (5JU8)
  • E-site tRNA Valine, mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): AY; model(s): 1
3.6 Å65(2) 5JU8|1|AY, 5JTE|1|AY
513NR_all_18489.2
Exact match
Saccharomyces cerevisiae
6ELZ|1|6 (6ELZ)
  • Internal transcribed spacer 2, ITS2, ITS[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
3.3 Å65(6) 6ELZ|1|6, 6C0F|1|6, 3JCT|1|6, 6EM1|1|6, 6CB1|1|6, 5Z3G|1|C
514NR_all_26284.1
Exact match
Thermus thermophilus
1H4S|1|T (1H4S)
  • TRNAPRO(CGG)
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.9 Å65(2) 1H4S|1|T, 1H4Q|1|T
515NR_all_30439.1
Exact match
3EGZ|1|B (3EGZ)
  • Tetracycline aptamer and artificial ribo[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å65(1) 3EGZ|1|B
516NR_all_60469.1
Exact match
4N0T|1|B (4N0T)
  • U6 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å65(3) 4N0T|1|B, 5TF6|1|B, 5TF6|1|D
517NR_all_72858.1
Exact match
Oryctolagus cuniculus
4CXG|1|Y (4CXG)
  • TRANSFER RNA, MESSENGER RNA
  • ELECTRON MICROSCOPY
  • Chain(s): Y; model(s): 1
8.7 Å65(2) 4CXG|1|Y, 4CXH|1|Y
518NR_all_06099.1
Exact match
Escherichia coli
486D|1|A (486D)
  • P-SITE TRNA OF 70S RIBOSOME, P-SITE CODO[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
7.5 Å64(1) 486D|1|A
519NR_all_08854.1
Exact match
Thermus thermophilus
5IB8|1|1L (5IB8)
  • tRNALys, mRNA
  • X-RAY DIFFRACTION
  • Chain(s): 1L; model(s): 1
3.1 Å64(1) 5IB8|1|1L
520NR_all_47330.1
Exact match
3SKL|1|B (3SKL)
  • RNA (66-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å64(8) 3SKL|1|B, 3SKT|1|A, 3SKT|1|B, 3SKL|1|A, 3SKW|1|A, 3SKR|1|A, 3SKR|1|B, 3SKW|1|B
521NR_all_48352.1
Exact match
Actinomyces odontolyticus
4XWF|1|A (4XWF)
  • pfl RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å64(2) 4XWF|1|A, 4XW7|1|A
522NR_all_55114.1
Exact match
Geobacillus stearothermophilus
5B63|1|D (5B63)
  • tRNA-Arg, TRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å64(4) 5B63|1|D, 5B63|1|B, 5YYN|1|D, 5YYN|1|B
523NR_all_55424.1
Exact match
Homo sapiens
3NKB|1|B (3NKB)
  • The hepatitis delta virus ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å64(1) 3NKB|1|B
524NR_all_64096.1
Exact match
Thermus thermophilus
486D|1|E (486D)
  • E-SITE TRNA OF 70S RIBOSOME
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
7.5 Å64(1) 486D|1|E
525NR_all_83181.1
Exact match
2DLC|1|Y (2DLC)
  • T-RNA (76-MER)
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.4 Å64(1) 2DLC|1|Y
526NR_all_99632.5
Exact match
Saccharomyces cerevisiae
6FYY|1|1 (6FYY)
  • tRNAi, mRNA (31-MER), YEAST INITIATOR TR[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
3.0 Å64(8) 6FYY|1|1, 6FYX|1|1, 1YFG|1|A, 5OA3|1|1, 3J81|1|1, 6GSM|1|1, 6GSN|1|1, 3JAQ|1|1
527NR_all_06653.1
Exact match
Escherichia coli
3J45|1|1 (3J45)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
9.5 Å63(2) 3J45|1|1, 3J46|1|1
528NR_all_07161.1
Exact match
Saccharomyces cerevisiae
2WW9|1|D (2WW9)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
8.6 Å63(2) 2WW9|1|D, 2WWA|1|D
529NR_all_12174.1
Exact match
Triticum aestivum
2WWB|1|D (2WWB)
  • 5.8S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
6.5 Å63(1) 2WWB|1|D
530NR_all_82534.3
Exact match
1F7U|1|B (1F7U)
  • TRNA(ARG), P-site tRNA, mRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å63(4) 1F7U|1|B, 1F7V|1|B, 6Q8Y|1|n, 6I7O|1|n
531NR_all_03470.1
Exact match
Thermus thermophilus
1SER|1|T (1SER)
  • TRNASER
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.9 Å62(1) 1SER|1|T
532NR_all_06843.2
Exact match
1EVV|1|A (1EVV)
  • PHENYLALANINE TRANSFER RNA, 76mer-tRNA, [...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å62(47) 1EVV|1|A, 3WC2|1|P, 3WC2|1|Q, 4V4R|1|AV, 1SZ1|1|F, 1SZ1|1|E, 4V4S|1|AV, 4V4T|1|AV, 4V4R|1|AW, 4V4S|1|AW, 4V4T|1|AW, 4V49|1|AW, 4V49|1|AV, 1TTT|1|F, 1TTT|1|D, 1TTT|1|E, 1JGQ|1|C, 1JGQ|1|B, 4V42|1|AC, 4V42|1|AB, 1JGO|1|C, 1JGO|1|B, 4V69|1|AY, 1JGP|1|C, 1JGP|1|B, 4V66|1|AE, 3EP2|1|Y, 3EQ3|1|Y, 4V65|1|AE, 4V65|1|AA, 4V66|1|AA, 4V66|1|AP, 4V65|1|AP, 4V48|1|A6, 3DEG|1|A, 1MJ1|1|C, 1ZO1|1|F, 1ZO3|1|A, 1ZO3|1|B, 1ML5|1|B, 1MJ1|1|D, 4V4W|1|AW, 4V4W|1|AV, 4V4W|1|AU, 4V4V|1|AV, 4V4V|1|AW, 4V4V|1|AU
533NR_all_17498.1
Exact match
3ICQ|1|E (3ICQ)
  • RNA (62-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å62(2) 3ICQ|1|E, 3ICQ|1|D
534NR_all_43578.1
Exact match
Thermomyces lanuginosus
4V7H|1|A7 (4V7H)
  • P/E tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A7; model(s): 1
8.9 Å62(1) 4V7H|1|A7
535NR_all_45460.1
Exact match
Neurospora crassa
2N3R|5|A (2N3R)
  • RNA (62-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
62(1) 2N3R|5|A
536NR_all_51522.1
Exact match
1PN7|1|C (1PN7)
  • P-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
10.8 Å62(1) 1PN7|1|C
537NR_all_51962.2
Exact match
Escherichia coli
4YCP|1|B (4YCP)
  • tRNATrp, A-SITE TRNA G24A TRP-TRNA TRP, [...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å62(15) 4YCP|1|B, 4V5S|1|AY, 4V5R|1|CY, 4V5S|1|CY, 4V5R|1|AY, 4V5L|1|AY, 4V5Q|1|AY, 4V5Q|1|CY, 4V5P|1|AY, 4V5P|1|CY, 4V6R|1|AB, 4V6Q|1|AB, 4V6N|1|BB, 4V6P|1|AB, 4V6O|1|AB
538NR_all_64375.1
Exact match
synthetic construct
5BTP|1|B (5BTP)
  • RNA (62-MER), RNA (75-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å62(4) 5BTP|1|B, 5BTP|1|A, 6OD9|1|B, 6OD9|1|A
539NR_all_90775.1
Exact match
Bos taurus
1FIR|1|A (1FIR)
  • HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA([...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.3 Å62(1) 1FIR|1|A
540NR_all_91379.1
Exact match
synthetic construct
2N3Q|8|A (2N3Q)
  • RNA (62-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
62(1) 2N3Q|8|A
541NR_all_03414.1
Exact match
Leishmania donovani
3JCS|1|6 (3JCS)
  • 26S zeta ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
2.8 Å61(1) 3JCS|1|6
542NR_all_35537.1
Exact match
Thermus aquaticus
2Z9Q|1|A (2Z9Q)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
11.7 Å61(1) 2Z9Q|1|A
543NR_all_39792.1
Exact match
Escherichia coli
4U7U|1|L (4U7U)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.0 Å61(2) 4U7U|1|L, 4U7U|1|X
544NR_all_45112.1
Exact match
Saccharomyces cerevisiae
486D|1|C (486D)
  • A-SITE TRNA OF 70S RIBOSOME, A-SITE CODO[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
7.5 Å61(1) 486D|1|C
545NR_all_45855.1
Exact match
Thermus thermophilus
4V8Q|1|BY (4V8Q)
  • TMRNA DELA
  • X-RAY DIFFRACTION
  • Chain(s): BY; model(s): 1
3.1 Å61(1) 4V8Q|1|BY
546NR_all_46720.2
Exact match
Synechococcus elongatus
5DDP|1|A (5DDP)
  • RNA (61-MER), L-glutamine riboswitch RNA[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å61(4) 5DDP|1|A, 5DDP|1|B, 5DDR|1|B, 5DDR|1|A
547NR_all_52305.1
Exact match
Escherichia coli
3J45|1|4 (3J45)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
9.5 Å61(1) 3J45|1|4
548NR_all_75381.1
Exact match
Xenopus laevis
1UN6|1|F (1UN6)
  • 5S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.1 Å61(2) 1UN6|1|F, 1UN6|1|E
549NR_all_99751.1
Exact match
2HVY|1|E (2HVY)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.3 Å61(1) 2HVY|1|E
550NR_all_23049.1
Exact match
Thermus thermophilus
1KUQ|1|B (1KUQ)
  • 16S RIBOSOMAL RNA FRAGMENT, RRNA FRAGMEN[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å60(3) 1KUQ|1|B, 1F7Y|1|B, 1DK1|1|B
551NR_all_34126.1
Exact match
3HAX|1|E (3HAX)
  • H/ACA RNA, 5'-R(*AP*UP*AP*AP*UP*UP*(FHU)[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.1 Å60(1) 3HAX|1|E
552NR_all_36097.1
Exact match
Pseudomonas aeruginosa
6B48|1|M (6B48)
  • Pseudomonas aeruginosa strain SMC4485 CR[...]
  • ELECTRON MICROSCOPY
  • Chain(s): M; model(s): 1
3.6 Å60(1) 6B48|1|M
553NR_all_37236.1
Exact match
Pseudomonas aeruginosa
6B46|1|M (6B46)
  • Pseudomonas aeruginosa strain SMC4485 CR[...]
  • ELECTRON MICROSCOPY
  • Chain(s): M; model(s): 1
3.1 Å60(4) 6B46|1|M, 6B47|1|M, 5UZ9|2|M, 6B45|1|M
554NR_all_39150.1
Exact match
2CZJ|1|H (2CZJ)
  • tmRNA (63-MER)
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å60(4) 2CZJ|1|H, 2CZJ|1|B, 2CZJ|1|F, 2CZJ|1|D
555NR_all_59317.1
Exact match
synthetic construct
6DB9|1|R (6DB9)
  • RNA (60-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.0 Å60(2) 6DB9|1|R, 6DB8|1|R
556NR_all_70313.2
Exact match
Escherichia coli
5H9F|1|L (5H9F)
  • crRNA (61-MER), crRNA, Escherichia coli [...]
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.5 Å60(6) 5H9F|1|L, 5CD4|1|L, 5CD4|1|X, 5H9E|1|L, 4TVX|1|X, 4TVX|1|L
557NR_all_74932.1
Exact match
Pseudomonas aeruginosa
6B44|1|M (6B44)
  • Pseudomonas aeruginosa strain SMC4485 CR[...]
  • ELECTRON MICROSCOPY
  • Chain(s): M; model(s): 1
2.9 Å60(1) 6B44|1|M
558NR_all_76909.1
Exact match
3RW6|1|H (3RW6)
  • constitutive transport element(CTE)of Ma[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.3 Å60(2) 3RW6|1|H, 3RW6|1|F
559NR_all_85143.1
Exact match
Escherichia coli
3IZZ|1|D (3IZZ)
  • Helix 18 (Small Subunit)
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
10.8 Å60(1) 3IZZ|1|D
560NR_all_12803.1
Exact match
2MIY|5|A (2MIY)
  • RNA_(59-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
59(1) 2MIY|5|A
561NR_all_33278.1
Exact match
Homo sapiens
5LYS|1|B (5LYS)
  • 7SK RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å59(6) 5LYS|1|B, 5LYV|1|B, 5LYS|1|A, 5LYU|1|B, 5LYU|1|A, 5LYV|1|A
562NR_all_38581.2
Exact match
Thermobifida fusca
6C66|1|J (6C66)
  • crRNA
  • ELECTRON MICROSCOPY
  • Chain(s): J; model(s): 1
3.7 Å59(3) 6C66|1|J, 5U0A|1|K, 5U07|1|K
563NR_all_48748.1
Exact match
metagenome
5T5A|1|A (5T5A)
  • DNA/RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å59(1) 5T5A|1|A
564NR_all_52315.1
Exact match
4M4O|1|B (4M4O)
  • RNA (59-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å59(1) 4M4O|1|B
565NR_all_59748.1
Exact match
Thermus thermophilus
1ZC8|1|A (1ZC8)
  • TLD 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
13.0 Å59(1) 1ZC8|1|A
566NR_all_69815.1
Exact match
Escherichia coli
3IZZ|1|A (3IZZ)
  • Helix 5, 14, 15 (Small Subunit)
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
10.8 Å59(1) 3IZZ|1|A
567NR_all_78535.1
Exact match
Thermus thermophilus
1ZC8|1|H (1ZC8)
  • protein kinase 2 mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
13.0 Å59(1) 1ZC8|1|H
568NR_all_91367.1
Exact match
Escherichia coli
1ZN1|1|B (1ZN1)
  • ribosomal 23S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
14.1 Å59(1) 1ZN1|1|B
569NR_all_98672.1
Exact match
Escherichia coli
1MVR|1|D (1MVR)
  • Helix 89 of 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
12.8 Å59(1) 1MVR|1|D
570NR_all_04153.1
Exact match
Thermus thermophilus
2OM7|1|I (2OM7)
  • Fragment of23S rRNA (H42-44)
  • ELECTRON MICROSCOPY
  • Chain(s): I; model(s): 1
7.3 Å58(1) 2OM7|1|I
571NR_all_04601.1
Exact match
Synechococcus elongatus
5DDO|1|B (5DDO)
  • L-glutamine riboswitch (58-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å58(1) 5DDO|1|B
572NR_all_39651.1
Exact match
3HJW|1|D (3HJW)
  • RNA (58-MER), 5'-R(*GP*AP*GP*CP*GP*(FHU)[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å58(6) 3HJW|1|D, 3LWV|1|D, 3LWR|1|D, 3LWP|1|D, 3LWO|1|D, 3LWQ|1|D
573NR_all_48288.1
Exact match
Homo sapiens
5ZAL|1|C (5ZAL)
  • RNA (73-mer)
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
4.7 Å58(2) 5ZAL|1|C, 5ZAM|1|C
574NR_all_60266.1
Exact match
6MPU|1|M (6MPU)
  • CRISPR RNA (60-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): M; model(s): 1
58(2) 6MPU|1|M, 6NE0|1|M
575NR_all_62394.1
Exact match
synthetic construct
2M58|2|A (2M58)
  • RNA (59-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
58(1) 2M58|2|A
576NR_all_69350.1
Exact match
Synechococcus elongatus
5DDO|1|A (5DDO)
  • L-glutamine riboswitch (58-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å58(1) 5DDO|1|A
577NR_all_74849.1
Exact match
1MMS|1|C (1MMS)
  • 23S RIBOSOMAL RNA, 58nts of 23S rRNA, FR[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å58(7) 1MMS|1|C, 1MMS|1|D, 1R2X|1|C, 1R2W|1|C, 1EG0|1|L, 1OLN|1|C, 2JQ7|3|B
578NR_all_75200.1
Exact match
Salmonella enterica
4V2S|1|Q (4V2S)
  • RYDC
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
3.5 Å58(1) 4V2S|1|Q
579NR_all_99303.1
Exact match
synthetic construct
5XWP|1|C (5XWP)
  • RNA (59-MER), RNA (30-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.1 Å58(2) 5XWP|1|C, 5XWP|1|E
580NR_all_20840.1
Exact match
Homo sapiens
5IEM|9|A (5IEM)
  • 7SK snRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
57(1) 5IEM|9|A
581NR_all_36634.1
Exact match
2QUW|1|B (2QUW)
  • Hammerhead ribozyme, cleaved fragment
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å57(2) 2QUW|1|B, 2QUW|1|D
582NR_all_57578.1
Exact match
Saccharomyces cerevisiae
6I7O|1|l (6I7O)
  • mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): l; model(s): 1
5.3 Å57(1) 6I7O|1|l
583NR_all_95614.1
Exact match
Escherichia coli
1HC8|1|C (1HC8)
  • 58 NUCLEOTIDE RIBOSOMAL 23S RNA DOMAIN, [...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å57(7) 1HC8|1|C, 1HC8|1|D, 1Y39|1|C, 1Y39|1|D, 1QA6|1|C, 1QA6|1|D, 1C04|1|E
584NR_all_26186.1
Exact match
4JRC|1|B (4JRC)
  • Distal Stem I region of the glyQS T box [...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å56(2) 4JRC|1|B, 4JRC|1|A
585NR_all_41221.1
Exact match
Murine leukemia virus
2LC8|1|A (2LC8)
  • RNA (56-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
56(1) 2LC8|1|A
586NR_all_46354.1
Exact match
Homo sapiens
6NU2|1|B (6NU2)
  • mt-tRNAVal
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.9 Å56(2) 6NU2|1|B, 6NU3|1|B
587NR_all_75133.1
Exact match
Fusobacterium nucleatum
6DN2|1|Y+6DN2|1|X (6DN2)
  • RNA (56-MER), RNA RIBOSWITCH, FMN ribosw[...]
  • X-RAY DIFFRACTION
  • Chain(s): X, Y, i; model(s): 1
2.9 Å56(7) 6DN2|1|Y+6DN2|1|X, 6DN3|1|Y+6DN3|1|X, 3F4H|1|Y+3F4H|1|X, 6DN1|1|Z+6DN1|1|X, 6BFB|1|Y+6BFB|1|X, 3F4E|1|Y+3F4E|1|X, 2YIF|1|Z+2YIF|1|X
588NR_all_98871.1
Exact match
Homo sapiens
5OOL|1|B (5OOL)
  • mitochondrial tRNAVal, mt-tRNAVal
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.1 Å56(4) 5OOL|1|B, 5OOM|1|B, 3J7Y|1|B, 3J9M|1|B
589NR_all_02307.1
Exact match
Mitsuaria sp. 67
4WT8|1|DV (4WT8)
  • DNA (55-MER), tRNA (5'-D(*AP*UP*CP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): DV; model(s): 1
3.4 Å55(1) 4WT8|1|DV
590NR_all_21686.1
Exact match
2HGH|1|B (2HGH)
  • 55-MER
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
55(1) 2HGH|1|B
591NR_all_26582.1
Exact match
4K27|1|U (4K27)
  • Myotonic Dystrophy Type 2 RNA
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.4 Å55(1) 4K27|1|U
592NR_all_29106.1
Exact match
Escherichia coli
4QYZ|1|L (4QYZ)
  • RNA (55-MER)
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.0 Å55(1) 4QYZ|1|L
593NR_all_46884.1
Exact match
1MZP|1|B (1MZP)
  • fragment of 23S rRNA, 25S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å55(2) 1MZP|1|B, 2NOQ|1|E
594NR_all_53209.1
Exact match
Bacillus subtilis
2KZL|2|A (2KZL)
  • RNA (55-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
55(1) 2KZL|2|A
595NR_all_55702.1
Exact match
1C9S|1|W (1C9S)
  • SINGLE STRANDED RNA (55-MER)
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
1.9 Å55(1) 1C9S|1|W
596NR_all_68829.1
Exact match
1P5M|10|A (1P5M)
  • 55-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 10
55(1) 1P5M|10|A
597NR_all_88023.1
Exact match
Homo sapiens
6MCI|1|A (6MCI)
  • 7SK RNA, 7SK Stem-loop 1 RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
55(2) 6MCI|1|A, 6MCF|2|A
598NR_all_18889.3
Exact match
Fusobacterium nucleatum
5C45|1|X+5C45|1|Y (5C45)
  • FMN Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X, Y, i; model(s): 1
2.9 Å54(4) 5C45|1|X+5C45|1|Y, 5KX9|1|X+5KX9|1|Y, 3F4G|1|X+3F4G|1|Y, 2YIE|1|X+2YIE|1|Z
599NR_all_19502.2
Exact match
synthetic construct
4RGE|1|C (4RGE)
  • env22 twister ribozyme, RNA (54-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å54(7) 4RGE|1|C, 4RGE|1|B, 4RGE|1|A, 5DUN|1|A, 4RGF|1|A, 4RGF|1|B, 4RGF|1|C
600NR_all_24202.1
Exact match
Homo sapiens
4PKD|1|V (4PKD)
  • U1 snRNA stem-loops 1 and 2 (55-MER)
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.5 Å54(1) 4PKD|1|V
601NR_all_42833.1
Exact match
Thermus thermophilus
2OM7|1|G (2OM7)
  • Fragment of23S rRNA (H68)
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
7.3 Å54(1) 2OM7|1|G
602NR_all_69504.1
Exact match
Canis lupus
4V5Z|1|BE (4V5Z)
  • RNA Expansion segment ES7 part II
  • ELECTRON MICROSCOPY
  • Chain(s): BE; model(s): 1
8.7 Å54(1) 4V5Z|1|BE
603NR_all_24404.1
Exact match
2MHI|6|A (2MHI)
  • Medaka telomerase RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
53(1) 2MHI|6|A
604NR_all_43318.1
Exact match
2N4L|6|A (2N4L)
  • RNA (53-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
53(1) 2N4L|6|A
605NR_all_79184.1
Exact match
4GCW|1|B (4GCW)
  • TRNA(THR)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å53(2) 4GCW|1|B, 2FK6|1|R
606NR_all_79951.1
Exact match
4OJI|1|A (4OJI)
  • RNA (52-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å53(1) 4OJI|1|A
607NR_all_04979.1
Exact match
6AAY|1|B (6AAY)
  • RNA (52-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å52(1) 6AAY|1|B
608NR_all_16133.1
Exact match
Thermus thermophilus
1ZC8|1|J (1ZC8)
  • protein kinase 4 mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): J; model(s): 1
13.0 Å52(1) 1ZC8|1|J
609NR_all_58167.1
Exact match
3E5C|1|A (3E5C)
  • SMK box (SAM-III) Riboswitch, SMK box (S[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å52(3) 3E5C|1|A, 3E5F|1|A, 3E5E|1|A
610NR_all_61114.1
Exact match
Saccharomyces cerevisiae
5YDT|1|SA (5YDT)
  • Saccharomyces cerevisiae strain ALI 308 [...]
  • ELECTRON MICROSCOPY
  • Chain(s): SA; model(s): 1
4.5 Å52(1) 5YDT|1|SA
611NR_all_70511.1
Exact match
6E9F|1|B+6E9F|1|C (6E9F)
  • crRNA (52-MER), RNA (27-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B, C, i; model(s): 1
3.3 Å52(1) 6E9F|1|B+6E9F|1|C
612NR_all_82984.1
Exact match
Thermotoga petrophila
4ENC|1|A (4ENC)
  • Fluoride riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å52(5) 4ENC|1|A, 4ENB|1|A, 3VRS|1|A, 4ENA|1|A, 4EN5|1|A
613NR_all_83080.1
Exact match
2QWY|1|C (2QWY)
  • SAM-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å52(3) 2QWY|1|C, 2QWY|1|A, 2QWY|1|B
614NR_all_02553.1
Exact match
Pyrococcus horikoshii
5Y7M|1|D (5Y7M)
  • RNA (52-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å51(2) 5Y7M|1|D, 5Y7M|1|B
615NR_all_27521.1
Exact match
6E9E|1|B (6E9E)
  • crRNA (52-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.4 Å51(1) 6E9E|1|B
616NR_all_36591.1
Exact match
synthetic construct
5XWY|1|B (5XWY)
  • RNA (59-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.2 Å51(1) 5XWY|1|B
617NR_all_83027.1
Exact match
Ralstonia solanacearum
3NPQ|1|A (3NPQ)
  • S-ADENOSYLHOMOCYSTEINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å51(4) 3NPQ|1|A, 3NPQ|1|C, 3NPQ|1|B, 3NPN|1|A
618NR_all_12561.1
Exact match
6QN3|1|A+6QN3|1|B (6QN3)
  • RNA (51-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A, B, i; model(s): 1
2.3 Å50(1) 6QN3|1|A+6QN3|1|B
619NR_all_28256.1
Exact match
Oryctolagus cuniculus
3J0O|1|7 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
9.0 Å50(4) 3J0O|1|7, 3J0L|1|7, 3J0Q|1|7, 3J0P|1|7
620NR_all_43355.1
Exact match
Oryctolagus cuniculus
4CXG|1|2 (4CXG)
  • 28S RRNA - H89
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
8.7 Å50(2) 4CXG|1|2, 4CXH|1|2
621NR_all_65403.1
Exact match
6IV9|1|B (6IV9)
  • crRNA (50-MER), RNA (51-MER), RNA (53-ME[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å50(3) 6IV9|1|B, 6IV8|1|B, 6IV8|1|D
622NR_all_69065.1
Exact match
Oryctolagus cuniculus
3J0L|1|1 (3J0L)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
9.8 Å50(1) 3J0L|1|1
623NR_all_23226.1
Exact match
metagenome
5KTJ|1|A (5KTJ)
  • Pistol (50-MER), RNA (5'-R(*UP*CP*UP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å49(2) 5KTJ|1|A, 5KTJ|1|C
624NR_all_23978.1
Exact match
1U63|1|D (1U63)
  • 49 NT FRAGMENT OF MRNA FOR L1
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.4 Å49(2) 1U63|1|D, 1U63|1|B
625NR_all_28320.1
Exact match
Saccharomyces cerevisiae
2LU0|7|A (2LU0)
  • RNA (49-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
49(1) 2LU0|7|A
626NR_all_30691.1
Exact match
1RMN|1|A (1RMN)
  • RNA (49-MER)
  • FLUORESCENCE TRANSFER
  • Chain(s): A; model(s): 1
49(1) 1RMN|1|A
627NR_all_54091.1
Exact match
Thermus thermophilus
1ZC8|1|I (1ZC8)
  • protein kinase 3
  • ELECTRON MICROSCOPY
  • Chain(s): I; model(s): 1
13.0 Å49(1) 1ZC8|1|I
628NR_all_76196.1
Exact match
Homo sapiens
1E8O|1|E (1E8O)
  • 7SL RNA, SRP Alu domain
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å49(2) 1E8O|1|E, 1RY1|1|E
629NR_all_80776.1
Exact match
6R47|1|A (6R47)
  • RNA (50-MER), RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å49(1) 6R47|1|A
630NR_all_81496.1
Exact match
metagenome
5Y85|1|D (5Y85)
  • DNA/RNA (50-MER), RNA (5'-R(P*AP*CP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å49(4) 5Y85|1|D, 5Y85|1|B, 5Y87|1|D, 5Y87|1|B
631NR_all_00810.1
Exact match
Escherichia coli
4C7O|1|E (4C7O)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.6 Å48(1) 4C7O|1|E
632NR_all_09706.1
Exact match
Methanocaldococcus jannaschii
2VPL|1|B (2VPL)
  • FRAGMENT OF MRNA FOR L1-OPERON CONTAININ[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å48(2) 2VPL|1|B, 2VPL|1|D
633NR_all_10054.2
Exact match
synthetic construct
5DH6|1|A (5DH6)
  • hammerhead ribozyme, RNA (48-MER), RNA ([...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å48(8) 5DH6|1|A, 5DI4|1|A, 5DQK|1|A, 5EAO|1|A, 5DH7|1|A, 5DI2|1|A, 5DH8|1|A, 5EAQ|1|A
634NR_all_11528.1
Exact match
2M8K|5|A (2M8K)
  • RNA (48-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
48(1) 2M8K|5|A
635NR_all_17139.1
Exact match
Drosophila melanogaster
2KUU|1|A (2KUU)
  • K10 TLS RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
48(4) 2KUU|1|A, 2KUV|6|A, 2KUR|10|A, 2KE6|1|A
636NR_all_18260.1
Exact match
Oryctolagus cuniculus
4CXG|1|a (4CXG)
  • 18S RRNA - H5-H14
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
8.7 Å48(2) 4CXG|1|a, 4CXH|1|a
637NR_all_24952.1
Exact match
synthetic construct
6GOV|1|R (6GOV)
  • RNA (TRANSCRIPTION BUBBLE)
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.7 Å48(1) 6GOV|1|R
638NR_all_27023.1
Exact match
3LQX|1|B (3LQX)
  • SRP RNA, 4.5S RNA DOMAIN IV, 4.5 S RNA, [...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å48(14) 3LQX|1|B, 1HQ1|1|B, 2PXE|1|B, 2PXD|1|B, 2PXT|1|B, 2PXB|1|B, 2PXF|1|B, 2PXP|1|B, 2PXL|1|B, 2PXV|1|B, 2PXU|1|B, 2PXK|1|B, 2PXQ|1|B, 1DUL|1|B
639NR_all_30893.1
Exact match
Escherichia coli
3EP2|1|B (3EP2)
  • Fragment H43-44 of the 23S rRNA, ribosom[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
9.0 Å48(4) 3EP2|1|B, 3EQ3|1|B, 3EQ4|1|B, 3J0D|1|A
640NR_all_31040.1
Exact match
Drosophila melanogaster
5ZTM|1|C (5ZTM)
  • non-coding mRNA sequence roX2
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å48(1) 5ZTM|1|C
641NR_all_56210.1
Exact match
Canis lupus
4V5Z|1|BG (4V5Z)
  • RNA Expansion segment ES9
  • ELECTRON MICROSCOPY
  • Chain(s): BG; model(s): 1
8.7 Å48(1) 4V5Z|1|BG
642NR_all_56431.1
Exact match
synthetic construct
6GZK|1|A (6GZK)
  • TMR3 (48-MER), tetramethylrhodamine apta[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
48(2) 6GZK|1|A, 6GZR|2|A
643NR_all_65349.1
Exact match
Oryctolagus cuniculus
3J0O|1|a (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
9.0 Å48(4) 3J0O|1|a, 3J0L|1|a, 3J0Q|1|a, 3J0P|1|a
644NR_all_76472.1
Exact match
Drosophila melanogaster
2KUW|2|A (2KUW)
  • K10 TLS RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
48(1) 2KUW|2|A
645NR_all_83636.1
Exact match
Escherichia coli
5LZD|1|x (5LZD)
  • SECIS mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): x; model(s): 1
3.4 Å48(3) 5LZD|1|x, 5LZC|1|x, 5LZB|1|x
646NR_all_93589.1
Exact match
3J2K|1|1 (3J2K)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
48(1) 3J2K|1|1
647NR_all_00301.1
Exact match
Homo sapiens
6BG9|1|A+6BG9|1|B (6BG9)
  • RNA dimerization signal
  • ELECTRON MICROSCOPY, SOLUTION NMR
  • Chain(s): A, B, i; model(s): 1
47(1) 6BG9|1|A+6BG9|1|B
648NR_all_05707.1
Exact match
4QJH|1|F (4QJH)
  • Twister Ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.9 Å47(3) 4QJH|1|F, 4QJH|1|B, 4QJH|1|D
649NR_all_06780.1
Exact match
1S03|1|A (1S03)
  • 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å47(1) 1S03|1|A
650NR_all_07004.1
Exact match
1S03|1|B (1S03)
  • 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å47(1) 1S03|1|B
651NR_all_07351.1
Exact match
Neurospora crassa
2MTK|5|A (2MTK)
  • RNA (47-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
47(1) 2MTK|5|A
652NR_all_11458.2
Exact match
Oryzias latipes
4O26|1|E (4O26)
  • Telomerase TR
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å47(2) 4O26|1|E, 4O26|1|F
653NR_all_36148.1
Exact match
synthetic construct
5KH8|2|A (5KH8)
  • riboswitch (47-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
47(1) 5KH8|2|A
654NR_all_42222.1
Exact match
synthetic construct
5K7D|1|A (5K7D)
  • RNA 47-MER, DNA/RNA 11-MER
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å47(3) 5K7D|1|A, 5K7C|1|A, 5K7E|1|A
655NR_all_44868.1
Exact match
6FZ0|1|A (6FZ0)
  • metY SAM V (53-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å47(1) 6FZ0|1|A
656NR_all_48307.1
Exact match
1YMO|11|A (1YMO)
  • Telomerase RNA P2b-P3 pseudoknot
  • SOLUTION NMR
  • Chain(s): A; model(s): 11
47(3) 1YMO|11|A, 2K95|6|A, 2K96|1|A
657NR_all_65047.1
Exact match
Neurospora crassa
2MTJ|1|A (2MTJ)
  • RNA (47-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
47(1) 2MTJ|1|A
658NR_all_68259.1
Exact match
Homo sapiens
5UNE|1|A+5UNE|1|B (5UNE)
  • RNA (47-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A, B, i; model(s): 1
2.9 Å47(1) 5UNE|1|A+5UNE|1|B
659NR_all_84961.1
Exact match
Homo sapiens
4PJO|1|1 (4PJO)
  • U1 RNA variant (48-MER) with 4-helix jun[...]
  • X-RAY DIFFRACTION
  • Chain(s): 1; model(s): 1
3.3 Å47(4) 4PJO|1|1, 4PJO|1|2, 4PJO|1|3, 4PJO|1|4
660NR_all_01806.1
Exact match
3IAB|1|R (3IAB)
  • P3 domain of the RNA component of RNase [...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å46(1) 3IAB|1|R
661NR_all_08212.1
Exact match
1XJR|1|A (1XJR)
  • s2m RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å46(1) 1XJR|1|A
662NR_all_17773.1
Exact match
3CIY|1|C+3CIY|1|D (3CIY)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): C, D, i; model(s): 1
3.4 Å46(1) 3CIY|1|C+3CIY|1|D
663NR_all_23835.1
Exact match
Pyrococcus horikoshii
5XTM|1|B (5XTM)
  • RNA (47-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å46(1) 5XTM|1|B
664NR_all_34740.1
Exact match
4QJD|1|D (4QJD)
  • Twister RNA sequence
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å46(4) 4QJD|1|D, 4QJD|1|B, 4QJD|1|H, 4QJD|1|F
665NR_all_37028.1
Exact match
Pyrococcus horikoshii
5XTM|1|D (5XTM)
  • RNA (47-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å46(1) 5XTM|1|D
666NR_all_67474.1
Exact match
Pyrococcus horikoshii
5DCV|1|D (5DCV)
  • RNA (47-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.4 Å46(2) 5DCV|1|D, 5DCV|1|B
667NR_all_80828.1
Exact match
synthetic construct
4TS2|1|Y+4TS2|1|X (4TS2)
  • Spinach aptamer RNA, bimolecular constru[...]
  • X-RAY DIFFRACTION
  • Chain(s): X, Y, i; model(s): 1
2.9 Å46(2) 4TS2|1|Y+4TS2|1|X, 4TS0|1|Y+4TS0|1|X
668NR_all_80987.1
Exact match
2NUE|1|C (2NUE)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å46(1) 2NUE|1|C
669NR_all_86306.1
Exact match
Enterococcus faecalis
6C27|1|A (6C27)
  • SAM-III riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å46(2) 6C27|1|A, 6C27|1|B
670NR_all_89156.1
Exact match
Saccharomyces cerevisiae
2NOQ|1|B (2NOQ)
  • 18S ribosomal RNA, 16S RIBOSOMAL RNA HEL[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
7.3 Å46(2) 2NOQ|1|B, 2R1G|1|B
671NR_all_25547.1
Exact match
synthetic construct
3PU0|1|R (3PU0)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å45(1) 3PU0|1|R
672NR_all_26915.1
Exact match
Escherichia coli
1MVR|1|A (1MVR)
  • Helix 34 of 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
12.8 Å45(1) 1MVR|1|A
673NR_all_28395.1
Exact match
1Z2J|1|A (1Z2J)
  • HIV-1 frameshift site RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
45(1) 1Z2J|1|A
674NR_all_29179.1
Exact match
synthetic construct
3PU1|1|R (3PU1)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å45(1) 3PU1|1|R
675NR_all_47370.1
Exact match
1P6V|1|B (1P6V)
  • 45-MER
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å45(2) 1P6V|1|B, 1P6V|1|D
676NR_all_56742.1
Exact match
6D3P|1|A (6D3P)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å45(1) 6D3P|1|A
677NR_all_62858.1
Exact match
Sulfolobus solfataricus
1QZW|1|F (1QZW)
  • 7S RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
4.1 Å45(4) 1QZW|1|F, 1QZW|1|H, 1QZW|1|B, 1QZW|1|D
678NR_all_80173.1
Exact match
2L94|1|A (2L94)
  • RNA_(45-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
45(1) 2L94|1|A
679NR_all_85950.1
Exact match
3PTX|1|R (3PTX)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å45(1) 3PTX|1|R
680NR_all_32799.1
Exact match
Escherichia coli
1QZC|1|A (1QZC)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
9.0 Å44(1) 1QZC|1|A
681NR_all_38367.1
Exact match
Escherichia coli
3J46|1|3 (3J46)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
10.1 Å44(1) 3J46|1|3
682NR_all_40657.1
Exact match
1G1X|1|J+1G1X|1|I (1G1X)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): I, J, i; model(s): 1
2.6 Å44(1) 1G1X|1|J+1G1X|1|I
683NR_all_48149.1
Exact match
synthetic construct
4RMO|1|B (4RMO)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å44(8) 4RMO|1|B, 4RMO|1|D, 4RMO|1|H, 4RMO|1|F, 4RMO|1|J, 4RMO|1|L, 4RMO|1|N, 4RMO|1|P
684NR_all_62528.1
Exact match
synthetic construct
5EEU|1|W (5EEU)
  • (GAGUU)10GAG 53-NUCLEOTIDE RNA
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.0 Å44(11) 5EEU|1|W, 5EEV|1|W, 5EEX|1|W, 5EEW|1|W, 5EEY|1|W, 5EEZ|1|W, 5EF0|1|W, 1GTF|1|W, 5EF1|1|W, 5EF2|1|W, 5EF3|1|W
685NR_all_84424.1
Exact match
1GTN|1|W (1GTN)
  • (GAGCC)11G 56-NUCLEOTIDE RNA
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.5 Å44(1) 1GTN|1|W
686NR_all_93153.1
Exact match
Turnip yellow mosaic virus
1A60|1|A (1A60)
  • TYMV PSEUDOKNOT
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
44(1) 1A60|1|A
687NR_all_99432.1
Exact match
1DUH|1|A (1DUH)
  • 4.5S RNA DOMAIN IV
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å44(1) 1DUH|1|A
688NR_all_06706.1
Exact match
2JYH|1|B (2JYH)
  • RNA (43-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
43(4) 2JYH|1|B, 2JYH|1|A, 2JYJ|2|A, 2JYJ|2|B
689NR_all_23975.1
Exact match
Shewanella putrefaciens
5O7H|1|A (5O7H)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å43(2) 5O7H|1|A, 5O6U|1|A
690NR_all_37036.1
Exact match
2JYF|3|A (2JYF)
  • RNA (43-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
43(2) 2JYF|3|A, 2JYF|3|B
691NR_all_40386.1
Exact match
Lachnospiraceae bacterium NK4A179
5WLH|1|B (5WLH)
  • pre-crRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å43(1) 5WLH|1|B
692NR_all_50005.1
Exact match
2I7Z|1|B (2I7Z)
  • 43-MER
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
43(6) 2I7Z|1|B, 2I7Z|1|A, 2ADT|1|B, 2ADT|1|A, 2I7E|1|B, 2I7E|1|A
693NR_all_53123.1
Exact match
6HAG|1|A (6HAG)
  • SAM Riboswitch
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
43(1) 6HAG|1|A
694NR_all_56732.1
Exact match
Escherichia coli
1CQL|10|A (1CQL)
  • SRP DOMAIN IV RNA, SRP RNA DOMAIN IV
  • SOLUTION NMR
  • Chain(s): A; model(s): 10
43(2) 1CQL|10|A, 1CQ5|1|A
695NR_all_63427.1
Exact match
2FEY|4|A (2FEY)
  • stem-loop IV of Tetrahymena telomerase R[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
43(1) 2FEY|4|A
696NR_all_67614.1
Exact match
Neisseria meningitidis
2N6X|3|A (2N6X)
  • RNA (43-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
43(1) 2N6X|3|A
697NR_all_74260.1
Exact match
Homo sapiens
5BTM|1|A (5BTM)
  • RNA (55-mer)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å43(2) 5BTM|1|A, 5BTM|1|B
698NR_all_08812.1
Exact match
Canis lupus
4V5Z|1|AD (4V5Z)
  • RNA Expansion segment ES6 part I
  • ELECTRON MICROSCOPY
  • Chain(s): AD; model(s): 1
8.7 Å42(1) 4V5Z|1|AD
699NR_all_15417.1
Exact match
1KH6|1|A (1KH6)
  • JIIIabc
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å42(1) 1KH6|1|A
700NR_all_22252.1
Exact match
Thermus thermophilus
2OM7|1|H (2OM7)
  • Fragment of23S rRNA (H89)
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
7.3 Å42(1) 2OM7|1|H
701NR_all_22632.1
Exact match
4M6D|1|H (4M6D)
  • aptamer
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.7 Å42(6) 4M6D|1|H, 4M6D|1|F, 4M6D|1|J, 4M6D|1|D, 4M6D|1|L, 4M6D|1|B
702NR_all_42484.1
Exact match
2OEU|1|A (2OEU)
  • Hammerhead Ribozyme, 5'-R(*GP*GP*CP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å42(3) 2OEU|1|A, 3ZD3|1|A, 2GOZ|1|A
703NR_all_66328.1
Exact match
Saccharomyces cerevisiae
5M0H|1|A (5M0H)
  • ASH1 E3 (42 nt-TL/TLR)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å42(1) 5M0H|1|A
704NR_all_69913.1
Exact match
Spinacia oleracea
1MNX|5|A (1MNX)
  • Loop E from 5S rRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
42(1) 1MNX|5|A
705NR_all_73308.1
Exact match
Homo sapiens
2L2K|1|A (2L2K)
  • RNA (42-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
42(1) 2L2K|1|A
706NR_all_76247.1
Exact match
Homo sapiens
2KX8|1|A (2KX8)
  • 7SK
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
42(1) 2KX8|1|A
707NR_all_81170.1
Exact match
Neisseria meningitidis
2N6T|1|A (2N6T)
  • RNA (42-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
42(1) 2N6T|1|A
708NR_all_85536.1
Exact match
Lachnospiraceae bacterium
5W1H|1|B (5W1H)
  • mature crRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å42(3) 5W1H|1|B, 5W1I|1|B, 5W1I|1|D
709NR_all_87597.1
Exact match
Homo sapiens
2L2J|14|A (2L2J)
  • RNA (42-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 14
42(1) 2L2J|14|A
710NR_all_88517.4
Exact match
4JNG|1|L (4JNG)
  • RNA (42-MER), RNA (45-MER), POLY-URIDINE[...]
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.1 Å42(17) 4JNG|1|L, 5UK4|1|x, 5UK4|1|v, 5UK4|1|w, 5UK4|1|u, 4BHH|1|R, 4J1G|1|E, 3ZLA|1|I, 3ZLA|1|J, 3PU4|1|R, 2GIC|1|R, 3HHZ|1|R, 6BJY|1|R, 5UKB|1|R, 6H25|1|R, 2WYY|1|S, 2WYY|1|R
711NR_all_93255.1
Exact match
5H0R|1|H+5H0R|1|I (5H0R)
  • RNA (42-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): H, I, i; model(s): 1
3.9 Å42(1) 5H0R|1|H+5H0R|1|I
712NR_all_93863.1
Exact match
Escherichia coli
1T1M|1|B (1T1M)
  • 42-mer fragment of double helix from 16S[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
12.0 Å42(1) 1T1M|1|B
713NR_all_95110.1
Exact match
1RPU|1|C+1RPU|1|D (1RPU)
  • 5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*UP*CP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, i; model(s): 1
2.5 Å42(1) 1RPU|1|C+1RPU|1|D
714NR_all_02518.1
Exact match
2AU4|1|A (2AU4)
  • Class I RNA aptamer to GTP
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
41(1) 2AU4|1|A
715NR_all_40870.1
Exact match
Enterovirus A
5V16|1|A (5V16)
  • RNA (41-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
41(1) 5V16|1|A
716NR_all_52192.1
Exact match
Canis lupus
4V5Z|1|AH (4V5Z)
  • RNA helix
  • ELECTRON MICROSCOPY
  • Chain(s): AH; model(s): 1
8.7 Å41(1) 4V5Z|1|AH
717NR_all_53343.1
Exact match
Escherichia coli
1MJ1|1|Q (1MJ1)
  • sarcin-ricin loop of 23SrRNA
  • ELECTRON MICROSCOPY
  • Chain(s): Q; model(s): 1
13.0 Å41(1) 1MJ1|1|Q
718NR_all_65451.1
Exact match
Escherichia coli
1A51|3|A (1A51)
  • 5S RRNA LOOP D/LOOP E
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
41(1) 1A51|3|A
719NR_all_71100.1
Exact match
Enterovirus A
5V17|1|A (5V17)
  • RNA (41-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
41(1) 5V17|1|A
720NR_all_80667.1
Exact match
1TRJ|1|B (1TRJ)
  • Helix 39 of 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
11.7 Å41(1) 1TRJ|1|B
721NR_all_86256.1
Exact match
1ZC5|1|A (1ZC5)
  • HIV-1 frameshift RNA signal
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
41(1) 1ZC5|1|A
722NR_all_88747.1
Exact match
synthetic construct
5NFV|1|B (5NFV)
  • pre-crRNA, crRNA (40-MER), crRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å41(8) 5NFV|1|B, 6I1L|1|E, 6I1L|1|B, 6I1K|1|B, 5NG6|1|F, 5NG6|1|H, 5NG6|1|D, 5NG6|1|B
723NR_all_01073.1
Exact match
Thermobifida fusca
5NWQ|1|A (5NWQ)
  • Guanidine III riboswitch, RNA (41-MER), [...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å40(13) 5NWQ|1|A, 5NY8|1|A, 5NZD|1|A, 5NZD|1|B, 5NWQ|1|B, 5O62|1|A, 5NZ3|1|A, 5O69|1|A, 5NY8|1|B, 5NZ6|1|A, 5NZ3|1|B, 5O62|1|B, 5O69|1|B
724NR_all_13125.1
Exact match
1G1X|1|D+1G1X|1|E (1G1X)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): D, E, i; model(s): 1
2.6 Å40(1) 1G1X|1|D+1G1X|1|E
725NR_all_13754.1
Exact match
Escherichia coli
1ZN1|1|C (1ZN1)
  • ribosomal 16S RNA, 16S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
14.1 Å40(2) 1ZN1|1|C, 1ZN0|1|C
726NR_all_14866.1
Exact match
Acidaminococcus sp. BV3L6
5KK5|1|B (5KK5)
  • RNA (40-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.3 Å40(1) 5KK5|1|B
727NR_all_25696.1
Exact match
2HUA|1|A (2HUA)
  • CSFV IRES Domain IIa
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
40(1) 2HUA|1|A
728NR_all_27745.1
Exact match
synthetic construct
2NBZ|1|A (2NBZ)
  • IRES RNA 40-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
40(1) 2NBZ|1|A
729NR_all_36746.1
Exact match
Francisella tularensis
5MGA|1|B (5MGA)
  • RNA (40-MER), RNA (28-MER), RNA (29-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å40(6) 5MGA|1|B, 6GTG|1|B, 6GTC|1|B, 6GTF|1|B, 6GTE|1|B, 6GTD|1|B
730NR_all_36990.1
Exact match
Human immunodeficiency virus 1
4PMI|1|A (4PMI)
  • Rev-Response-Element RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å40(1) 4PMI|1|A
731NR_all_48252.1
Exact match
synthetic construct
5XUZ|1|B (5XUZ)
  • crRNA, RNA, RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å40(12) 5XUZ|1|B, 5XUZ|1|F, 5XUT|1|B, 5XUS|1|B, 5XUU|1|B, 6NMA|1|G, 6NM9|1|E, 6NM9|1|G, 6NMC|1|G, 6OMV|1|G, 6NME|1|G, 6NMD|1|G
732NR_all_74407.1
Exact match
Acidaminococcus sp. BV3L6
5XH7|1|B (5XH7)
  • crRNA, RNA (43-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å40(3) 5XH7|1|B, 5XH6|1|B, 5B43|1|B
733NR_all_79722.1
Exact match
6NUE|1|H (6NUE)
  • crRNA, target ssRNA
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
3.3 Å40(2) 6NUE|1|H, 6NUD|1|H+6NUD|1|U
734NR_all_90696.1
Exact match
Leptotrichia shahii
5WTK|1|B (5WTK)
  • RNA (58-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å40(1) 5WTK|1|B
735NR_all_20761.1
Exact match
synthetic construct
2NBY|6|A (2NBY)
  • IRES RNA (39-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
39(1) 2NBY|6|A
736NR_all_41092.1
Exact match
synthetic construct
2MXL|1|A (2MXL)
  • RNA (39-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
39(1) 2MXL|1|A
737NR_all_41959.1
Exact match
3P22|1|A (3P22)
  • Core ENE hairpin from KSHV PAN RNA, olig[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å39(4) 3P22|1|A, 3P22|1|E, 3P22|1|C, 3P22|1|G
738NR_all_45065.1
Exact match
2D1A|1|A+2D1A|1|B (2D1A)
  • RNA
  • SOLUTION NMR
  • Chain(s): A, B, i; model(s): 1
39(1) 2D1A|1|A+2D1A|1|B
739NR_all_52747.1
Exact match
4KR6|1|C (4KR6)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å39(1) 4KR6|1|C
740NR_all_53766.1
Exact match
4KR6|1|D (4KR6)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å39(1) 4KR6|1|D
741NR_all_57443.1
Exact match
4KR9|1|M (4KR9)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.5 Å39(2) 4KR9|1|M, 4KR7|1|M
742NR_all_57492.2
Exact match
2D1B|1|A (2D1B)
  • RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
39(2) 2D1B|1|A, 2D1B|1|B
743NR_all_87561.1
Exact match
4KR9|1|X (4KR9)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.5 Å39(2) 4KR9|1|X, 4KR7|1|X
744NR_all_01611.2
Exact match
1A9L|1|A (1A9L)
  • PRE-TRNA BULGE-HELIX-BULGE MOTIF, ABISS7[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
38(2) 1A9L|1|A, 2A9L|1|A
745NR_all_13046.1
Exact match
Hepatitis C virus
2KU0|4|A (2KU0)
  • HCV IRES Domain IIa RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
38(1) 2KU0|4|A
746NR_all_13890.1
Exact match
Canis lupus
4V5Z|1|BS (4V5Z)
  • RNA Expansion segment ES39 part II
  • ELECTRON MICROSCOPY
  • Chain(s): BS; model(s): 1
8.7 Å38(1) 4V5Z|1|BS
747NR_all_14284.1
Exact match
synthetic construct
1B36|8|A (1B36)
  • RNA (RNA LOOP B)
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
38(1) 1B36|8|A
748NR_all_18718.1
Exact match
synthetic construct
4PDB|1|I (4PDB)
  • SELEX RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.6 Å38(1) 4PDB|1|I
749NR_all_32905.1
Exact match
1TXS|4|A (1TXS)
  • Enteroviral 5'-UTR
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
38(1) 1TXS|4|A
750NR_all_37735.1
Exact match
1L2X|1|A (1L2X)
  • RNA pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å38(3) 1L2X|1|A, 437D|1|A, 1L3D|1|A
751NR_all_38065.1
Exact match
2KHY|9|A (2KHY)
  • RNA (38-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
38(1) 2KHY|9|A
752NR_all_47361.1
Exact match
1M5L|1|A (1M5L)
  • modified HIV-1 packaging signal stem-loo[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
38(1) 1M5L|1|A
753NR_all_73836.1
Exact match
Pseudomonas aeruginosa
5XLO|1|K (5XLO)
  • crRNA with 32nt spacer sequence
  • ELECTRON MICROSCOPY
  • Chain(s): K; model(s): 1
3.8 Å38(1) 5XLO|1|K
754NR_all_78506.1
Exact match
2ZY6|1|A (2ZY6)
  • phenylalanyl transfer RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å38(1) 2ZY6|1|A
755NR_all_79100.1
Exact match
Homo sapiens
6D12|1|C (6D12)
  • human 7SK RNA stem-loop 4
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å38(1) 6D12|1|C
756NR_all_84559.1
Exact match
synthetic construct
6E8U|1|B (6E8U)
  • RNA (37-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å38(2) 6E8U|1|B, 6PQ7|1|C
757NR_all_84907.1
Exact match
1U3K|7|A (1U3K)
  • ABISS7
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
38(1) 1U3K|7|A
758NR_all_85064.1
Exact match
Hepatitis C virus
2KTZ|1|A (2KTZ)
  • HCV IRES Domain IIa RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
38(1) 2KTZ|1|A
759NR_all_88906.1
Exact match
3CZ3|1|G+3CZ3|1|H (3CZ3)
  • RNA (5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): G, H, i; model(s): 1
3.2 Å38(2) 3CZ3|1|G+3CZ3|1|H, 3CZ3|1|E+3CZ3|1|F
760NR_all_93156.1
Exact match
1Q8N|1|A (1Q8N)
  • RNA Aptamer
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
38(1) 1Q8N|1|A
761NR_all_98433.1
Exact match
synthetic construct
6E8S|1|A (6E8S)
  • iMango-III aptamer
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.4 Å38(2) 6E8S|1|A, 6E8S|1|B
762NR_all_14947.1
Exact match
1KOG|1|O (1KOG)
  • Threonyl-tRNA synthetase mRNA
  • X-RAY DIFFRACTION
  • Chain(s): O; model(s): 1
3.5 Å37(8) 1KOG|1|O, 1KOG|1|J, 1KOG|1|M, 1KOG|1|P, 1KOG|1|L, 1KOG|1|I, 1KOG|1|K, 1KOG|1|N
763NR_all_26988.1
Exact match
1D6K|4|B (1D6K)
  • 5S RRNA E-LOOP (5SE)
  • SOLUTION NMR
  • Chain(s): B; model(s): 4
37(1) 1D6K|4|B
764NR_all_29611.1
Exact match
Homo sapiens
2LUB|1|A (2LUB)
  • RNA (37-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
37(1) 2LUB|1|A
765NR_all_36729.1
Exact match
Pan troglodytes
2LHP|1|A (2LHP)
  • RNA (37-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
37(1) 2LHP|1|A
766NR_all_41425.1
Exact match
6DTD|1|C (6DTD)
  • RNA (37-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.7 Å37(1) 6DTD|1|C
767NR_all_49782.1
Exact match
1I6U|1|C (1I6U)
  • 16S RRNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å37(2) 1I6U|1|C, 1I6U|1|D
768NR_all_15923.1
Exact match
Mason-Pfizer monkey virus
1E95|14|A (1E95)
  • RNA (5'-(*GP*CP*GP*GP*CP*CP*AP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 14
36(1) 1E95|14|A
769NR_all_18912.1
Exact match
2LA5|6|A (2LA5)
  • RNA (36-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
36(1) 2LA5|6|A
770NR_all_22049.1
Exact match
Thermus thermophilus
6O1O|1|M+6O1O|1|N (6O1O)
  • RNA (36-MER), RNA (30-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): M, N, i; model(s): 1
3.8 Å36(1) 6O1O|1|M+6O1O|1|N
771NR_all_24663.1
Exact match
3GS5|1|C (3GS5)
  • RNA (36-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å36(1) 3GS5|1|C
772NR_all_26426.2
Exact match
synthetic construct
6C63|1|A (6C63)
  • RNA (36-MER), RNA (32-MER), RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å36(9) 6C63|1|A, 6C63|1|B, 6C65|1|A, 6C65|1|B, 6C64|1|A, 6C64|1|B, 6C63|1|C, 6C65|1|C, 6C64|1|D
773NR_all_29777.1
Exact match
2TPK|1|A (2TPK)
  • RNA (MRNA PSEUDOKNOT)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
36(1) 2TPK|1|A
774NR_all_39458.1
Exact match
synthetic construct
6E8T|1|A (6E8T)
  • RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å36(3) 6E8T|1|A, 6E8T|1|C, 6E8T|1|B
775NR_all_40597.1
Exact match
2HW8|1|B (2HW8)
  • 36-MER, mRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å36(5) 2HW8|1|B, 1ZHO|1|D, 1ZHO|1|B, 1ZHO|1|F, 1ZHO|1|H
776NR_all_42294.1
Exact match
1RAW|1|A (1RAW)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
36(1) 1RAW|1|A
777NR_all_45693.1
Exact match
3VJR|1|B (3VJR)
  • tRNA CCA-acceptor
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å36(2) 3VJR|1|B, 3VJR|1|D
778NR_all_59708.1
Exact match
1N8X|1|A (1N8X)
  • HIV-1 STEM LOOP SL1 MONOMERIC RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
36(1) 1N8X|1|A
779NR_all_65000.1
Exact match
Oryzias latipes
5KQE|11|A (5KQE)
  • Telomerase RNA P2ab
  • SOLUTION NMR
  • Chain(s): A; model(s): 11
36(1) 5KQE|11|A
780NR_all_65533.1
Exact match
3OVB|1|C (3OVB)
  • RNA (35-MER), RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å36(9) 3OVB|1|C, 3OVA|1|C, 3OVB|1|D, 3OUY|1|C, 3OVS|1|C, 3OUY|1|D, 3OV7|1|C, 3OVS|1|D, 3OV7|1|D
781NR_all_78862.1
Exact match
4V9E|1|Ag (4V9E)
  • 35-mer poly(U) RNA
  • X-RAY DIFFRACTION
  • Chain(s): Ag; model(s): 1
3.4 Å36(6) 4V9E|1|Ag, 4V9E|1|Bm, 4V9E|1|Am, 4V9E|1|Aa, 4V9E|1|Ba, 4V9E|1|Bg
782NR_all_81978.1
Exact match
2FDT|7|A (2FDT)
  • 36-mer
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
36(1) 2FDT|7|A
783NR_all_82659.1
Exact match
Neisseria meningitidis
2N6S|1|A (2N6S)
  • RNA (36-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
36(1) 2N6S|1|A
784NR_all_82908.1
Exact match
Escherichia coli
3J45|1|2 (3J45)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
9.5 Å36(2) 3J45|1|2, 3J46|1|2
785NR_all_00085.1
Exact match
2PCV|5|A (2PCV)
  • U65 Box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
35(1) 2PCV|5|A
786NR_all_02963.1
Exact match
synthetic construct
5DEA|1|C (5DEA)
  • sc1
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å35(3) 5DEA|1|C, 5DE5|1|C, 5DE8|1|C
787NR_all_03882.1
Exact match
2L3E|11|A (2L3E)
  • 35-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 11
35(1) 2L3E|11|A
788NR_all_08724.1
Exact match
4H5O|1|L (4H5O)
  • 35-mer poly(U) RNA
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.9 Å35(2) 4H5O|1|L, 4H5O|1|K
789NR_all_14315.1
Exact match
synthetic construct
6E8T|1|D (6E8T)
  • RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å35(1) 6E8T|1|D
790NR_all_14959.1
Exact match
Homo sapiens
6DCC|1|B (6DCC)
  • human 7SK RNA stem-loop 1 proximal methy[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å35(2) 6DCC|1|B, 6DCB|1|B
791NR_all_22853.1
Exact match
synthetic construct
3PLA|1|G+3PLA|1|H+3PLA|1|I+3PLA|1|J (3PLA)
  • C/D guide RNA, RNA (5'-R(*CP*CP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): G, H, I, J; model(s): 1
3.2 Å35(2) 3PLA|1|G+3PLA|1|H+3PLA|1|I+3PLA|1|J, 3PLA|1|N+3PLA|1|O
792NR_all_23939.1
Exact match
Kneallhazia solenopsae
4C4W|1|H (4C4W)
  • TSKT-23
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å35(2) 4C4W|1|H, 4C4W|1|D
793NR_all_25919.1
Exact match
synthetic construct
6CF2|1|G (6CF2)
  • RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.0 Å35(1) 6CF2|1|G
794NR_all_27904.1
Exact match
2XD0|1|W (2XD0)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
3.0 Å35(1) 2XD0|1|W
795NR_all_38950.2
Exact match
Pectobacterium atrosepticum
2XDB|1|G (2XDB)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.6 Å35(9) 2XDB|1|G, 2XD0|1|H, 2XD0|1|I, 2XD0|1|V, 2XD0|1|G, 2XD0|1|U, 2XDD|1|F, 2XDD|1|G, 2XDD|1|H
796NR_all_43215.1
Exact match
2GM0|1|A+2GM0|1|B (2GM0)
  • RNA (35-MER)
  • SOLUTION NMR
  • Chain(s): A, B, I, J; model(s): 1
35(1) 2GM0|1|A+2GM0|1|B
797NR_all_55381.1
Exact match
2PCW|1|A (2PCW)
  • U65 box H/ACA snoRNA, rRNA substrate of [...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
35(1) 2PCW|1|A
798NR_all_57703.1
Exact match
1FMN|1|A (1FMN)
  • RNA (5'-R(*GP*GP*CP*GP*UP*GP*UP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
35(1) 1FMN|1|A
799NR_all_70098.1
Exact match
synthetic construct
5DE8|1|A (5DE8)
  • sc1
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å35(3) 5DE8|1|A, 5DEA|1|A, 5DE5|1|A
800NR_all_70895.1
Exact match
Haloarcula marismortui
5FJ4|1|H (5FJ4)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å35(2) 5FJ4|1|H, 5FJ4|1|D
801NR_all_71771.1
Exact match
Thermus thermophilus
4V83|1|CV (4V83)
  • domain 3 of PSIC IGR IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.5 Å35(2) 4V83|1|CV, 4V83|1|AV
802NR_all_71956.1
Exact match
Azotobacter vinelandii
2M57|5|A (2M57)
  • RNA_(35-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
35(1) 2M57|5|A
803NR_all_73441.1
Exact match
synthetic construct
5BJO|1|E (5BJO)
  • RNA (36-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.4 Å35(8) 5BJO|1|E, 5BJP|1|E, 5BJO|1|Y, 5BJP|1|Y, 6E81|1|A, 6E80|1|A, 6E84|1|A, 6E82|1|A
804NR_all_76225.1
Exact match
6IFL|1|J+6IFL|1|I (6IFL)
  • NTR, crRNA, type III-A CRISPR-Cas interf[...]
  • ELECTRON MICROSCOPY
  • Chain(s): I, J; model(s): 1
3.2 Å35(2) 6IFL|1|J+6IFL|1|I, 6IFR|1|J+6IFR|1|N
805NR_all_78769.1
Exact match
1ULL|3|A (1ULL)
  • RNA (5'-R (GP*GP*CP*UP*GP*GP*AP*CP*UP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
35(1) 1ULL|3|A
806NR_all_88496.1
Exact match
1ET4|1|A (1ET4)
  • RNA APTAMER, 35-MER, VITAMIN B12 BINDING[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å35(9) 1ET4|1|A, 1ET4|1|C, 1ET4|1|B, 1ET4|1|D, 1ET4|1|E, 1DDY|1|C, 1DDY|1|G, 1DDY|1|A, 1DDY|1|E
807NR_all_95874.1
Exact match
3R9X|1|C (3R9X)
  • RNA301
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å35(1) 3R9X|1|C
808NR_all_03598.2
Exact match
2LPT|1|A (2LPT)
  • RNA_(34-MER), RNA (34-MER), D5-PL RNA RI[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
34(3) 2LPT|1|A, 2LPS|2|A, 2F88|1|A
809NR_all_07414.1
Exact match
Saccharomyces cerevisiae
2WW9|1|E (2WW9)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
8.6 Å34(2) 2WW9|1|E, 2WWA|1|E
810NR_all_26735.1
Exact match
2P89|3|A (2P89)
  • U65 H/ACA snoRNA, 28S rRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
34(1) 2P89|3|A
811NR_all_31224.1
Exact match
1R2P|9|A (1R2P)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
34(1) 1R2P|9|A
812NR_all_31404.1
Exact match
1RNK|1|A (1RNK)
  • RNA PSEUDOKNOT
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
34(1) 1RNK|1|A
813NR_all_32674.1
Exact match
1NBK|1|A (1NBK)
  • RNA aptamer
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
34(1) 1NBK|1|A
814NR_all_36505.1
Exact match
1R7Z|5|A (1R7Z)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
34(1) 1R7Z|5|A
815NR_all_38781.1
Exact match
3R9W|1|B (3R9W)
  • RNA301
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å34(1) 3R9W|1|B
816NR_all_38996.1
Exact match
3ID5|1|D (3ID5)
  • half C/D RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
4.0 Å34(2) 3ID5|1|D, 3ID5|1|H
817NR_all_41342.1
Exact match
1I9F|5|A (1I9F)
  • REV RESPONSE ELEMENT RNA, REV RESPONSIVE[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
34(3) 1I9F|5|A, 1ETG|14|A, 1ETF|1|A
818NR_all_43326.1
Exact match
1T28|1|A (1T28)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
34(1) 1T28|1|A
819NR_all_46231.1
Exact match
Pyrococcus furiosus
3NMU|1|E+3NMU|1|K (3NMU)
  • RNA (34-MER), RNA (5'-R(*GP*AP*GP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, I, J, K; model(s): 1
2.7 Å34(2) 3NMU|1|E+3NMU|1|K, 3NMU|1|D+3NMU|1|I
820NR_all_49489.1
Exact match
2JTP|16|A (2JTP)
  • SIV17-50 RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 16
34(1) 2JTP|16|A
821NR_all_49730.1
Exact match
Homo sapiens
4X4V|1|B (4X4V)
  • Human MenBeta minihelix ending in CCACC,[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å34(4) 4X4V|1|B, 4X4V|1|D, 4X4U|1|B, 4X4U|1|D
822NR_all_51196.1
Exact match
Thermus thermophilus
4V84|1|AV (4V84)
  • RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): AV; model(s): 1
3.4 Å34(2) 4V84|1|AV, 4V84|1|CV
823NR_all_52610.1
Exact match
synthetic construct
4PCJ|1|A (4PCJ)
  • trCUG-3('5), RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å34(2) 4PCJ|1|A, 4FNJ|1|A
824NR_all_55907.2
Exact match
1HMH|1|E (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.6 Å34(2) 1HMH|1|E, 1HMH|1|C
825NR_all_62367.1
Exact match
Escherichia coli
1MJI|1|D (1MJI)
  • 5S rRNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å34(2) 1MJI|1|D, 1MJI|1|C
826NR_all_66108.1
Exact match
2DRA|1|B (2DRA)
  • tRNA (34-MER), tRNA (33-MER), tRNA (35-M[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å34(18) 2DRA|1|B, 2DVI|1|B, 2ZH6|1|B, 2DR8|1|B, 2DRB|1|B, 2DR9|1|B, 2ZH3|1|B, 2ZH2|1|B, 2ZHB|1|B, 2ZH1|1|B, 2ZH4|1|B, 2ZH8|1|B, 2ZH7|1|B, 2DR7|1|B, 2ZH5|1|B, 2ZHA|1|B, 2ZH9|1|B, 2DR5|1|B
827NR_all_78722.1
Exact match
Triticum aestivum
2WWB|1|E (2WWB)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
6.5 Å34(1) 2WWB|1|E
828NR_all_81676.1
Exact match
6IFK|1|N+6IFK|1|J (6IFK)
  • crRNA, CTR1, CTR2
  • ELECTRON MICROSCOPY
  • Chain(s): I, J, N; model(s): 1
3.2 Å34(5) 6IFK|1|N+6IFK|1|J, 6IFU|1|I+6IFU|1|J, 6IG0|1|N+6IG0|1|J, 6IFZ|1|I+6IFZ|1|J, 6IFY|1|I+6IFY|1|J
829NR_all_82681.1
Exact match
1HMH|1|A (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å34(1) 1HMH|1|A
830NR_all_85024.1
Exact match
1R7W|12|A (1R7W)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 12
34(1) 1R7W|12|A
831NR_all_88352.1
Exact match
2KPV|3|A (2KPV)
  • RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
34(1) 2KPV|3|A
832NR_all_90215.1
Exact match
1YLS|1|B (1YLS)
  • RNA Diels-Alder ribozyme, Diels-Alder ri[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å34(6) 1YLS|1|B, 1YLS|1|D, 1YKV|1|D, 1YKV|1|B, 1YKQ|1|D, 1YKQ|1|B
833NR_all_91105.1
Exact match
4OOG|1|D (4OOG)
  • 34-mer RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å34(1) 4OOG|1|D
834NR_all_93004.1
Exact match
Danio rerio
2RVO|3|A (2RVO)
  • RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
34(1) 2RVO|3|A
835NR_all_94175.1
Exact match
1P5N|8|A (1P5N)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
34(1) 1P5N|8|A
836NR_all_94355.1
Exact match
2EUY|2|A (2EUY)
  • U65 box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
34(1) 2EUY|2|A
837NR_all_98897.1
Exact match
1YSH|1|F (1YSH)
  • RNA (34-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
9.5 Å34(1) 1YSH|1|F
838NR_all_99287.1
Exact match
Rattus norvegicus
2L3C|1|B (2L3C)
  • RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
34(1) 2L3C|1|B
839NR_all_09715.1
Exact match
Thermus thermophilus
5NS3|1|C (5NS3)
  • double-stranded RNA, RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å33(4) 5NS3|1|C, 5NS4|1|C, 5NS3|1|D, 5NS4|1|D
840NR_all_22747.1
Exact match
2OZB|1|C (2OZB)
  • RNA comprising the 5' Stem-Loop RNA of [...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å33(2) 2OZB|1|C, 2OZB|1|F
841NR_all_31091.1
Exact match
4K50|1|B (4K50)
  • RNA (33-MER), RNA (5'-R(P*GP*CP*CP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å33(4) 4K50|1|B, 4K50|1|J, 4K50|1|N, 4K50|1|F
842NR_all_31833.1
Exact match
Thermus thermophilus
486D|1|G (486D)
  • 900 STEM-LOOP OF 16S RRNA IN THE 70S RIB[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
7.5 Å33(2) 486D|1|G, 2R1G|1|C
843NR_all_42653.1
Exact match
5T16|1|H (5T16)
  • RNA substrate analog
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.8 Å33(4) 5T16|1|H, 5T16|1|P, 5T16|1|O, 5T16|1|G
844NR_all_43728.1
Exact match
2JXV|1|A (2JXV)
  • RNA (33-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
33(1) 2JXV|1|A
845NR_all_46564.1
Exact match
Bacillus thuringiensis
4ATO|1|G (4ATO)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.2 Å33(1) 4ATO|1|G
846NR_all_55696.1
Exact match
1EXY|1|A (1EXY)
  • RNA APTAMER, 33-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
33(1) 1EXY|1|A
847NR_all_74421.1
Exact match
1F1T|1|A (1F1T)
  • MALACHITE GREEN APTAMER RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å33(1) 1F1T|1|A
848NR_all_93087.1
Exact match
synthetic construct
5LWJ|1|A (5LWJ)
  • GTP Class II RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
33(1) 5LWJ|1|A
849NR_all_97287.1
Exact match
1EHT|3|A (1EHT)
  • THEOPHYLLINE-BINDING RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
33(2) 1EHT|3|A, 1O15|1|A
850NR_all_02664.1
Exact match
Yersinia enterocolitica
2LI4|1|A (2LI4)
  • RNA (32-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 2LI4|1|A
851NR_all_07784.1
Exact match
1XHP|1|A (1XHP)
  • U6 snRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 1XHP|1|A
852NR_all_08155.1
Exact match
Homo sapiens
3SIV|1|C+3SIV|1|F (3SIV)
  • U4atac snRNA
  • X-RAY DIFFRACTION
  • Chain(s): C, F, I, J; model(s): 1
3.3 Å32(2) 3SIV|1|C+3SIV|1|F, 3SIV|1|I+3SIV|1|L
853NR_all_18111.1
Exact match
1Z31|1|A (1Z31)
  • human telomerase PJ6 hairpin
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 1Z31|1|A
854NR_all_19686.1
Exact match
Canis lupus
4V5Z|1|AE (4V5Z)
  • RNA Expansion segment ES6 part II
  • ELECTRON MICROSCOPY
  • Chain(s): AE; model(s): 1
8.7 Å32(1) 4V5Z|1|AE
855NR_all_23840.1
Exact match
Drosophila melanogaster
5A18|1|A (5A18)
  • OSKAR MRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(2) 5A18|1|A, 5A17|1|A
856NR_all_28149.1
Exact match
Escherichia coli
3BO0|1|G (3BO0)
  • 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
9.6 Å32(2) 3BO0|1|G, 3BO1|1|G
857NR_all_28653.1
Exact match
Human immunodeficiency virus 1
1G70|1|A (1G70)
  • HIV-1 RRE-IIB 32 NUCLEOTIDE RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 1G70|1|A
858NR_all_30403.1
Exact match
Canis lupus
4V5Z|1|AB (4V5Z)
  • RNA Expansion segment ES3
  • ELECTRON MICROSCOPY
  • Chain(s): AB; model(s): 1
8.7 Å32(1) 4V5Z|1|AB
859NR_all_34462.1
Exact match
2LUP|11|A (2LUP)
  • RNA (32-MER), 5' terminal hairpin of snR[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 11
32(3) 2LUP|11|A, 1T4L|1|A, 2LBS|1|A
860NR_all_44181.1
Exact match
Canis lupus
3DKN|1|F (3DKN)
  • RNA (32-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
8.7 Å32(1) 3DKN|1|F
861NR_all_45933.1
Exact match
1KPD|1|A (1KPD)
  • RNA PSEUDOKNOT APKA27G
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 1KPD|1|A
862NR_all_68262.1
Exact match
Pyrococcus furiosus
3X1L|1|I (3X1L)
  • RNA (32-MER)
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.1 Å32(1) 3X1L|1|I
863NR_all_69484.1
Exact match
Plautia stali intestine virus
4XEJ|1|BIRE (4XEJ)
  • IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): BIRE; model(s): 1
3.8 Å32(2) 4XEJ|1|BIRE, 4XEJ|1|AIRE
864NR_all_69759.1
Exact match
synthetic construct
6AZ4|1|A (6AZ4)
  • RNA (32-MER), RNA (5'-R(*CP*AP*GP*CP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å32(1) 6AZ4|1|A
865NR_all_71895.1
Exact match
2LWK|8|A (2LWK)
  • RNA (32-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
32(1) 2LWK|8|A
866NR_all_79481.1
Exact match
synthetic construct
4RBQ|1|A (4RBQ)
  • U-Helix RNA from Trypanosome editing, RN[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å32(2) 4RBQ|1|A, 5DA6|1|A
867NR_all_79637.1
Exact match
1KAJ|1|A (1KAJ)
  • RNA PSEUDOKNOT APK
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 1KAJ|1|A
868NR_all_80808.1
Exact match
6IFN|1|N (6IFN)
  • RNA (32-MER)
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.9 Å32(1) 6IFN|1|N
869NR_all_89241.1
Exact match
Escherichia coli
3J5S|1|B (3J5S)
  • 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
7.5 Å32(1) 3J5S|1|B
870NR_all_06460.1
Exact match
synthetic construct
6HYK|2|A (6HYK)
  • RNA (31-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
31(1) 6HYK|2|A
871NR_all_13447.1
Exact match
Rattus norvegicus
6H0R|1|A (6H0R)
  • SRS2 fragment of Rgs4 3' UTR, RNA (31-ME[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å31(2) 6H0R|1|A, 6H0R|1|B
872NR_all_21518.1
Exact match
Human immunodeficiency virus 1
1LVJ|2|A (1LVJ)
  • HIV-1 Trans Activating Region RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
31(1) 1LVJ|2|A
873NR_all_26762.1
Exact match
2N6Q|9|A (2N6Q)
  • Telomerase RNA pseudoknot
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
31(2) 2N6Q|9|A, 5KMZ|4|A
874NR_all_29474.1
Exact match
1JO7|18|A (1JO7)
  • Influenza A virus promoter RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 18
31(1) 1JO7|18|A
875NR_all_31642.1
Exact match
Canis lupus
1RY1|1|N+1RY1|1|M (1RY1)
  • SRP RNA
  • ELECTRON MICROSCOPY
  • Chain(s): I, J, M, N; model(s): 1
12.0 Å31(1) 1RY1|1|N+1RY1|1|M
876NR_all_34216.1
Exact match
Thermus thermophilus
1ZC8|1|C (1ZC8)
  • H2b d mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
13.0 Å31(1) 1ZC8|1|C
877NR_all_34610.1
Exact match
Escherichia coli
364D|1|C+364D|1|B+364D|1|A (364D)
  • RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, J; model(s): 1
3.0 Å31(2) 364D|1|C+364D|1|B+364D|1|A, 357D|1|C+357D|1|B+357D|1|A
878NR_all_43617.1
Exact match
Homo sapiens
5UZT|1|A (5UZT)
  • pre-miR-21
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
31(1) 5UZT|1|A
879NR_all_44641.1
Exact match
Thermus thermophilus
1X18|1|B (1X18)
  • RNA (31-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
13.5 Å31(1) 1X18|1|B
880NR_all_47899.1
Exact match
Homo sapiens
5UZZ|1|A (5UZZ)
  • pre-miR21
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
31(1) 5UZZ|1|A
881NR_all_51503.1
Exact match
Homo sapiens
4X4N|1|D (4X4N)
  • G70A tRNA minihelix, RNA (5'-D(P*CP*G)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å31(18) 4X4N|1|D, 4X4T|1|G, 4X4N|1|B, 4X4P|1|B, 4X4O|1|D, 4X4P|1|H, 4X4T|1|B, 4X4P|1|D, 4X4P|1|F, 4X4O|1|B, 4X4N|1|G, 4X4Q|1|B, 4X4R|1|B, 4X4T|1|D, 4X4R|1|D, 4X4Q|1|D, 4X4S|1|B, 4X4S|1|D
882NR_all_56124.1
Exact match
Oryctolagus cuniculus
3J0O|1|g+3J0O|1|G+3J0O|1|d (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): G, J, d, g; model(s): 1
9.0 Å31(4) 3J0O|1|g+3J0O|1|G+3J0O|1|d, 3J0L|1|g+3J0L|1|G+3J0L|1|d, 3J0Q|1|g+3J0Q|1|G+3J0Q|1|d, 3J0P|1|g+3J0P|1|G+3J0P|1|d
883NR_all_62030.1
Exact match
1MFY|1|A (1MFY)
  • C4 promoter of influneza A virus
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
31(1) 1MFY|1|A
884NR_all_62450.1
Exact match
1YNC|1|A (1YNC)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
31(1) 1YNC|1|A
885NR_all_80276.1
Exact match
Caldanaerobacter subterraneus
6E1S|1|A (6E1S)
  • RNA (33-MER), PREQ1 RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å31(8) 6E1S|1|A, 6E1T|1|A, 6E1W|1|A, 6E1U|1|A, 6E1V|1|A, 3Q50|1|A, 3Q51|1|A, 3GCA|1|A
886NR_all_86751.1
Exact match
1YNE|4|A (1YNE)
  • APOLIPOPROTEIN B mRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
31(2) 1YNE|4|A, 1YLG|13|A
887NR_all_87104.1
Exact match
2LDT|4|A (2LDT)
  • RNA (31-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
31(1) 2LDT|4|A
888NR_all_93701.1
Exact match
synthetic construct
5V3F|1|A (5V3F)
  • RNA (31-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å31(2) 5V3F|1|A, 5V3F|1|B
889NR_all_97153.1
Exact match
Canis lupus
4V5Z|1|AF (4V5Z)
  • RNA Expansion segment ES9
  • ELECTRON MICROSCOPY
  • Chain(s): AF; model(s): 1
8.7 Å31(1) 4V5Z|1|AF
890NR_all_99580.1
Exact match
1YNG|6|A (1YNG)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
31(1) 1YNG|6|A
891NR_all_01772.1
Exact match
3SNP|1|D (3SNP)
  • ferritin H IRE RNA, ferritin IRE RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å30(4) 3SNP|1|D, 3SNP|1|C, 2IPY|1|C, 2IPY|1|D
892NR_all_07356.1
Exact match
Human immunodeficiency virus 1
6MCE|1|A (6MCE)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 6MCE|1|A
893NR_all_09737.1
Exact match
Thermus thermophilus
1ZC8|1|G (1ZC8)
  • protein kinase 4 mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
13.0 Å30(1) 1ZC8|1|G
894NR_all_12719.1
Exact match
4IFD|1|R (4IFD)
  • RNA (45-MER), RNA synthetic
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å30(2) 4IFD|1|R, 5C0X|1|R
895NR_all_17006.1
Exact match
1EBR|1|A (1EBR)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 1EBR|1|A
896NR_all_17965.1
Exact match
Enterovirus B
1RFR|3|A (1RFR)
  • stemloop-D RNA of the 5'-cloverleaf of c[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
30(1) 1RFR|3|A
897NR_all_18727.1
Exact match
1AKX|1|A (1AKX)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 1AKX|1|A
898NR_all_29695.1
Exact match
1LDZ|3|A (1LDZ)
  • LEAD-DEPENDENT RIBOZYME
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
30(2) 1LDZ|3|A, 2LDZ|1|A
899NR_all_29722.1
Exact match
1AJU|9|A (1AJU)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
30(1) 1AJU|9|A
900NR_all_33072.1
Exact match
Canis lupus
4V5Z|1|BR (4V5Z)
  • RNA Expansion segment ES39 part I, RNA E[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BR; model(s): 1
8.7 Å30(2) 4V5Z|1|BR, 4V5Z|1|BT
901NR_all_45264.1
Exact match
1KP7|1|A (1KP7)
  • Hepatitis C Virus Internal Ribosome Entr[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 1KP7|1|A
902NR_all_58813.1
Exact match
1HWQ|1|A (1HWQ)
  • VS RIBOZYME SUBSTRATE RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 1HWQ|1|A
903NR_all_59504.1
Exact match
1HVU|1|I (1HVU)
  • RNA (33 NUCLEOTIDE RNA PSEUDOKNOT)
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
4.8 Å30(4) 1HVU|1|I, 1HVU|1|L, 1HVU|1|C, 1HVU|1|F
904NR_all_66595.1
Exact match
Canis lupus
4V5Z|1|BJ (4V5Z)
  • RNA Expansion segment ES15 part II
  • ELECTRON MICROSCOPY
  • Chain(s): BJ; model(s): 1
8.7 Å30(1) 4V5Z|1|BJ
905NR_all_68509.1
Exact match
Canis lupus
4V5Z|1|BQ (4V5Z)
  • RNA Expansion segment ES31 part II
  • ELECTRON MICROSCOPY
  • Chain(s): BQ; model(s): 1
8.7 Å30(1) 4V5Z|1|BQ
906NR_all_83665.1
Exact match
Saccharomyces cerevisiae
5Y58|1|X (5Y58)
  • TLC1
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.8 Å30(3) 5Y58|1|X, 5Y58|1|Y, 5Y58|1|Z
907NR_all_85681.1
Exact match
1EKZ|4|B (1EKZ)
  • STAUFEN DOUBLE-STRANDED RNA BINDING DOMA[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 4
30(1) 1EKZ|4|B
908NR_all_89800.1
Exact match
1AUD|8|B (1AUD)
  • RNA 3UTR
  • SOLUTION NMR
  • Chain(s): B; model(s): 8
30(1) 1AUD|8|B
909NR_all_94450.1
Exact match
1NA2|1|A (1NA2)
  • telomerase RNA p2b hairpin
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 1NA2|1|A
910NR_all_95363.3
Exact match
3K1V|1|A (3K1V)
  • PreQ1 riboswitch, RNA (36-MER), 36-MER
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å30(7) 3K1V|1|A, 3FU2|1|C, 3FU2|1|B, 3FU2|1|A, 3FU4|1|A, 2KFC|4|A, 2L1V|1|A
911NR_all_00390.1
Exact match
1AQO|3|A (1AQO)
  • IRON RESPONSIVE ELEMENT RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
29(1) 1AQO|3|A
912NR_all_00786.1
Exact match
2KDQ|1|B (2KDQ)
  • HIV-1 TAR RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
29(1) 2KDQ|1|B
913NR_all_02086.1
Exact match
3BBM|1|B+3BBM|1|C+3BBM|1|A (3BBM)
  • Loop A and Loop B Ribozyme strand, Loop [...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, J; model(s): 1
2.7 Å29(10) 3BBM|1|B+3BBM|1|C+3BBM|1|A, 3B5S|1|B+3B5S|1|C+3B5S|1|A, 3B5A|1|B+3B5A|1|C+3B5A|1|A, 3BBI|1|B+3BBI|1|C+3BBI|1|A, 3BBK|1|B+3BBK|1|C+3BBK|1|A, 3B91|1|B+3B91|1|C+3B91|1|A, 3B5F|1|B+3B5F|1|C+3B5F|1|A, 3B58|1|B+3B58|1|C+3B58|1|A, 4G6P|1|B+4G6P|1|C+4G6P|1|A, 4G6S|1|B+4G6S|1|C+4G6S|1|A
914NR_all_02783.1
Exact match
1EBS|1|A (1EBS)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 1EBS|1|A
915NR_all_03275.1
Exact match
Escherichia coli
5MS0|1|R (5MS0)
  • nascent RNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
9.8 Å29(1) 5MS0|1|R
916NR_all_03525.1
Exact match
Escherichia coli
2BH2|1|D (2BH2)
  • 23S RIBOSOMAL RNA 1932-1968
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å29(2) 2BH2|1|D, 2BH2|1|C
917NR_all_04787.1
Exact match
Saccharomyces cerevisiae
2M24|9|A (2M24)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
29(1) 2M24|9|A
918NR_all_15581.1
Exact match
Rattus norvegicus
1SCL|4|A (1SCL)
  • RNA SARCIN-RICIN LOOP
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
29(1) 1SCL|4|A
919NR_all_21583.1
Exact match
2JWV|1|A (2JWV)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 2JWV|1|A
920NR_all_24762.1
Exact match
1EBQ|1|A (1EBQ)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 1EBQ|1|A
921NR_all_27126.1
Exact match
Human immunodeficiency virus 1
1QD3|1|A (1QD3)
  • HIV-1 TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 1QD3|1|A
922NR_all_28654.1
Exact match
2KX5|1|A (2KX5)
  • HIV TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 2KX5|1|A
923NR_all_29847.1
Exact match
2L8H|3|A (2L8H)
  • HIV TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
29(1) 2L8H|3|A
924NR_all_33015.1
Exact match
Human immunodeficiency virus 1
5J0M|1|B (5J0M)
  • Apical region (29-mer) of the HIV-1 TAR [...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
29(1) 5J0M|1|B
925NR_all_34881.1
Exact match
1F84|10|A (1F84)
  • HCV-1B IRES RNA DOMAIN IIID
  • SOLUTION NMR
  • Chain(s): A; model(s): 10
29(1) 1F84|10|A
926NR_all_35232.1
Exact match
Human immunodeficiency virus 1
1UUD|1|B (1UUD)
  • RNA (5'-(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
29(1) 1UUD|1|B
927NR_all_42491.1
Exact match
Human immunodeficiency virus 1
1UUI|1|B (1UUI)
  • 5'-R(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
29(1) 1UUI|1|B
928NR_all_48894.1
Exact match
2K64|1|A (2K64)
  • 29-MER, 5'-R(*CP*AP*GP*UP*GP*UP*C)-3', R[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(2) 2K64|1|A, 2M23|1|A
929NR_all_48921.1
Exact match
Thermus thermophilus
1ZC8|1|F (1ZC8)
  • H5 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
13.0 Å29(1) 1ZC8|1|F
930NR_all_50423.1
Exact match
Human immunodeficiency virus 1
5J2W|1|B (5J2W)
  • Apical region (29mer) of the HIV-1 TAR R[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
29(1) 5J2W|1|B
931NR_all_51124.1
Exact match
Homo sapiens
6DU4|1|B (6DU4)
  • hp1x-RNA (29-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å29(1) 6DU4|1|B
932NR_all_52900.1
Exact match
1ANR|2|A (1ANR)
  • RNA REGULATORY ELEMENT TAR
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
29(1) 1ANR|2|A
933NR_all_55924.2
Exact match
1OOA|1|C (1OOA)
  • RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å29(2) 1OOA|1|C, 1OOA|1|D
934NR_all_57955.2
Exact match
1Q96|1|A (1Q96)
  • sarcin/ricin 28S rRNA, SARCIN/RICIN LOOP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å29(8) 1Q96|1|A, 1Q96|1|B, 1Q96|1|C, 1Q93|1|C, 1Q93|1|A, 1Q93|1|B, 430D|1|A, 1C04|1|F
935NR_all_75875.1
Exact match
3SN2|1|B (3SN2)
  • transferrin receptor iron regulatory ele[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å29(1) 3SN2|1|B
936NR_all_76462.1
Exact match
1ARJ|7|N (1ARJ)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): N; model(s): 7
29(1) 1ARJ|7|N
937NR_all_78170.1
Exact match
1L1C|1|C (1L1C)
  • licT mRNA antiterminator hairpin
  • SOLUTION NMR
  • Chain(s): C; model(s): 1
29(1) 1L1C|1|C
938NR_all_78730.1
Exact match
Thermus thermophilus
2OM7|1|F (2OM7)
  • Fragment of23S rRNA (H95)
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
7.3 Å29(1) 2OM7|1|F
939NR_all_79547.1
Exact match
2R1G|1|F (2R1G)
  • 16S RIBOSOMAL RNA HELIX 45
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
12.5 Å29(1) 2R1G|1|F
940NR_all_79607.1
Exact match
3J2K|1|4 (3J2K)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
29(1) 3J2K|1|4
941NR_all_82905.1
Exact match
2GIO|1|A (2GIO)
  • 29-MER, 28-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(2) 2GIO|1|A, 2GIP|1|A
942NR_all_86990.1
Exact match
Canis lupus
4V5Z|1|AC (4V5Z)
  • RNA Expansion segment ES4
  • ELECTRON MICROSCOPY
  • Chain(s): AC; model(s): 1
8.7 Å29(1) 4V5Z|1|AC
943NR_all_87910.1
Exact match
synthetic construct
6D2U|1|B (6D2U)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
29(1) 6D2U|1|B
944NR_all_88506.1
Exact match
2K5Z|3|A (2K5Z)
  • Duck HBV apical loop
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
29(1) 2K5Z|3|A
945NR_all_89498.1
Exact match
Human immunodeficiency virus 1
5J1O|2|B (5J1O)
  • Apical region (29mer) of the HIV-1 TAR e[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 2
29(1) 5J1O|2|B
946NR_all_91100.1
Exact match
2K63|12|A (2K63)
  • 29-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 12
29(1) 2K63|12|A
947NR_all_91317.1
Exact match
1NBR|10|A (1NBR)
  • RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): A; model(s): 10
29(1) 1NBR|10|A
948NR_all_91774.1
Exact match
Human immunodeficiency virus 1
1UTS|2|B (1UTS)
  • RNA (5'-(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 2
29(1) 1UTS|2|B
949NR_all_92938.1
Exact match
Mus musculus
5LSN|1|A (5LSN)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 5LSN|1|A
950NR_all_95171.1
Exact match
3MJA|1|B (3MJA)
  • Domain 3 of the cricket paralysis virus [...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å29(4) 3MJA|1|B, 3B31|1|A, 3MJ3|1|B, 3MJB|1|A
951NR_all_95796.1
Exact match
Saccharomyces cerevisiae
2M1V|1|A (2M1V)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 2M1V|1|A
952NR_all_10635.1
Exact match
1ZBN|1|A (1ZBN)
  • BIV mRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
28(1) 1ZBN|1|A
953NR_all_14513.1
Exact match
Homo sapiens
3SIU|1|F (3SIU)
  • U4atac snRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å28(2) 3SIU|1|F, 3SIU|1|C
954NR_all_14960.1
Exact match
synthetic construct
2NC0|1|A (2NC0)
  • IRES RNA (28-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
28(1) 2NC0|1|A
955NR_all_18396.1
Exact match
synthetic construct
3ZC0|1|M (3ZC0)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.0 Å28(3) 3ZC0|1|M, 3ZC0|1|O, 3ZC0|1|N
956NR_all_18914.1
Exact match
Homo sapiens
6AAX|1|B (6AAX)
  • RNA (28-mer)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å28(2) 6AAX|1|B, 6AAX|1|D
957NR_all_21041.1
Exact match
Homo sapiens
5MWI|1|A (5MWI)
  • RNA G(CUG)8C duplex
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.5 Å28(1) 5MWI|1|A
958NR_all_27965.1
Exact match
1MNB|1|B (1MNB)
  • BIV TAR RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
28(1) 1MNB|1|B
959NR_all_37650.1
Exact match
Escherichia coli
28SR|1|A (28SR)
  • SRP DOMAIN IV, CONSERVED MOTIF IN SRP RN[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
28(2) 28SR|1|A, 28SP|1|A
960NR_all_37659.1
Exact match
2NCI|1|A (2NCI)
  • RNA (28-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
28(1) 2NCI|1|A
961NR_all_39330.1
Exact match
Saccharomyces cerevisiae
2X7N|1|A (2X7N)
  • SARCIN-RICIN LOOP
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
11.8 Å28(1) 2X7N|1|A
962NR_all_44411.1
Exact match
Human immunodeficiency virus 2
2KMJ|4|A (2KMJ)
  • RNA (28-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
28(1) 2KMJ|4|A
963NR_all_44743.1
Exact match
Homo sapiens
6AJK|1|B (6AJK)
  • RNA (28-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å28(1) 6AJK|1|B
964NR_all_45541.1
Exact match
synthetic construct
1BIV|5|A (1BIV)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
28(1) 1BIV|5|A
965NR_all_52096.2
Exact match
synthetic construct
4TUW|1|C (4TUW)
  • HISTONE MRNA 3' STEM LOOP, RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å28(5) 4TUW|1|C, 4TUW|1|D, 4TV0|1|B, 4TUX|1|D, 4TUX|1|C
966NR_all_52425.1
Exact match
2EZ6|1|D (2EZ6)
  • 28-MER, RNA12, RNA10
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å28(8) 2EZ6|1|D, 2EZ6|1|C, 4M30|1|D, 4M30|1|C, 2NUF|1|D, 2NUF|1|C, 4M2Z|1|C, 4M2Z|1|D
967NR_all_52795.1
Exact match
2LUN|8|A (2LUN)
  • RNA (28-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
28(1) 2LUN|8|A
968NR_all_57646.1
Exact match
Saccharomyces cerevisiae
5M0J|1|E (5M0J)
  • ASH1 E3 (28 nt-loop)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.8 Å28(1) 5M0J|1|E
969NR_all_68428.1
Exact match
1D4R|1|B+1D4R|1|A (1D4R)
  • 29-MER OF MODIFIED SRP RNA HELIX 6
  • X-RAY DIFFRACTION
  • Chain(s): A, B, J; model(s): 1
2.0 Å28(2) 1D4R|1|B+1D4R|1|A, 1D4R|1|C
970NR_all_73700.1
Exact match
Homo sapiens
6AAS|1|A (6AAS)
  • RNA (28-MER), RNA (24-mer)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
28(2) 6AAS|1|A, 6AAU|1|A
971NR_all_74884.1
Exact match
2R1G|1|D (2R1G)
  • 16S RIBOSOMAL RNA HELIX 28
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
12.5 Å28(1) 2R1G|1|D
972NR_all_78207.1
Exact match
1YSH|1|A (1YSH)
  • RNA (28-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
9.5 Å28(1) 1YSH|1|A
973NR_all_78625.1
Exact match
Saccharomyces cerevisiae
5M0J|1|F (5M0J)
  • ASH1 E3 (28 nt-loop)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å28(1) 5M0J|1|F
974NR_all_86202.1
Exact match
Saccharomyces cerevisiae
5M0I|1|F (5M0I)
  • ASH1-E3 element, RNA (28-MER)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.4 Å28(1) 5M0I|1|F
975NR_all_90603.1
Exact match
Saccharomyces cerevisiae
5M0I|1|E (5M0I)
  • ASH1-E3 element, RNA (28-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.4 Å28(1) 5M0I|1|E
976NR_all_92078.1
Exact match
Escherichia coli
4CXH|1|x (4CXH)
  • MESSENGER RNA
  • ELECTRON MICROSCOPY
  • Chain(s): x; model(s): 1
8.9 Å28(1) 4CXH|1|x
977NR_all_93829.1
Exact match
2A9X|1|2 (2A9X)
  • BIV TAR RNA
  • SOLUTION NMR
  • Chain(s): 2; model(s): 1
28(1) 2A9X|1|2
978NR_all_94729.3
Exact match
4NLF|1|A (4NLF)
  • 23S ribosomal RNA Sarcin Ricin Loop, RNA[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.0 Å28(28) 4NLF|1|A, 5D99|1|A, 1Q9A|1|A, 4NMG|1|A, 3DW4|1|A, 3DW6|1|A, 4Y27|1|A, 3DVZ|1|A, 4NXH|1|A, 5NQI|1|A, 3S7C|1|A, 5MRX|1|A, 3DW5|1|A, 3DW7|1|A, 483D|1|A, 3S8U|1|A, 1MSY|1|A, 480D|1|A, 1JBR|1|D, 1JBT|1|C, 1JBT|1|D, 1JBS|1|D, 1JBS|1|C, 3EQ3|1|D, 3EP2|1|D, 3DEG|1|I, 1EG0|1|M, 3EQ4|1|D
979NR_all_00165.1
Exact match
1F7H|5|A (1F7H)
  • RNASE P RNA RIBOZYME, P4 DOMAIN
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
27(1) 1F7H|5|A
980NR_all_03120.1
Exact match
Escherichia coli
3BO0|1|E (3BO0)
  • 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
9.6 Å27(2) 3BO0|1|E, 3BO1|1|E
981NR_all_04218.1
Exact match
synthetic construct
2M4Q|6|1 (2M4Q)
  • RNA (27-MER), FRAGMENT OF 18S RIBOSOMAL [...]
  • SOLUTION NMR
  • Chain(s): 1; model(s): 6
27(2) 2M4Q|6|1, 1FYO|1|A
982NR_all_09346.1
Exact match
2AP5|1|A (2AP5)
  • C27A Sugarcane Yellow Leaf Virus RNA pse[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 2AP5|1|A
983NR_all_10362.1
Exact match
Enterobacteria phage lambda
5LM7|1|G (5LM7)
  • RNA (29-MER)
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.4 Å27(2) 5LM7|1|G, 5LM7|1|R
984NR_all_10777.1
Exact match
1TRJ|1|C (1TRJ)
  • Helix 40 of 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
11.7 Å27(1) 1TRJ|1|C
985NR_all_12506.1
Exact match
2AHT|1|A (2AHT)
  • 27-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 2AHT|1|A
986NR_all_15848.1
Exact match
Hepatitis B virus
2IXY|1|A (2IXY)
  • 5'-R(*GP*GP*CP*CP*UP*CP*CP*AP*AP*GP *CP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 2IXY|1|A
987NR_all_18069.1
Exact match
1FQZ|1|A (1FQZ)
  • HEPATITIS C VIRUS IRES DOMAIN IIID
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1FQZ|1|A
988NR_all_20773.1
Exact match
6O7H|1|G+6O7H|1|H (6O7H)
  • RNA (38-MER), RNA (40-MER), RNA (5'-R(*G[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A, G, H, J; model(s): 1
2.9 Å27(7) 6O7H|1|G+6O7H|1|H, 6O7E|1|G+6O7E|1|H, 6MUT|1|G+6MUT|1|H, 6MUR|1|G+6MUR|1|H, 6O7I|1|G+6O7I|1|H, 6MUU|1|G, 6MUS|1|G+6MUS|1|H
989NR_all_22999.1
Exact match
1YG4|1|A (1YG4)
  • ScYLV RNA pseudoknot
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1YG4|1|A
990NR_all_23387.1
Exact match
Canis lupus
4V5Z|1|BB (4V5Z)
  • RNA Expansion segment ES4
  • ELECTRON MICROSCOPY
  • Chain(s): BB; model(s): 1
8.7 Å27(1) 4V5Z|1|BB
991NR_all_24573.1
Exact match
Saccharomyces cerevisiae
4YHW|1|F+4YHW|1|D (4YHW)
  • U6 snRNA fragment, U4 snRNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): A, D, F, J; model(s): 1
3.3 Å27(1) 4YHW|1|F+4YHW|1|D
992NR_all_24791.1
Exact match
3GS5|1|A (3GS5)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å27(1) 3GS5|1|A
993NR_all_30619.2
Exact match
2KXM|1|A (2KXM)
  • RNA (27-MER), RNA_(27-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(3) 2KXM|1|A, 2N0J|3|A, 2MXS|5|A
994NR_all_30667.1
Exact match
1XOK|1|A (1XOK)
  • alfalfa mosaic virus RNA 3' UTR
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å27(1) 1XOK|1|A
995NR_all_32911.1
Exact match
Human immunodeficiency virus 1
6CMN|1|D (6CMN)
  • Trans-Activation Response RNA Element, R[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å27(3) 6CMN|1|D, 6CYT|1|N, 5L1Z|1|N
996NR_all_34537.1
Exact match
484D|2|B (484D)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): B; model(s): 2
27(1) 484D|2|B
997NR_all_36362.1
Exact match
1XSH|1|A (1XSH)
  • RNase P RNA P4 stem, RNA (27-MER), 5'-R([...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(7) 1XSH|1|A, 1XSU|1|A, 2CD3|1|A, 1F7I|2|A, 2CD6|1|A, 1F6Z|1|A, 1F79|1|A
998NR_all_39089.1
Exact match
Escherichia coli
3BO1|1|D (3BO1)
  • 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
9.6 Å27(2) 3BO1|1|D, 3BO0|1|D
999NR_all_45664.1
Exact match
1YG3|1|A (1YG3)
  • ScYLV RNA pseudoknot
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1YG3|1|A
1000NR_all_46023.1
Exact match
1YSV|1|A (1YSV)
  • 27-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1YSV|1|A
1001NR_all_49799.1
Exact match
2B63|1|R (2B63)
  • 31-MER
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.8 Å27(1) 2B63|1|R
1002NR_all_52143.1
Exact match
1XSG|1|A (1XSG)
  • RNase P RNA P4 stem, RNA (27-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(2) 1XSG|1|A, 1XST|1|A
1003NR_all_52148.1
Exact match
Human immunodeficiency virus 1
2LDL|1|A (2LDL)
  • RNA (27-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 2LDL|1|A
1004NR_all_52226.1
Exact match
1FYP|1|A (1FYP)
  • FRAGMENT OF 18S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1FYP|1|A
1005NR_all_54907.1
Exact match
1PBR|1|A (1PBR)
  • 16S RIBOSOMAL RNA, RNA (16S RNA)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(2) 1PBR|1|A, 1BYJ|31|A
1006NR_all_56057.1
Exact match
2LQZ|3|A (2LQZ)
  • RNA (27-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
27(1) 2LQZ|3|A
1007NR_all_56766.1
Exact match
Escherichia coli
2CD5|1|A (2CD5)
  • 5'-R(*GP*GP*AP*AP*GP*UP*CP*CP*GP*GP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(5) 2CD5|1|A, 1F6X|1|A, 2CD1|1|A, 1F78|1|A, 1F7F|3|A
1008NR_all_63125.1
Exact match
1TOB|1|A (1TOB)
  • RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1TOB|1|A
1009NR_all_67463.1
Exact match
2AP0|9|A (2AP0)
  • C27A Sugarcane Yellow Leaf Virus RNA pse[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
27(1) 2AP0|9|A
1010NR_all_69068.1
Exact match
Escherichia coli
1MVR|1|E (1MVR)
  • Helix 93 of 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
12.8 Å27(1) 1MVR|1|E
1011NR_all_79685.1
Exact match
Saccharomyces cerevisiae
4YHW|1|E+4YHW|1|C (4YHW)
  • U6 snRNA fragment, U4 snRNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): A, C, E, J; model(s): 1
3.3 Å27(1) 4YHW|1|E+4YHW|1|C
1012NR_all_80099.1
Exact match
2LJJ|1|A (2LJJ)
  • IV-B RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 2LJJ|1|A
1013NR_all_83539.1
Exact match
1F7G|1|A (1F7G)
  • RNASE P RNA RIBOZYME, P4 DOMAIN
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1F7G|1|A
1014NR_all_90233.1
Exact match
Escherichia coli
1MJ1|1|R (1MJ1)
  • helix 69 of 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
13.0 Å27(1) 1MJ1|1|R
1015NR_all_91237.1
Exact match
Escherichia coli
1QZC|1|C (1QZC)
  • 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
9.0 Å27(1) 1QZC|1|C
1016NR_all_92049.1
Exact match
1KPZ|1|A (1KPZ)
  • P1-P2 frameshifting pseudoknot
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(2) 1KPZ|1|A, 1KPY|3|A
1017NR_all_02574.1
Exact match
Senecavirus A
4PHY|1|A+4PHY|1|B (4PHY)
  • RNA (26-MER), RNA (5'-R(*GP*CP*AP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, J; model(s): 1
3.1 Å26(1) 4PHY|1|A+4PHY|1|B
1018NR_all_08420.1
Exact match
2A43|1|A (2A43)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å26(1) 2A43|1|A
1019NR_all_11428.1
Exact match
Pseudomonas phage PRR1
4ANG|1|R (4ANG)
  • 5'-R(*CP*CP*AP*UP*AP*AP*GP*GP*AP*GP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.5 Å26(2) 4ANG|1|R, 4ANG|1|S
1020NR_all_26264.1
Exact match
1JID|1|B (1JID)
  • HELIX 6 OF HUMAN SRP RNA, SRP19 binding [...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å26(2) 1JID|1|B, 1L1W|1|A
1021NR_all_26321.2
Exact match
4QOZ|1|A (4QOZ)
  • histone mRNA stem-loop
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å26(6) 4QOZ|1|A, 4L8R|1|A, 4QOZ|1|D, 4L8R|1|D, 4HXH|1|A, 4HXH|1|D
1022NR_all_26836.2
Exact match
Haloarcula marismortui
4BW0|1|A (4BW0)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å26(9) 4BW0|1|A, 5FJ1|1|B, 5FJ1|1|E, 5FJ1|1|C, 5FJ1|1|A, 5FJ1|1|D, 5FJ1|1|F, 5FJ1|1|H, 5FJ1|1|G
1023NR_all_36664.1
Exact match
6H9H|1|E (6H9H)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.8 Å26(1) 6H9H|1|E
1024NR_all_45183.1
Exact match
1QWB|4|A (1QWB)
  • sNRE26
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
26(1) 1QWB|4|A
1025NR_all_48282.1
Exact match
2RFK|1|E+2RFK|1|D+2RFK|1|F (2RFK)
  • guide RNA 2, guide RNA 1, target RNA
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, J; model(s): 1
2.9 Å26(1) 2RFK|1|E+2RFK|1|D+2RFK|1|F
1026NR_all_67137.1
Exact match
Lachnospiraceae bacterium ND2006
6P7M|1|B (6P7M)
  • mature crRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.0 Å26(3) 6P7M|1|B, 6P7N|1|B, 6P7N|1|F
1027NR_all_74739.1
Exact match
synthetic construct
6IV6|1|G (6IV6)
  • RNA (59-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
3.6 Å26(1) 6IV6|1|G
1028NR_all_74744.1
Exact match
2RP1|1|A (2RP1)
  • PEMV-1 mRNA pseudoknot
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
26(2) 2RP1|1|A, 2RP0|4|A
1029NR_all_89224.1
Exact match
2F8T|1|C+2F8T|1|D (2F8T)
  • 26-MER
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, J; model(s): 1
3.1 Å26(1) 2F8T|1|C+2F8T|1|D
1030NR_all_89470.1
Exact match
2MIS|1|A (2MIS)
  • VS Ribozyme, RNA (26-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
26(2) 2MIS|1|A, 2L5Z|1|A
1031NR_all_96653.1
Exact match
387D|1|A (387D)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å26(1) 387D|1|A
1032NR_all_02858.1
Exact match
2QUX|1|F (2QUX)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.4 Å25(6) 2QUX|1|F, 2QUX|1|I, 2QUX|1|C, 2QUX|1|R, 2QUX|1|O, 2QUX|1|L
1033NR_all_08337.1
Exact match
Pariacoto virus
1F8V|1|R (1F8V)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å25(1) 1F8V|1|R
1034NR_all_16134.1
Exact match
Saccharomyces cerevisiae
2WW9|1|F (2WW9)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
8.6 Å25(2) 2WW9|1|F, 2WWA|1|F
1035NR_all_30036.1
Exact match
2KGP|1|A (2KGP)
  • RNA (25-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
25(1) 2KGP|1|A
1036NR_all_31526.1
Exact match
1M82|1|A (1M82)
  • RNA (25-MER): THE COMPLEMENTARY RNA PROM[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
25(1) 1M82|1|A
1037NR_all_34039.1
Exact match
Homo sapiens
6DU5|1|B (6DU5)
  • hp6-RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å25(1) 6DU5|1|B
1038NR_all_54148.1
Exact match
Canis lupus
4V5Z|1|BH (4V5Z)
  • RNA Expansion segment ES12
  • ELECTRON MICROSCOPY
  • Chain(s): BH; model(s): 1
8.7 Å25(1) 4V5Z|1|BH
1039NR_all_65028.2
Exact match
359D|1|B+359D|1|A (359D)
  • RNA HAMMERHEAD RIBOZYME, 5'-R(*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, F, J; model(s): 1
2.9 Å25(10) 359D|1|B+359D|1|A, 301D|1|B+301D|1|A, 1MME|1|D+1MME|1|C, 299D|1|B+299D|1|A, 1MME|1|B+1MME|1|A, 300D|1|B+300D|1|A, 1NYI|1|B+1NYI|1|A, 1Q29|1|B+1Q29|1|A, 488D|1|D+488D|1|B+488D|1|A+488D|1|C, 379D|1|B+379D|1|A
1040NR_all_79502.1
Exact match
3HJY|1|D+3HJY|1|C+3HJY|1|E (3HJY)
  • RNA (25-MER), 5'-R(*GP*GP*GP*CP*UP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
3.7 Å25(1) 3HJY|1|D+3HJY|1|C+3HJY|1|E
1041NR_all_81333.1
Exact match
3WBM|1|X+3WBM|1|Y (3WBM)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E, J, X, Y; model(s): 1
2.0 Å25(1) 3WBM|1|X+3WBM|1|Y
1042NR_all_81641.1
Exact match
Drosophila melanogaster
6F4G|1|C (6F4G)
  • U2-SL4
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å25(2) 6F4G|1|C, 6F4G|1|F
1043NR_all_82252.1
Exact match
1QC8|1|A (1QC8)
  • TAU EXON 10 SPLICING REGULATORY ELEMENT [...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
25(1) 1QC8|1|A
1044NR_all_87385.1
Exact match
Canis lupus
4V5Z|1|BK (4V5Z)
  • RNA Expansion segment ES19
  • ELECTRON MICROSCOPY
  • Chain(s): BK; model(s): 1
8.7 Å25(1) 4V5Z|1|BK
1045NR_all_89190.1
Exact match
Saccharomyces cerevisiae
5GAM|1|W (5GAM)
  • U6 snRNA, 5' end
  • ELECTRON MICROSCOPY
  • Chain(s): W; model(s): 1
3.7 Å25(1) 5GAM|1|W
1046NR_all_98716.1
Exact match
1EI2|9|A (1EI2)
  • TAU EXON 10 SRE RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
25(1) 1EI2|9|A
1047NR_all_99842.1
Exact match
Triticum aestivum
2WWB|1|F (2WWB)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
6.5 Å25(1) 2WWB|1|F
1048NR_all_04723.1
Exact match
2HEM|1|A (2HEM)
  • 5'-R(P*GP*GP*GP*AP*AP*GP*GP*CP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 2HEM|1|A
1049NR_all_06489.1
Exact match
1KKS|1|A (1KKS)
  • 5'-R(*GP*GP*AP*AP*GP*GP*CP*CP*CP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 1KKS|1|A
1050NR_all_08924.1
Exact match
Methanococcus maripaludis
4Z7K|1|C (4Z7K)
  • RNA/DNA Hybrid (31-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å24(1) 4Z7K|1|C
1051NR_all_09747.1
Exact match
2QH2|1|A (2QH2)
  • Human telomerase RNA CR7 terminal hairpi[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 2QH2|1|A
1052NR_all_15188.1
Exact match
3NVK|1|K+3NVK|1|G (3NVK)
  • RNA (5'-R(*GP*CP*CP*GP*UP*UP*GP*AP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, G, J, K; model(s): 1
3.2 Å24(2) 3NVK|1|K+3NVK|1|G, 3NVK|1|L+3NVK|1|S
1053NR_all_20710.1
Exact match
1NYB|1|B (1NYB)
  • BoxB RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
24(1) 1NYB|1|B
1054NR_all_29415.1
Exact match
Homo sapiens
6BSG|1|R (6BSG)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å24(3) 6BSG|1|R, 6BSH|1|R, 6BSJ|1|R
1055NR_all_30596.1
Exact match
3A6P|1|E+3A6P|1|D (3A6P)
  • pre-microRNA
  • X-RAY DIFFRACTION
  • Chain(s): D, E, J; model(s): 1
2.9 Å24(2) 3A6P|1|E+3A6P|1|D, 3A6P|1|J+3A6P|1|I
1056NR_all_33071.1
Exact match
2F4X|1|A+2F4X|1|B (2F4X)
  • 5'-R(P*GP*GP*UP*UP*GP*CP*UP*GP*AP*AP*GP*[...]
  • SOLUTION NMR
  • Chain(s): A, B, E, J; model(s): 1
24(1) 2F4X|1|A+2F4X|1|B
1057NR_all_33684.1
Exact match
2R1G|1|A (2R1G)
  • 16S RIBOSOMAL RNA HELIX 1
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
12.5 Å24(1) 2R1G|1|A
1058NR_all_34197.1
Exact match
2KF0|2|A (2KF0)
  • RNA (5'-R(*GP*GP*UP*UP*CP*CP*CP*CP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
24(2) 2KF0|2|A, 2KEZ|1|A
1059NR_all_37932.1
Exact match
1MT4|4|A (1MT4)
  • 23S ribosomal Hairpin 35
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
24(1) 1MT4|4|A
1060NR_all_46548.1
Exact match
2LV0|1|A (2LV0)
  • RNA (5'-R(*GP*GP*GP*CP*UP*AP*AP*UP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(2) 2LV0|1|A, 2GBH|1|A
1061NR_all_50588.1
Exact match
Pyrococcus furiosus
3NVI|1|F (3NVI)
  • RNA (5'-R(*CP*UP*CP*UP*GP*AP*CP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.7 Å24(2) 3NVI|1|F, 3NVI|1|E
1062NR_all_52870.1
Exact match
synthetic construct
5JC7|1|X+5JC7|1|Y (5JC7)
  • RNA (5'-R(P*GP*GP*AP*CP*GP*UP*CP*AP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, J, X, Y; model(s): 1
2.8 Å24(1) 5JC7|1|X+5JC7|1|Y
1063NR_all_53829.1
Exact match
1SY4|5|A (1SY4)
  • U6 Intramolecular Stem-Loop RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
24(1) 1SY4|5|A
1064NR_all_58228.1
Exact match
Pseudomonas aeruginosa
5XLP|1|K (5XLP)
  • crRNA with 20nt spacer sequence
  • ELECTRON MICROSCOPY
  • Chain(s): K; model(s): 1
4.2 Å24(1) 5XLP|1|K
1065NR_all_59452.1
Exact match
1NC0|2|A (1NC0)
  • U80G U6 RNA Intramolecular Stem-Loop
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
24(1) 1NC0|2|A
1066NR_all_61819.1
Exact match
unidentified
6BU9|1|B+6BU9|1|C (6BU9)
  • RNA (5'-R(*GP*GP*AP*GP*GP*UP*AP*GP*UP*AP[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B, C, E, J; model(s): 1
6.8 Å24(1) 6BU9|1|B+6BU9|1|C
1067NR_all_66000.1
Exact match
1E4P|8|A (1E4P)
  • RNA (5'-R(*GP*UP*GP*CP*GP*AP*AP*GP*AP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
24(1) 1E4P|8|A
1068NR_all_66919.1
Exact match
Thermus thermophilus
1X18|1|D (1X18)
  • 5'-R(P*UP*GP*UP*UP*GP*GP*GP*UP*UP*AP*AP*[...]
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
13.5 Å24(1) 1X18|1|D
1069NR_all_67726.2
Exact match
synthetic construct
5F9F|1|F (5F9F)
  • RNA (5'-R(*GP*AP*AP*UP*AP*UP*AP*AP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å24(18) 5F9F|1|F, 5F9F|1|L, 5F9F|1|H, 5F9F|1|B, 5F9F|1|J, 5F9F|1|D, 5F9H|1|F, 5F98|1|D, 5F98|1|B, 5F9H|1|L, 5F98|1|L, 5F98|1|J, 5F98|1|H, 5F98|1|F, 5F9H|1|J, 5F9H|1|D, 5F9H|1|B, 5F9H|1|H
1070NR_all_68474.1
Exact match
6IQW|1|I (6IQW)
  • RNA (5'-R(*GP*UP*GP*GP*AP*AP*AP*GP*UP*GP[...]
  • ELECTRON MICROSCOPY
  • Chain(s): I; model(s): 1
3.4 Å24(1) 6IQW|1|I
1071NR_all_71924.1
Exact match
Canis lupus
1RY1|1|O+1RY1|1|P (1RY1)
  • SRP RNA
  • ELECTRON MICROSCOPY
  • Chain(s): E, J, O, P; model(s): 1
12.0 Å24(1) 1RY1|1|O+1RY1|1|P
1072NR_all_80533.1
Exact match
1LC6|7|A (1LC6)
  • U6 Intramolecular Stem-loop RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
24(1) 1LC6|7|A
1073NR_all_82596.1
Exact match
1RHT|1|A (1RHT)
  • RNA (5'-R(P*GP*GP*GP*AP*CP*UP*GP*AP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 1RHT|1|A
1074NR_all_84568.1
Exact match
Homo sapiens
6BSI|1|R (6BSI)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å24(1) 6BSI|1|R
1075NR_all_85104.1
Exact match
1NJP|1|5 (1NJP)
  • tRNA acceptor stem mimic
  • X-RAY DIFFRACTION
  • Chain(s): 5; model(s): 1
3.5 Å24(2) 1NJP|1|5, 1NJM|1|5
1076NR_all_86436.1
Exact match
2PN3|1|A+2PN3|1|B (2PN3)
  • 5'-R(*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.9 Å24(5) 2PN3|1|A+2PN3|1|B, 2PN4|1|A+2PN4|1|B, 2PN4|1|C+2PN4|1|D, 2NOK|1|C+2NOK|1|D, 2NOK|1|A+2NOK|1|B
1077NR_all_88604.1
Exact match
1TFN|1|A (1TFN)
  • RNA (5'-R(*GP*GP*GP*AP*CP*UP*GP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 1TFN|1|A
1078NR_all_89332.1
Exact match
Homo sapiens
1A9N|1|Q (1A9N)
  • RNA (5'-R(*CP*CP*UP*GP*GP*UP*AP*UP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.4 Å24(2) 1A9N|1|Q, 1A9N|1|R
1079NR_all_94767.1
Exact match
synthetic construct
6O5F|1|D+6O5F|1|C (6O5F)
  • RNA (5'-R(P*CP*AP*AP*GP*GP*UP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
2.5 Å24(1) 6O5F|1|D+6O5F|1|C
1080NR_all_97142.1
Exact match
Saccharomyces cerevisiae
2LK3|1|A (2LK3)
  • RNA (5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 2LK3|1|A
1081NR_all_01648.1
Exact match
1S2F|1|A (1S2F)
  • 5'-R(*GP*GP*GP*GP*AP*GP*UP*GP*GP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1S2F|1|A
1082NR_all_01761.1
Exact match
synthetic construct
2N7X|15|A (2N7X)
  • RNA (5'-R(*GP*GP*UP*AP*GP*UP*UP*UP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 15
23(1) 2N7X|15|A
1083NR_all_04852.2
Exact match
Moorella thermoacetica
2UWM|1|D (2UWM)
  • 5'-R(*GP*GP*CP*GP*UP*UP*GP*CP*CP*GP *GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å23(7) 2UWM|1|D, 2UWM|1|C, 2PLY|1|C, 2PLY|1|E, 1WSU|1|E, 1WSU|1|F, 1WSU|1|G
1084NR_all_08464.1
Exact match
synthetic construct
4B3O|1|R (4B3O)
  • 5'-R(*AP*UP*GP*AP*3DRP*GP*GP*CP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å23(1) 4B3O|1|R
1085NR_all_10426.1
Exact match
2FRL|1|A (2FRL)
  • 5'-R(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2FRL|1|A
1086NR_all_12262.1
Exact match
1NZ1|1|A (1NZ1)
  • SP U6 Intramolecular Stem-Loop RNA, U6 I[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(2) 1NZ1|1|A, 1SYZ|2|A
1087NR_all_12586.1
Exact match
synthetic construct
2N3O|1|B (2N3O)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
23(1) 2N3O|1|B
1088NR_all_21529.1
New id, no parents
synthetic construct
6OZO|1|C+6OZO|1|D (6OZO)
  • DNA/RNA (5'-R(*CP*GP*GP*UP*AP*AP*CP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
2.2 Å23(1) 6OZO|1|C+6OZO|1|D
1089NR_all_21945.1
Exact match
3TS2|1|U (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.0 Å23(1) 3TS2|1|U
1090NR_all_22969.1
Exact match
2ES5|1|A (2ES5)
  • 5'-R(*GP*GP*AP*GP*AP*GP*GP*CP*UP*CP*UP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2ES5|1|A
1091NR_all_23180.1
Exact match
1HYS|1|E (1HYS)
  • 5'-R(*UP*CP*AP*GP*CP*CP*AP*CP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å23(1) 1HYS|1|E
1092NR_all_24378.1
Exact match
1OW9|1|A (1OW9)
  • A mimic of the VS Ribozyme Hairpin Subst[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1OW9|1|A
1093NR_all_25450.1
Exact match
1BAU|1|A+1BAU|1|B (1BAU)
  • SL1 RNA DIMER
  • SOLUTION NMR
  • Chain(s): A, B, E, J; model(s): 1
23(1) 1BAU|1|A+1BAU|1|B
1094NR_all_26375.1
Exact match
synthetic construct
2N2O|1|A (2N2O)
  • RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2N2O|1|A
1095NR_all_29527.1
Exact match
Homo sapiens
6GBM|1|A (6GBM)
  • RNA (5'-R(*GP*GP*CP*AP*GP*AP*UP*UP*AP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 6GBM|1|A
1096NR_all_32675.1
Exact match
3TS2|1|V (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.0 Å23(1) 3TS2|1|V
1097NR_all_36231.1
Exact match
2ANN|1|B (2ANN)
  • 5'-R(*CP*GP*CP*GP*CP*GP*GP*AP*UP*CP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å23(2) 2ANN|1|B, 2ANR|1|B
1098NR_all_42932.1
Exact match
synthetic construct
4P43|1|B+4P43|1|A (4P43)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.0 Å23(1) 4P43|1|B+4P43|1|A
1099NR_all_43385.1
Exact match
2M22|6|A (2M22)
  • 5'-R(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
23(1) 2M22|6|A
1100NR_all_43908.1
Exact match
Escherichia coli
5WQ1|1|A (5WQ1)
  • DsrA-SL1
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 5WQ1|1|A
1101NR_all_44457.1
Exact match
3PHP|1|A (3PHP)
  • RNA (5'-R(*GP*GP*UP*UP*CP*CP*GP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 3PHP|1|A
1102NR_all_45605.1
Exact match
Homo sapiens
5ED2|1|F+5ED2|1|E (5ED2)
  • RNA (5'-R(P*CP*AP*GP*AP*GP*CP*CP*CP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, J; model(s): 1
3.0 Å23(2) 5ED2|1|F+5ED2|1|E, 5ED2|1|C+5ED2|1|B
1103NR_all_48359.1
Exact match
synthetic construct
5UZ6|1|A (5UZ6)
  • RNA (25-MER), RNA (5'-D(*(8OS))-R(P*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å23(9) 5UZ6|1|A, 5UZ6|1|C, 5UZ6|1|E, 6BMD|1|C, 6BMD|1|A, 6BMD|1|E, 5V9Z|1|A, 5UX3|1|A, 5V0O|1|A
1104NR_all_50024.1
Exact match
1S34|1|A (1S34)
  • 5'-R(*GP*GP*GP*GP*AP*GP*UP*GP*GP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1S34|1|A
1105NR_all_53161.1
Exact match
1NEM|1|A (1NEM)
  • 5'-R(*GP*GP*AP*CP*UP*GP*GP*GP*CP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1NEM|1|A
1106NR_all_54107.1
Exact match
Saccharomyces cerevisiae
5ED1|1|C+5ED1|1|B (5ED1)
  • RNA (5'-R(*GP*AP*CP*UP*GP*AP*AP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, E, J; model(s): 1
2.8 Å23(3) 5ED1|1|C+5ED1|1|B, 5HP3|1|C+5HP3|1|B, 5HP2|1|C+5HP2|1|B
1107NR_all_57169.1
Exact match
1MFK|1|A (1MFK)
  • 5'-R(P*GP*GP*CP*GP*GP*UP*UP*GP*CP*AP*GP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1MFK|1|A
1108NR_all_58839.1
Exact match
Escherichia coli
6G63|1|B (6G63)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
4.0 Å23(1) 6G63|1|B
1109NR_all_64753.1
Exact match
Saccharomyces cerevisiae
6FSZ|1|2 (6FSZ)
  • RNA (5'-R(P*AP*AP*AP*AP*UP*UP*UP*AP*AP*A[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
4.6 Å23(1) 6FSZ|1|2
1110NR_all_65694.1
Exact match
2RO2|1|A (2RO2)
  • RNA (5'-R(*GP*GP*GP*AP*GP*AP*CP*CP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2RO2|1|A
1111NR_all_66081.1
Exact match
1JTJ|1|A (1JTJ)
  • HIV-1Lai SL1
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1JTJ|1|A
1112NR_all_68957.1
Exact match
2PJP|1|B (2PJP)
  • SECIS RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å23(1) 2PJP|1|B
1113NR_all_70019.1
Exact match
1K5I|2|A (1K5I)
  • 5'-R(P*GP*GP*AP*CP*CP*CP*GP*GP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
23(1) 1K5I|2|A
1114NR_all_76134.1
Exact match
Human immunodeficiency virus 1
1BVJ|1|A (1BVJ)
  • RNA (5'-R(P*GP*GP*CP*GP*AP*CP*GP*GP*UP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1BVJ|1|A
1115NR_all_77764.1
Exact match
Escherichia virus BZ13
5UF3|1|A (5UF3)
  • phage GA operator RNA hairpin
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 5UF3|1|A
1116NR_all_79081.1
Exact match
2M12|2|A (2M12)
  • RNA (5'-R(*GP*GP*GP*UP*GP*UP*AP*UP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
23(1) 2M12|2|A
1117NR_all_79227.1
Exact match
1JU1|1|A+1JU1|1|B (1JU1)
  • HIV-1Lai SL1
  • SOLUTION NMR
  • Chain(s): A, B, E, J; model(s): 1
23(1) 1JU1|1|A+1JU1|1|B
1118NR_all_82965.1
Exact match
1BGZ|1|A (1BGZ)
  • RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1BGZ|1|A
1119NR_all_83550.1
Exact match
synthetic construct
2N2P|1|A (2N2P)
  • RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2N2P|1|A
1120NR_all_84600.1
Exact match
1TLR|1|A (1TLR)
  • RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACU[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1TLR|1|A
1121NR_all_87573.1
Exact match
2ESE|1|B (2ESE)
  • 5'-R(*GP*GP*AP*GP*AP*GP*GP*CP*UP*CP*UP*G[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
23(1) 2ESE|1|B
1122NR_all_93599.1
Exact match
Homo sapiens
5UDZ|1|W (5UDZ)
  • let-7f-1 pre-element, RNA (5'-R(*GP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.0 Å23(4) 5UDZ|1|W, 5UDZ|1|V, 3TS0|1|V, 3TS0|1|U
1123NR_all_94843.1
Exact match
synthetic construct
2N82|3|A (2N82)
  • RNA (5'-R(*GP*GP*UP*AP*GP*UP*UP*UP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
23(1) 2N82|3|A
1124NR_all_94871.1
Exact match
unidentified
6MDZ|1|E+6MDZ|1|C (6MDZ)
  • RNA (5'-R(P*AP*AP*AP*CP*AP*CP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, E, J; model(s): 1
3.4 Å23(6) 6MDZ|1|E+6MDZ|1|C, 6MDZ|1|F+6MDZ|1|D, 6MFR|1|F+6MFR|1|D, 6NIT|1|E+6NIT|1|C, 6NIT|1|F+6NIT|1|D, 6MFR|1|E+6MFR|1|C
1125NR_all_96665.1
Exact match
synthetic construct
2N0R|1|A (2N0R)
  • RNA (5'-R(*GP*CP*UP*GP*AP*GP*CP*UP*CP*GP[...]
  • SOLID-STATE NMR
  • Chain(s): A; model(s): 1
23(1) 2N0R|1|A
1126NR_all_98616.1
Exact match
2QH3|1|A (2QH3)
  • Human U64 H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2QH3|1|A
1127NR_all_03015.1
Exact match
2KD8|1|A (2KD8)
  • 5'-R(*GP*GP*AP*UP*GP*GP*UP*UP*GP*GP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2KD8|1|A
1128NR_all_08052.1
Exact match
synthetic construct
5VCI|1|A+5VCI|1|B (5VCI)
  • RNA (5'-R(*CP*UP*GP*CP*UP*GP*GP*CP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.6 Å22(3) 5VCI|1|A+5VCI|1|B, 5VGW|1|A+5VGW|1|B, 5VCF|1|A+5VCF|1|B
1129NR_all_09579.1
Exact match
5C5W|1|A (5C5W)
  • RNA (5'-R(P*CP*CP*UP*GP*AP*GP*UP*UP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å22(1) 5C5W|1|A
1130NR_all_13408.1
Exact match
1K2G|1|A (1K2G)
  • 5'-R(*CP*AP*GP*AP*CP*UP*UP*CP*GP*GP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1K2G|1|A
1131NR_all_14172.1
Exact match
Thermus thermophilus
4A4S|1|A (4A4S)
  • 5'-R(*GP*GP*AP*CP*CP*CP*GP*GP*CP*UP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 4A4S|1|A
1132NR_all_21811.1
Exact match
2HNS|1|A (2HNS)
  • 5'-R(*GP*GP*CP*GP*UP*GP*AP*UP*CP*AP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2HNS|1|A
1133NR_all_24575.1
Exact match
1TJZ|15|A (1TJZ)
  • VS Ribozyme
  • SOLUTION NMR
  • Chain(s): A; model(s): 15
22(1) 1TJZ|15|A
1134NR_all_25049.1
Exact match
1JUR|1|A (1JUR)
  • 5'-R(*GP*GP*CP*CP*UP*GP*AP*GP*GP*AP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1JUR|1|A
1135NR_all_25813.1
Exact match
3FTF|1|C+3FTF|1|D (3FTF)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
2.8 Å22(1) 3FTF|1|C+3FTF|1|D
1136NR_all_25893.1
Exact match
Tetrahymena thermophila
4ERD|1|C+4ERD|1|D (4ERD)
  • 5'-R(P*GP*GP*UP*CP*GP*AP*CP*AP*UP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
2.6 Å22(1) 4ERD|1|C+4ERD|1|D
1137NR_all_30897.1
Exact match
1K6G|2|A (1K6G)
  • RNA (5'-R(P*GP*GP*CP*GP*UP*CP*AP*UP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
22(1) 1K6G|2|A
1138NR_all_31561.1
Exact match
synthetic construct
4P3T|1|A+4P3T|1|B (4P3T)
  • 5'-D(*UP*UP*GP*CP*GP*UP*CP*CP*CP*GP*(5BU[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
1.6 Å22(1) 4P3T|1|A+4P3T|1|B
1139NR_all_32689.1
Exact match
2M5U|1|A (2M5U)
  • RNA_(5'-R(*GP*GP*CP*AP*GP*AP*UP*UP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2M5U|1|A
1140NR_all_34670.1
Exact match
1IE1|4|A (1IE1)
  • 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
22(1) 1IE1|4|A
1141NR_all_35088.1
Exact match
3LOA|1|B+3LOA|1|A (3LOA)
  • 5'-R(*GP*GP*GP*(5BU)P*GP*GP*UP*GP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.3 Å22(1) 3LOA|1|B+3LOA|1|A
1142NR_all_35700.1
Exact match
1OSW|3|A (1OSW)
  • 5'-R(*GP*GP*AP*GP*GP*CP*GP*CP*UP*AP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
22(1) 1OSW|3|A
1143NR_all_35756.1
Exact match
2MFC|1|B (2MFC)
  • SL1(RsmZ) RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
22(2) 2MFC|1|B, 2MFC|1|D
1144NR_all_36771.1
Exact match
2G1W|1|A (2G1W)
  • 5'-R(*GP*GP*GP*GP*UP*GP*GP*CP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2G1W|1|A
1145NR_all_36773.1
Exact match
Saccharomyces cerevisiae
6EZ0|1|A (6EZ0)
  • RNA (27-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 6EZ0|1|A
1146NR_all_38099.1
Exact match
3BNR|1|C+3BNR|1|D (3BNR)
  • A site of human mitochondrial ribosome, [...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
2.1 Å22(6) 3BNR|1|C+3BNR|1|D, 3BNR|1|A+3BNR|1|B, 3BNS|1|C+3BNS|1|D, 3BNS|1|A+3BNS|1|B, 3BNQ|1|C+3BNQ|1|D, 3BNQ|1|A+3BNQ|1|B
1147NR_all_39177.1
Exact match
1N66|1|A (1N66)
  • internal loop in the Y-domain of poliovi[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1N66|1|A
1148NR_all_40327.1
Exact match
2JSE|1|A (2JSE)
  • RNA (5'-R(*GP*GP*AP*GP*UP*GP*GP*CP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2JSE|1|A
1149NR_all_44976.1
Exact match
2MFE|1|D (2MFE)
  • SL2(RsmZ) RNA, SL4(RsmZ) RNA
  • SOLUTION NMR
  • Chain(s): D; model(s): 1
22(4) 2MFE|1|D, 2MFE|1|B, 2MFG|1|B, 2MFG|1|D
1150NR_all_46150.1
Exact match
Haloarcula marismortui
4A4U|1|A (4A4U)
  • 5'-R(*GP*GP*AP*CP*CP*CP*GP*GP*CP*UP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 4A4U|1|A
1151NR_all_47406.1
Exact match
Equine infectious anemia virus
2W2H|1|R (2W2H)
  • 5'-R(*GP*CP*UP*CP*AP*GP*AP*UP*CP*UP *GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å22(2) 2W2H|1|R, 2W2H|1|S
1152NR_all_47541.1
Exact match
3HTX|1|B+3HTX|1|C (3HTX)
  • 5'-R(*GP*AP*UP*UP*UP*CP*UP*CP*UP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, E, J; model(s): 1
3.1 Å22(2) 3HTX|1|B+3HTX|1|C, 3HTX|1|E+3HTX|1|F
1153NR_all_48589.1
Exact match
2O3V|1|A+2O3V|1|B (2O3V)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.8 Å22(1) 2O3V|1|A+2O3V|1|B
1154NR_all_48836.1
Exact match
2GRW|1|A (2GRW)
  • 5'-GGACCUCUCGAAAGAGAUGUCC-3'
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2GRW|1|A
1155NR_all_52030.1
Exact match
6H9H|1|D (6H9H)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å22(3) 6H9H|1|D, 6H9I|1|C, 6H9I|1|E
1156NR_all_52761.1
Exact match
3TD0|1|B+3TD0|1|A (3TD0)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
1.6 Å22(1) 3TD0|1|B+3TD0|1|A
1157NR_all_53856.1
Exact match
synthetic construct
5JBG|1|X (5JBG)
  • RNA (5'-R(*GPPP*GP*AP*GP*CP*GP*UP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.0 Å22(1) 5JBG|1|X
1158NR_all_54657.1
Exact match
2O3Y|1|A+2O3Y|1|B (2O3Y)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.7 Å22(4) 2O3Y|1|A+2O3Y|1|B, 2G5K|1|A+2G5K|1|B, 2FQN|1|A+2FQN|1|B, 2O3W|1|A+2O3W|1|B
1159NR_all_55295.1
Exact match
3FTE|1|C+3FTE|1|D (3FTE)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
3.0 Å22(1) 3FTE|1|C+3FTE|1|D
1160NR_all_56099.1
Exact match
Drosophila melanogaster
6F4H|1|B (6F4H)
  • U1-SL2
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å22(2) 6F4H|1|B, 6F4H|1|F
1161NR_all_56977.1
Exact match
Homo sapiens
1DZ5|1|C+1DZ5|1|D (1DZ5)
  • PIE, RNA (5'-R(*GP*AP*GP*AP*CP*AP*UP*UP*[...]
  • SOLUTION NMR
  • Chain(s): C, D, E, J; model(s): 1
22(1) 1DZ5|1|C+1DZ5|1|D
1162NR_all_57276.1
Exact match
2GV3|6|A (2GV3)
  • 5'-R(*GP*GP*CP*CP*AP*GP*AP*CP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
22(1) 2GV3|6|A
1163NR_all_59799.1
Exact match
2F8S|1|C+2F8S|1|D (2F8S)
  • 5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
3.0 Å22(1) 2F8S|1|C+2F8S|1|D
1164NR_all_60167.4
Exact match
3C3Z|1|A+3C3Z|1|B (3C3Z)
  • HIV-1 subtype F genomic RNA, 5'-R(*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
1.5 Å22(20) 3C3Z|1|A+3C3Z|1|B, 2OIY|1|A+2OIY|1|B, 462D|1|B+462D|1|A, 1NLC|1|B+1NLC|1|A, 3C44|1|A+3C44|1|B, 1O3Z|1|B+1O3Z|1|A, 3C7R|1|A+3C7R|1|B, 3C5D|1|A+3C5D|1|B, 2OJ0|1|A+2OJ0|1|B, 1Y73|1|B+1Y73|1|A, 1Y99|1|A+1Y99|1|B, 3DVV|1|A+3DVV|1|B, 1WVD|1|B+1WVD|1|A, 1Y6T|1|B+1Y6T|1|A, 1Y90|1|B+1Y90|1|A, 2OIJ|1|A+2OIJ|1|B, 1Y95|1|B+1Y95|1|A, 3FAR|1|A+3FAR|1|B, 1Y6S|1|B+1Y6S|1|A, 2QEK|1|A+2QEK|1|B
1165NR_all_64766.1
Exact match
Drosophila melanogaster
6F4H|1|D (6F4H)
  • U1-SL2
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å22(1) 6F4H|1|D
1166NR_all_66855.1
Exact match
2MI0|12|A (2MI0)
  • 5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 12
22(1) 2MI0|12|A
1167NR_all_67461.1
Exact match
2K66|1|A (2K66)
  • 5'-R(*GP*GP*AP*GP*UP*AP*UP*GP*UP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2K66|1|A
1168NR_all_72484.1
Exact match
1IE2|16|A (1IE2)
  • 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 16
22(1) 1IE2|16|A
1169NR_all_73434.1
Exact match
1PJY|1|A (1PJY)
  • HIV-1 frameshift inducing stem-loop
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1PJY|1|A
1170NR_all_74199.1
Exact match
1NTA|1|A+1NTA|1|B (1NTA)
  • 5'-R(*GP*GP*AP*UP*CP*GP*CP*AP*UP*UP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.9 Å22(2) 1NTA|1|A+1NTA|1|B, 1NTB|1|A+1NTB|1|B
1171NR_all_77275.1
Exact match
4K31|1|B+4K31|1|C (4K31)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, E, J; model(s): 1
1.4 Å22(1) 4K31|1|B+4K31|1|C
1172NR_all_78706.1
Exact match
1ZCI|1|A+1ZCI|1|B (1ZCI)
  • 5'-R(*CP*(5BU)P*UP*GP*CP*UP*GP*AP*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
1.7 Å22(17) 1ZCI|1|A+1ZCI|1|B, 1ZCI|1|C+1ZCI|1|D, 2FD0|1|A+2FD0|1|B, 2B8S|1|A+2B8S|1|B, 2FCZ|1|A+2FCZ|1|B, 2FCZ|1|C+2FCZ|1|D, 2FCY|1|A+2FCY|1|B, 2B8R|1|A+2B8R|1|B, 1K9W|1|B, 1Y3S|1|A+1Y3S|1|B, 2FCX|1|A+2FCX|1|B, 1Y3O|1|A+1Y3O|1|B, 1K9W|1|D, 1YXP|1|A+1YXP|1|B, 1XPE|1|A+1XPE|1|B, 1XPF|1|A+1XPF|1|B, 1XP7|1|A+1XP7|1|B
1173NR_all_80055.1
Exact match
1RLG|1|D (1RLG)
  • 25-MER
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.7 Å22(2) 1RLG|1|D, 1RLG|1|C
1174NR_all_81112.1
Exact match
synthetic construct
6E7L|1|A (6E7L)
  • RNA (5'-R(*GP*GP*GP*CP*UP*GP*CP*AP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å22(1) 6E7L|1|A
1175NR_all_82207.1
Exact match
1K6H|1|A (1K6H)
  • RNA (5'-R(P*GP*GP*CP*GP*UP*GP*UP*UP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1K6H|1|A
1176NR_all_82922.1
Exact match
Haloarcula marismortui
4A4T|1|A (4A4T)
  • 5'-R(*GP*GP*AP*CP*CP*CP*GP*GP*CP*UP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 4A4T|1|A
1177NR_all_85144.1
Exact match
1IKD|24|A (1IKD)
  • TRNA ALA ACCEPTOR STEM
  • SOLUTION NMR
  • Chain(s): A; model(s): 24
22(1) 1IKD|24|A
1178NR_all_86272.1
Exact match
3MEI|1|A+3MEI|1|B (3MEI)
  • RNA (5'-R(*CP*CP*GP*CP*CP*GP*CP*GP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.0 Å22(1) 3MEI|1|A+3MEI|1|B
1179NR_all_86801.1
Exact match
synthetic construct
6G3B|1|C (6G3B)
  • RNA (5'-R(P*GP*UP*AP*GP*GP*AP*CP*CP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.8 Å22(1) 6G3B|1|C
1180NR_all_90832.1
Exact match
3BOY|1|D (3BOY)
  • 5'-R(*UP*UP*UP*AP*GP*UP*UP*UP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.7 Å22(2) 3BOY|1|D, 2GZT|1|D
1181NR_all_92714.1
Exact match
Canis lupus
4V5Z|1|BV (4V5Z)
  • RNA Expansion segment ES9 part2, RNA Exp[...]
  • ELECTRON MICROSCOPY
  • Chain(s): BV; model(s): 1
8.7 Å22(2) 4V5Z|1|BV, 4V5Z|1|BO
1182NR_all_93461.1
Exact match
1FJE|1|A (1FJE)
  • SNRE RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1FJE|1|A
1183NR_all_93725.1
Exact match
1F9L|1|A (1F9L)
  • 5'-R(*GP*GP*CP*GP*AP*AP*GP*UP*CP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1F9L|1|A
1184NR_all_93971.1
Exact match
Homo sapiens
6D06|1|B+6D06|1|C (6D06)
  • RNA (5'-R(*GP*CP*UP*CP*GP*CP*GP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, E, J; model(s): 1
2.6 Å22(1) 6D06|1|B+6D06|1|C
1185NR_all_94699.1
Exact match
2JYM|1|A (2JYM)
  • RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2JYM|1|A
1186NR_all_97787.1
Exact match
2GV4|3|A (2GV4)
  • Short RNA strand 5'-GGACCUCUCGAAAGAGUGGU[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
22(1) 2GV4|3|A
1187NR_all_99058.1
Exact match
2JUK|8|A (2JUK)
  • HIV-1 frameshift site RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
22(1) 2JUK|8|A
1188NR_all_04968.1
Exact match
synthetic construct
4B3Q|1|R (4B3Q)
  • TEMPLATE RNA, RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
5.0 Å21(2) 4B3Q|1|R, 4B3P|1|R
1189NR_all_07051.1
Exact match
synthetic construct
2FY1|1|B (2FY1)
  • S1A stem-loop RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
21(1) 2FY1|1|B
1190NR_all_07169.1
Exact match
synthetic construct
4P3U|1|B+4P3U|1|A (4P3U)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*(5BU[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
3.0 Å21(1) 4P3U|1|B+4P3U|1|A
1191NR_all_09192.1
Exact match
synthetic construct
5ID6|1|G (5ID6)
  • RNA (5'-R(P*AP*AP*UP*UP*UP*CP*UP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.4 Å21(1) 5ID6|1|G
1192NR_all_10023.1
Exact match
2M21|7|A (2M21)
  • 5'-R(*GP*GP*CP*GP*AP*UP*AP*CP*AP*CP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
21(1) 2M21|7|A
1193NR_all_15094.1
Exact match
synthetic construct
6IA2|1|A+6IA2|1|B (6IA2)
  • RNA (5'-R(*AP*GP*AP*GP*AP*AP*CP*CP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.3 Å21(1) 6IA2|1|A+6IA2|1|B
1194NR_all_15327.1
Exact match
1JOX|1|A (1JOX)
  • 5'-R(*GP*GP*CP*GP*GP*UP*GP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
21(1) 1JOX|1|A
1195NR_all_17495.1
Exact match
3SSF|1|A (3SSF)
  • 5'-R(*UP*AP*AP*AP*AP*GP*AP*AP*AP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å21(1) 3SSF|1|A
1196NR_all_20576.1
Exact match
Oryctolagus cuniculus
3J0O|1|f (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): f; model(s): 1
9.0 Å21(4) 3J0O|1|f, 3J0L|1|f, 3J0P|1|f, 3J0Q|1|f
1197NR_all_21191.1
Exact match
3BNT|1|A (3BNT)
  • A site of human mitochondrial ribosome
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å21(1) 3BNT|1|A
1198NR_all_22775.2
Exact match
1URN|1|Q (1URN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
1.9 Å21(2) 1URN|1|Q, 1URN|1|R
1199NR_all_25711.1
Exact match
synthetic construct
5N8L|1|B+5N8L|1|C (5N8L)
  • RNA (5'-R(*UP*UP*AP*AP*UP*UP*AP*UP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): B, C, E, J; model(s): 1
21(2) 5N8L|1|B+5N8L|1|C, 5N8M|1|B+5N8M|1|C
1200NR_all_26059.1
Exact match
synthetic construct
4P3U|1|C+4P3U|1|D (4P3U)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*(5BU[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
3.0 Å21(1) 4P3U|1|C+4P3U|1|D
1201NR_all_27625.1
Exact match
synthetic construct
4ZC7|1|A+4ZC7|1|B (4ZC7)
  • RNA duplex
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
3.0 Å21(2) 4ZC7|1|A+4ZC7|1|B, 4ZC7|1|C+4ZC7|1|D
1202NR_all_28891.1
Exact match
1SZY|1|A (1SZY)
  • 5'-R(P*GP*GP*CP*AP*GP*GP*GP*CP*UP*CP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
21(1) 1SZY|1|A
1203NR_all_30433.1
Exact match
Homo sapiens
5EW4|1|B+5EW4|1|A (5EW4)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*CP*CP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
1.5 Å21(2) 5EW4|1|B+5EW4|1|A, 5EW7|1|B+5EW7|1|A
1204NR_all_33176.1
Exact match
1RKJ|1|B (1RKJ)
  • 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
21(1) 1RKJ|1|B
1205NR_all_33353.1
Exact match
1D0U|14|A (1D0U)
  • PHAGE MS2 RNA BINDING SITE
  • SOLUTION NMR
  • Chain(s): A; model(s): 14
21(1) 1D0U|14|A
1206NR_all_36159.1
Exact match
Haloarcula marismortui
4A4R|1|A (4A4R)
  • 5'-R(*GMP*GP*AP*CP*CP*CP*GP*GP*CP*UP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
21(1) 4A4R|1|A
1207NR_all_36712.2
Exact match
1ZL3|1|B (1ZL3)
  • 5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*UP*(FLO) U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å21(5) 1ZL3|1|B, 2AB4|1|B, 1ZE2|1|C, 1ZE2|1|D, 1K8W|1|B
1208NR_all_40658.1
Exact match
2MFF|5|B (2MFF)
  • SL3(RsmZ) RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 5
21(2) 2MFF|5|B, 2MFF|5|D
1209NR_all_41922.1
Exact match
4KTG|1|B (4KTG)
  • 5'-R(P*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å21(2) 4KTG|1|B, 4KTG|1|E
1210NR_all_46403.1
Exact match
3BNN|1|C+3BNN|1|D (3BNN)
  • A site of human ribosome, A site of huma[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
2.0 Å21(5) 3BNN|1|C+3BNN|1|D, 3BNN|1|A+3BNN|1|B, 3BNO|1|A+3BNO|1|B, 3BNO|1|C+3BNO|1|D, 3BNP|1|A+3BNP|1|B
1211NR_all_51689.1
Exact match
2RRC|4|A (2RRC)
  • 5'-R(P*GP*GP*AP*CP*CP*CP*(AP7)P*CP*CP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
21(1) 2RRC|4|A
1212NR_all_52004.1
Exact match
1QWA|1|A (1QWA)
  • 18S ribosomal RNA, 5'ETS
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
21(1) 1QWA|1|A
1213NR_all_52295.1
Exact match
2ET8|1|A+2ET8|1|B (2ET8)
  • 5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.5 Å21(3) 2ET8|1|A+2ET8|1|B, 1O9M|1|A+1O9M|1|B, 2F4U|1|A+2F4U|1|B
1214NR_all_54284.1
Exact match
2H2X|12|A (2H2X)
  • 5'-R(*GP*GP*CP*GP*AP*UP*AP*CP*AP*CP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 12
21(1) 2H2X|12|A
1215NR_all_56182.1
Exact match
synthetic construct
6FLQ|1|R (6FLQ)
  • RNA (5'-R(*CP*CP*UP*GP*AP*UP*CP*AP*GP*GP[...]
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.6 Å21(1) 6FLQ|1|R
1216NR_all_58991.1
Exact match
Mus musculus
5F5H|1|D (5F5H)
  • RNA (5'-R(P*CP*CP*AP*CP*AP*CP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å21(1) 5F5H|1|D
1217NR_all_62398.1
Exact match
1BJ2|1|A+1BJ2|1|B (1BJ2)
  • RNA (5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*AP*UP[...]
  • SOLUTION NMR
  • Chain(s): A, B, E, J; model(s): 1
21(2) 1BJ2|1|A+1BJ2|1|B, 2BJ2|1|A+2BJ2|1|B
1218NR_all_66286.1
Exact match
Escherichia coli
1A4D|1|A+1A4D|1|B (1A4D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*UP*GP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A, B, E, J; model(s): 1
21(1) 1A4D|1|A+1A4D|1|B
1219NR_all_67308.1
Exact match
1JP0|1|A (1JP0)
  • 5'-R(*GP*GP*CP*GP*GP*UP*GP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
21(1) 1JP0|1|A
1220NR_all_67439.2
Exact match
4PQU|1|T (4PQU)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.5 Å21(4) 4PQU|1|T, 4PQU|1|E, 4PUO|1|T, 4PUO|1|E
1221NR_all_71199.1
Exact match
synthetic construct
5Z1I|1|A (5Z1I)
  • RNA (5'-R(P*GP*CP*GP*UP*CP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å21(44) 5Z1I|1|A, 2PWT|1|A+2PWT|1|B, 5ZEG|1|A+5ZEG|1|B+5ZEG|1|C, 5BWS|1|A+5BWS|1|B, 3TD1|1|B+3TD1|1|A, 4K32|1|A+4K32|1|B, 5BWS|1|C+5BWS|1|D, 5ZEI|1|A+5ZEI|1|B, 3BNL|1|A+3BNL|1|B, 5XZ1|1|C+5XZ1|1|D, 4P3S|1|B+4P3S|1|A, 5XZ1|1|A+5XZ1|1|B, 2ET5|1|A+2ET5|1|B, 4PDQ|1|A+4PDQ|1|B, 4GPY|1|A+4GPY|1|B, 4WCP|1|A+4WCP|1|B+4WCP|1|C, 5BXK|1|C+5BXK|1|D, 4GPW|1|A+4GPW|1|B, 1MWL|1|A+1MWL|1|B, 2ET4|1|A+2ET4|1|B, 4GPX|1|A+4GPX|1|B, 5BXK|1|A+5BXK|1|B, 2ESJ|1|A+2ESJ|1|B, 5Z1H|1|B+5Z1H|1|A, 2ESI|1|A+2ESI|1|B, 4WCQ|1|A+4WCQ|1|B, 4F8V|1|A+4F8V|1|B, 3WRU|1|A+3WRU|1|B, 4F8U|1|A+4F8U|1|B, 3S4P|1|A+3S4P|1|B, 4P20|1|A+4P20|1|B, 1LC4|1|A+1LC4|1|B, 2ET3|1|A+2ET3|1|B, 5ZEJ|1|A+5ZEJ|1|B, 5ZEM|1|A+5ZEM|1|B, 5Z71|1|B+5Z71|1|A, 4WCR|1|A+4WCR|1|B, 4WCS|1|A+4WCS|1|B, 2BE0|1|A+2BE0|1|B, 2BEE|1|A+2BEE|1|B, 1J7T|1|A+1J7T|1|B, 2G5Q|1|A+2G5Q|1|B, 1YRJ|1|A+1YRJ|1|B, 2F4T|1|B+2F4T|1|A
1222NR_all_72697.1
Exact match
1T0E|1|A+1T0E|1|C (1T0E)
  • 5'-R(*GP*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, E, J; model(s): 1
1.7 Å21(1) 1T0E|1|A+1T0E|1|C
1223NR_all_73328.1
Exact match
4PWD|1|T (4PWD)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.0 Å21(2) 4PWD|1|T, 4PWD|1|E
1224NR_all_77014.1
Exact match
Canis lupus
4V5Z|1|BA (4V5Z)
  • RNA Expansion segment ES3
  • ELECTRON MICROSCOPY
  • Chain(s): BA; model(s): 1
8.7 Å21(1) 4V5Z|1|BA
1225NR_all_82060.1
Exact match
17RA|7|A (17RA)
  • RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
21(1) 17RA|7|A
1226NR_all_82951.1
Exact match
2O3X|1|A+2O3X|1|B (2O3X)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*AP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.9 Å21(2) 2O3X|1|A+2O3X|1|B, 2F4S|1|A+2F4S|1|B
1227NR_all_84709.1
Exact match
synthetic construct
6GMH|1|P (6GMH)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
3.1 Å21(1) 6GMH|1|P
1228NR_all_89230.1
Exact match
Mus musculus
5F5H|1|C (5F5H)
  • RNA (5'-R(P*CP*CP*AP*CP*AP*CP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å21(1) 5F5H|1|C
1229NR_all_90658.1
Exact match
2MI0|12|B (2MI0)
  • 5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 12
21(1) 2MI0|12|B
1230NR_all_93859.1
Exact match
4J39|1|B (4J39)
  • 5'-R(P*CP*AP*GP*CP*AP*GP*CP*AP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å21(2) 4J39|1|B, 4J5V|1|B
1231NR_all_94226.1
Exact match
2ZKO|1|C+2ZKO|1|D (2ZKO)
  • RNA (5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
1.7 Å21(1) 2ZKO|1|C+2ZKO|1|D
1232NR_all_99953.1
Exact match
1FEU|1|C+1FEU|1|B (1FEU)
  • 21 NT FRAGMENT OF 5S RRNA, 19 NT FRAGMEN[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, E, J; model(s): 1
2.3 Å21(2) 1FEU|1|C+1FEU|1|B, 1FEU|1|F+1FEU|1|E
1233NR_all_04048.1
Exact match
2RPT|2|A (2RPT)
  • RNA (5'-R(*GP*GP*CP*CP*CP*GP*CP*CP*GP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
20(1) 2RPT|2|A
1234NR_all_14902.1
Exact match
synthetic construct
5UX0|1|B (5UX0)
  • RNA (5'-R(*G*GP*UP*AP*CP*AP*AP*CP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å20(2) 5UX0|1|B, 5UX0|1|E
1235NR_all_15508.1
Exact match
3TRZ|1|U (3TRZ)
  • RNA (5'-R(*GP*GP*GP*CP*AP*GP*GP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.9 Å20(6) 3TRZ|1|U, 3TRZ|1|X, 3TRZ|1|W, 3TRZ|1|V, 3TRZ|1|Y, 3TRZ|1|Z
1236NR_all_16758.1
Exact match
Mus musculus
5F5F|1|B (5F5F)
  • RNA (5'-R(P*UP*GP*AP*CP*UP*GP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å20(3) 5F5F|1|B, 5F5F|1|D, 5F5F|1|H
1237NR_all_16888.1
Exact match
Saccharomyces cerevisiae
3J6B|1|e (3J6B)
  • E-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): e; model(s): 1
3.2 Å20(1) 3J6B|1|e
1238NR_all_18337.2
Exact match
Escherichia coli
1QZC|1|B (1QZC)
  • 23S rRNA, ribosomal 23S RNA, Helix 69 of[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
9.0 Å20(6) 1QZC|1|B, 3J0E|1|A, 3J0D|1|B, 1MVR|1|C, 2MER|1|A, 2MEQ|1|A
1239NR_all_20137.1
Exact match
2RPK|1|A (2RPK)
  • RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
20(1) 2RPK|1|A
1240NR_all_20405.1
Exact match
Saccharomyces cerevisiae
2U2A|1|A (2U2A)
  • RNA (5'-R(P*GP*GP*UP*CP*AP*GP*UP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
20(2) 2U2A|1|A, 1U2A|1|A
1241NR_all_24235.1
Exact match
4LGT|1|E (4LGT)
  • stem-loop of 23S rRNA, stem loop fragmen[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.3 Å20(6) 4LGT|1|E, 4LGT|1|F, 3DH3|1|F+3DH3|1|E, 3DH3|1|G+3DH3|1|H, 3J0E|1|D, 3J0D|1|E
1242NR_all_25361.2
Exact match
4E48|1|A+4E48|1|B (4E48)
  • 5'-R(P*GP*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, E, J; model(s): 1
2.5 Å20(3) 4E48|1|A+4E48|1|B, 4JNX|1|B+4JNX|1|G, 4E48|1|D
1243NR_all_25585.3
Exact match
synthetic construct
4Z4D|1|B+4Z4D|1|D (4Z4D)
  • RNA (5'-R(P*UP*UP*CP*AP*CP*AP*UP*UP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, J; model(s): 1
1.6 Å20(12) 4Z4D|1|B+4Z4D|1|D, 4Z4E|1|B+4Z4E|1|D, 4W5O|1|B+4W5O|1|D, 4Z4C|1|B+4Z4C|1|D, 4Z4H|1|B+4Z4H|1|D, 6CBD|1|B+6CBD|1|C, 4Z4I|1|B+4Z4I|1|D, 4Z4G|1|B+4Z4G|1|D, 4W5T|1|B+4W5T|1|D, 4Z4F|1|B+4Z4F|1|D, 4W5R|1|B+4W5R|1|D, 4W5Q|1|B+4W5Q|1|D
1244NR_all_39223.1
Exact match
1MFJ|1|A (1MFJ)
  • 5'-R(*GP*AP*CP*AP*GP*UP*CP*UP*CP*UP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
20(1) 1MFJ|1|A
1245NR_all_39506.1
Exact match
Mus musculus
5F5F|1|F (5F5F)
  • RNA (5'-R(P*UP*GP*AP*CP*UP*GP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å20(1) 5F5F|1|F
1246NR_all_40086.1
Exact match
4JGN|1|E (4JGN)
  • 5'-R(P*UP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å20(2) 4JGN|1|E, 4JK0|1|B
1247NR_all_42560.1
Exact match
2ZI0|1|C+2ZI0|1|D (2ZI0)
  • RNA (5'-D(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, J; model(s): 1
2.8 Å20(1) 2ZI0|1|C+2ZI0|1|D
1248NR_all_45626.1
Exact match
4KZ2|1|B+4KZ2|1|A+4KZ2|1|C (4KZ2)
  • phi29 pRNA 3WJ core RNA 20 mer, phi29 pR[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, J; model(s): 1
3.1 Å20(1) 4KZ2|1|B+4KZ2|1|A+4KZ2|1|C
1249NR_all_51487.1
Exact match
4L8H|1|R (4L8H)
  • RNA operator hairpin, 5'-R(*AP*CP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å20(8) 4L8H|1|R, 2BS1|1|R, 2BS1|1|S, 2BS0|1|R, 1ZSE|1|R, 2BS0|1|S, 2B2D|1|R, 2B2D|1|S
1250NR_all_52383.1
Exact match
Thermus thermophilus
1X18|1|C (1X18)
  • 5'-R(P*UP*UP*CP*CP*CP*GP*GP*GP*CP*CP*UP*[...]
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
13.5 Å20(1) 1X18|1|C
1251NR_all_53294.1
Exact match
1EC6|1|D (1EC6)
  • 20-MER RNA HAIRPIN
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å20(1) 1EC6|1|D
1252NR_all_53912.1
Exact match
synthetic construct
5OIK|1|P (5OIK)
  • RNA (5'-R(P*UP*AP*UP*AP*UP*AP*CP*AP*UP*A[...]
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
3.7 Å20(1) 5OIK|1|P
1253NR_all_57105.1
Exact match
Oryctolagus cuniculus
3J0O|1|8 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 8; model(s): 1
9.0 Å20(2) 3J0O|1|8, 3J0L|1|8
1254NR_all_61682.1
Exact match
2JPP|1|C (2JPP)
  • RNA (5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): C; model(s): 1
20(2) 2JPP|1|C, 2JPP|1|D
1255NR_all_62068.1
Exact match
1EGK|1|A (1EGK)
  • RNA (5'-R(*AP*GP*GP*AP*GP*AP*GP*AP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å20(2) 1EGK|1|A, 1EGK|1|C
1256NR_all_63081.1
Exact match
2O33|20|A (2O33)
  • U2 snRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 20
20(1) 2O33|20|A
1257NR_all_63549.1
Exact match
Human immunodeficiency virus 1
6HAK|1|T+6HAK|1|P (6HAK)
  • RNA (5'-R(P*AP*GP*UP*GP*GP*CP*GP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, J, P, T; model(s): 1
4.0 Å20(2) 6HAK|1|T+6HAK|1|P, 6HAK|1|E+6HAK|1|F
1258NR_all_64055.1
Exact match
1BN0|2|A (1BN0)
  • SL3 RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
20(1) 1BN0|2|A
1259NR_all_65529.1
Exact match
1A1T|1|B (1A1T)
  • SL3 STEM-LOOP RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
20(1) 1A1T|1|B
1260NR_all_67852.1
Exact match
1URN|1|P (1URN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
1.9 Å20(1) 1URN|1|P
1261NR_all_70550.1
Exact match
361D|1|B (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å20(1) 361D|1|B
1262NR_all_73526.1
Exact match
361D|1|A (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å20(1) 361D|1|A
1263NR_all_78731.1
Exact match
3UZS|1|C (3UZS)
  • C13.28 RNA Aptamer
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
4.5 Å20(1) 3UZS|1|C
1264NR_all_78931.1
Exact match
4KNQ|1|B (4KNQ)
  • 5'-R(P*CP*CP*GP*CP*CP*GP*CP*CP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å20(1) 4KNQ|1|B
1265NR_all_81539.1
Exact match
1HLX|1|A (1HLX)
  • RNA (5'-R(*GP*GP*GP*AP*UP*AP*AP*CP*UP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
20(1) 1HLX|1|A
1266NR_all_83775.1
Exact match
Hepatitis C virus
3TZR|1|A+3TZR|1|B (3TZR)
  • 5'-R(*CP*GP*AP*GP*GP*AP*AP*CP*UP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, J; model(s): 1
2.2 Å20(1) 3TZR|1|A+3TZR|1|B
1267NR_all_91663.1
Exact match
Canis lupus
3DKN|1|D+3DKN|1|E (3DKN)
  • RNA (5'-R(P*CP*GP*UP*GP*CP*CP*AP*AP*GP*C[...]
  • ELECTRON MICROSCOPY
  • Chain(s): C, D, E, J; model(s): 1
8.7 Å20(1) 3DKN|1|D+3DKN|1|E
1268NR_all_94113.1
Exact match
1EC6|1|C (1EC6)
  • 20-MER RNA HAIRPIN
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å20(1) 1EC6|1|C
1269NR_all_95559.1
Exact match
1R9F|1|C (1R9F)
  • 5'-R(*UP*CP*GP*AP*AP*GP*UP*AP*UP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å20(4) 1R9F|1|C, 6BJG|1|C, 6BJH|1|C, 6BJV|1|C
1270NR_all_97298.1
Exact match
Canis lupus
4V5Z|1|BL (4V5Z)
  • RNA Expansion segment ES20
  • ELECTRON MICROSCOPY
  • Chain(s): BL; model(s): 1
8.7 Å20(1) 4V5Z|1|BL
1271NR_all_97434.1
Exact match
2TOB|1|A (2TOB)
  • RNA (5'-R(*AP*CP*UP*UP*GP*GP*UP*UP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
20(1) 2TOB|1|A
1272NR_all_98374.1
Exact match
2I82|1|F (2I82)
  • 5'-R(*GP*AP*GP*GP*GP*GP*AP*UP*UP*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å20(4) 2I82|1|F, 2I82|1|E, 2I82|1|G, 2I82|1|H
1273NR_all_99773.1
Exact match
1R9F|1|B (1R9F)
  • 5'-R(*CP*GP*UP*AP*CP*GP*CP*GP*GP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å20(4) 1R9F|1|B, 6BJG|1|D, 6BJH|1|D, 6BJV|1|D
1274NR_all_01016.1
Exact match
Escherichia coli
3BO1|1|F (3BO1)
  • 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
9.6 Å19(2) 3BO1|1|F, 3BO0|1|F
1275NR_all_01159.1
Exact match
Escherichia coli
3J0D|1|F (3J0D)
  • ribosomal 23S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
11.1 Å19(1) 3J0D|1|F
1276NR_all_01597.1
Exact match
synthetic construct
1Q2R|1|E (1Q2R)
  • RNA (5'-R(*AP*GP*CP*AP*CP*GP*GP*CP*UP*(N[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å19(4) 1Q2R|1|E, 1Q2R|1|F, 1Q2S|1|F, 1Q2S|1|E
1277NR_all_07301.1
Exact match
Archaeoglobus fulgidus
6HCT|1|A+6HCT|1|B (6HCT)
  • RNA (5'-R(*GP*CP*CP*GP*AP*UP*GP*AP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, J; model(s): 1
3.1 Å19(1) 6HCT|1|A+6HCT|1|B
1278NR_all_07345.1
Exact match
Escherichia coli
3J0E|1|e+3J0E|1|E (3J0E)
  • ribosomal 16S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): C, E, J, e; model(s): 1
9.9 Å19(2) 3J0E|1|e+3J0E|1|E, 3J0D|1|h+3J0D|1|H
1279NR_all_11234.1
Exact match
Oryctolagus cuniculus
4CXG|1|c (4CXG)
  • 28S RRNA - H95
  • ELECTRON MICROSCOPY
  • Chain(s): c; model(s): 1
8.7 Å19(2) 4CXG|1|c, 4CXH|1|c
1280NR_all_14136.1
Exact match
1DFU|1|M+1DFU|1|N (1DFU)
  • 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): C, J, M, N; model(s): 1
1.8 Å19(1) 1DFU|1|M+1DFU|1|N
1281NR_all_14992.1
Exact match
Thermus thermophilus
5XPA|1|D (5XPA)
  • RNA (5'-R(P*AP*UP*AP*CP*AP*AP*CP*CP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å19(1) 5XPA|1|D
1282NR_all_16825.1
Exact match
1F27|1|A (1F27)
  • RNA (5'-R(*AP*CP*CP*GP*UP*CP*AP*GP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å19(1) 1F27|1|A
1283NR_all_19645.1
Exact match
4QI2|1|G (4QI2)
  • RNA (5'-R(*AP*CP*AP*UP*GP*UP*UP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.0 Å19(4) 4QI2|1|G, 4QI2|1|F, 4QI2|1|E, 4QI2|1|H
1284NR_all_20602.1
Exact match
synthetic construct
2MKN|1|B+2MKN|1|C (2MKN)
  • RNA (5'-R(*GP*CP*CP*GP*UP*GP*GP*UP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): B, C, J; model(s): 1
19(1) 2MKN|1|B+2MKN|1|C
1285NR_all_25280.1
Exact match
Oryctolagus cuniculus
3J0Q|1|9 (3J0Q)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 9; model(s): 1
10.6 Å19(1) 3J0Q|1|9
1286NR_all_25678.1
Exact match
3J2K|1|0 (3J2K)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 0; model(s): 1
19(1) 3J2K|1|0
1287NR_all_28969.1
Exact match
synthetic construct
4A36|1|R+4A36|1|S (4A36)
  • 5'-R(*GP*CP*AP*UP*GP*CP*GP*AP*CP*CP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, J, R, S; model(s): 1
3.7 Å19(2) 4A36|1|R+4A36|1|S, 4A36|1|T+4A36|1|U
1288NR_all_30317.1
Exact match
synthetic construct
4RWN|1|B+4RWN|1|C (4RWN)
  • RNA (5'-R(*GP*GP*CP*UP*UP*UP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, J; model(s): 1
2.0 Å19(4) 4RWN|1|B+4RWN|1|C, 4S3N|1|B+4S3N|1|C, 4RWP|1|B+4RWP|1|C, 4RWO|1|B+4RWO|1|C
1289NR_all_31263.1
Exact match
4ILL|1|R (4ILL)
  • RNA (5'-R(*GP*CP*UP*AP*AP*UP*CP*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.5 Å19(2) 4ILL|1|R, 4ILL|1|C
1290NR_all_33669.1
Exact match
4PY5|1|B (4PY5)
  • 5'-R(*GP*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å19(1) 4PY5|1|B
1291NR_all_33790.1
Exact match
4K4U|1|B+4K4U|1|C+4K4U|1|D (4K4U)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, J; model(s): 1
2.9 Å19(2) 4K4U|1|B+4K4U|1|C+4K4U|1|D, 4K4U|1|F+4K4U|1|G+4K4U|1|H
1292NR_all_37848.1
Exact match
Homo sapiens
6HTU|1|D+6HTU|1|F (6HTU)
  • RNA (19-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D, F, J; model(s): 1
2.9 Å19(2) 6HTU|1|D+6HTU|1|F, 6HU6|1|A+6HU6|1|E
1293NR_all_39433.1
Exact match
Enterovirus E
2MFD|1|A (2MFD)
  • 5'-R(P*GP*GP*CP*GP*UP*UP*CP*GP*CP*UP*UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(1) 2MFD|1|A
1294NR_all_41120.1
Exact match
1ESY|2|A (1ESY)
  • RNA (5'-R(P*GP*GP*CP*GP*AP*CP*UP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
19(1) 1ESY|2|A
1295NR_all_43251.1
Exact match
4AY2|1|C (4AY2)
  • 5'-R-PPP(GP*GP*CP*GP*CP*GP*GP*CP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å19(1) 4AY2|1|C
1296NR_all_45159.1
Exact match
synthetic construct
4J50|1|A+4J50|1|B (4J50)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*AP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, J; model(s): 1
1.7 Å19(3) 4J50|1|A+4J50|1|B, 3SYW|1|A+3SYW|1|B, 4YN6|1|A+4YN6|1|B
1297NR_all_47387.1
Exact match
Hepatitis delta virus
1ATO|1|A (1ATO)
  • RNA (5'-R(*GP*GP*CP*AP*CP*CP*UP*CP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(1) 1ATO|1|A
1298NR_all_47604.1
Exact match
Human immunodeficiency virus 1
6B19|1|C+6B19|1|D (6B19)
  • RNA genome fragment, tRNA lysine3
  • ELECTRON MICROSCOPY
  • Chain(s): C, D, J; model(s): 1
4.5 Å19(1) 6B19|1|C+6B19|1|D
1299NR_all_51076.1
Exact match
1QC0|1|C+1QC0|1|D (1QC0)
  • 5'-R(*GP*CP*AP*CP*CP*GP*UP*UP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, J; model(s): 1
1.6 Å19(1) 1QC0|1|C+1QC0|1|D
1300NR_all_55642.1
Exact match
4KQ0|1|B+4KQ0|1|E (4KQ0)
  • 5'-R(P*GP*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, J; model(s): 1
2.1 Å19(1) 4KQ0|1|B+4KQ0|1|E
1301NR_all_59396.1
Exact match
Homo sapiens
5N5C|4|A (5N5C)
  • RNA (19-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
19(1) 5N5C|4|A
1302NR_all_59744.1
Exact match
Canis lupus
4V5Z|1|BM (4V5Z)
  • RNA Expansion segment ES24
  • ELECTRON MICROSCOPY
  • Chain(s): BM; model(s): 1
8.7 Å19(1) 4V5Z|1|BM
1303NR_all_62516.1
Exact match
3SJ2|1|A+3SJ2|1|B (3SJ2)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, J; model(s): 1
1.4 Å19(1) 3SJ2|1|A+3SJ2|1|B
1304NR_all_63046.1
Exact match
Oryctolagus cuniculus
3J0O|1|6 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
9.0 Å19(2) 3J0O|1|6, 3J0L|1|6
1305NR_all_64208.1
Exact match
Haloarcula marismortui
5G4U|1|I+5G4U|1|J (5G4U)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): D, I, J; model(s): 1
2.7 Å19(5) 5G4U|1|I+5G4U|1|J, 5G4U|1|A+5G4U|1|B, 5G4V|1|A+5G4V|1|B, 5G4V|1|E+5G4V|1|F, 5G4U|1|E+5G4U|1|F
1306NR_all_66896.1
Exact match
Escherichia coli
5NDI|1|B (5NDI)
  • RNA (5'-R(*UP*UP*UP*GP*CP*AP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å19(4) 5NDI|1|B, 5NDI|1|A, 5NDI|1|C, 5NDI|1|D
1307NR_all_67355.2
Exact match
Haloarcula marismortui
4CS1|1|A (4CS1)
  • 5'-(*GP*GP*CP*GP*AP*AP*GP*AP*AP*CP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å19(3) 4CS1|1|A, 6Q8U|1|A+6Q8U|1|B, 4C40|1|A
1308NR_all_67819.1
Exact match
Caenorhabditis elegans
1SLO|1|A (1SLO)
  • RNA (5'-R(*UP*UP*AP*CP*CP*CP*AP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(2) 1SLO|1|A, 1SLP|1|A
1309NR_all_70457.1
Exact match
2B6G|1|B (2B6G)
  • 5'-R(*GP*GP*AP*GP*GP*CP*UP*CP*UP*GP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
19(1) 2B6G|1|B
1310NR_all_70790.1
Exact match
4E5C|1|A+4E5C|1|B (4E5C)
  • 5'-R(P*GP*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, J; model(s): 1
1.7 Å19(1) 4E5C|1|A+4E5C|1|B
1311NR_all_75614.1
Exact match
Homo sapiens
2XEB|1|A+2XEB|1|B (2XEB)
  • 5'-R(P*GP*AP*UP*CP*GP*UP*AP*GP*CP*CP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, J; model(s): 1
19(1) 2XEB|1|A+2XEB|1|B
1312NR_all_75716.1
Exact match
2RLU|1|A (2RLU)
  • RNA (5'-R(*GP*GP*UP*UP*GP*CP*GP*GP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(1) 2RLU|1|A
1313NR_all_80676.1
Exact match
2KR8|1|A+2KR8|1|B (2KR8)
  • 5'-R(P*GP*AP*UP*CP*GP*UP*AP*GP*CP*CP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, J; model(s): 1
19(1) 2KR8|1|A+2KR8|1|B
1314NR_all_83196.1
Exact match
Mycobacterium smegmatis
5O5J|1|W (5O5J)
  • tRNA-Phe anticodon stem, mRNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): W; model(s): 1
3.5 Å19(1) 5O5J|1|W
1315NR_all_86744.1
Exact match
3SZX|1|A+3SZX|1|B (3SZX)
  • RNA (5'-R(P*UP*UP*GP*GP*GP*CP*CP*UP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, J; model(s): 1
2.2 Å19(1) 3SZX|1|A+3SZX|1|B
1316NR_all_86832.1
Exact match
Haloarcula marismortui
5FJ0|1|C (5FJ0)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å19(2) 5FJ0|1|C, 5FJ0|1|A+5FJ0|1|B
1317NR_all_87252.1
Exact match
2Y8W|1|B (2Y8W)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å19(1) 2Y8W|1|B
1318NR_all_92805.1
Exact match
1I3X|1|A (1I3X)
  • 5'-R(*GP*GP*CP*UP*GP*GP*CP*UP*GP*UP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(1) 1I3X|1|A
1319NR_all_97675.1
Exact match
Homo sapiens
6N4O|1|C+6N4O|1|D (6N4O)
  • RNA (5'-R(P*UP*GP*GP*AP*GP*UP*GP*UP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, J; model(s): 1
2.9 Å19(1) 6N4O|1|C+6N4O|1|D
1320NR_all_98705.4
Exact match
2P7E|1|D+2P7E|1|C+2P7E|1|P (2P7E)
  • Ribozyme strand III, Ribozyme strand II,[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, J, P; model(s): 1
2.1 Å19(19) 2P7E|1|D+2P7E|1|C+2P7E|1|P, 2NPY|1|D+2NPY|1|C+2NPY|1|A+2NPY|1|B, 1ZFT|1|D+1ZFT|1|C+1ZFT|1|A+1ZFT|1|B, 2P7F|1|D+2P7F|1|C+2P7F|1|A+2P7F|1|B, 1ZFV|1|D+1ZFV|1|C+1ZFV|1|A+1ZFV|1|B, 2OUE|1|D+2OUE|1|C+2OUE|1|A+2OUE|1|B, 2P7D|1|D+2P7D|1|C+2P7D|1|P, 2D2L|1|D+2D2L|1|C+2D2L|1|A+2D2L|1|B, 2FGP|1|D+2FGP|1|C+2FGP|1|A+2FGP|1|B, 1X9C|1|D+1X9C|1|C+1X9C|1|A+1X9C|1|B, 1ZFX|1|D+1ZFX|1|C+1ZFX|1|A+1ZFX|1|B, 2BCZ|1|D+2BCZ|1|C+2BCZ|1|A+2BCZ|1|B, 2D2K|1|D+2D2K|1|C+2D2K|1|A+2D2K|1|B, 2BCY|1|D+2BCY|1|C+2BCY|1|A+2BCY|1|B, 2NPZ|1|D+2NPZ|1|C+2NPZ|1|A+2NPZ|1|B, 1X9K|1|D+1X9K|1|C+1X9K|1|A+1X9K|1|B, 4G6R|1|D+4G6R|1|C+4G6R|1|A+4G6R|1|B, 3GS8|1|D+3GS8|1|C+3GS8|1|A+3GS8|1|B, 3GS1|1|D+3GS1|1|C+3GS1|1|A+3GS1|1|B
1321NR_all_99225.1
Exact match
1UUU|7|A (1UUU)
  • RNA (5'-R(*GP*GP*CP*GP*UP*AP*CP*GP*UP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
19(1) 1UUU|7|A
1322NR_all_99291.1
Exact match
2QKB|1|C (2QKB)
  • 5'-R(*GP*GP*AP*GP*UP*GP*CP*GP*AP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å19(1) 2QKB|1|C
1323NR_all_99512.1
Exact match
2B7G|1|A (2B7G)
  • 5'-R(*GP*GP*AP*GP*GP*CP*UP*CP*UP*GP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(1) 2B7G|1|A
1324NR_all_00536.1
Exact match
4GHL|1|E (4GHL)
  • short palindromic RNA AGACAGCAUAUGCUGUCU
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å18(2) 4GHL|1|E, 4GHL|1|F
1325NR_all_01810.1
Exact match
3KS8|1|E+3KS8|1|F (3KS8)
  • 5'-R(*AP*GP*AP*AP*GP*GP*AP*GP*GP*GP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, J, P; model(s): 1
2.4 Å18(1) 3KS8|1|E+3KS8|1|F
1326NR_all_05919.1
Exact match
Rhodobacter sphaeroides
6D9L|1|C (6D9L)
  • RNA (5'-R(P*UP*UP*AP*CP*UP*GP*CP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å18(2) 6D9L|1|C, 6D9L|1|H
1327NR_all_06402.1
Exact match
Pseudomonas aeruginosa
4AL5|1|B (4AL5)
  • 5'-R(*UP*UP*CP*AP*CP*UP*GP*CP*CP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å18(2) 4AL5|1|B, 4AL7|1|B
1328NR_all_11169.1
Exact match
2GVO|3|A (2GVO)
  • GUANOSINE-5'-MONOPHOSPHATE
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
18(1) 2GVO|3|A
1329NR_all_11512.1
Exact match
1I3Y|8|A (1I3Y)
  • 5'-R(*GP*GP*CP*UP*GP*GP*CP*(OMU)P*GP*UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
18(1) 1I3Y|8|A
1330NR_all_12111.2
Exact match
Rhodobacter sphaeroides
6D8A|1|C (6D8A)
  • RNA (5'-R(P*UP*UP*AP*CP*UP*GP*CP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å18(12) 6D8A|1|C, 6D92|1|C, 6D92|1|H, 6D8P|1|E, 6D8P|1|C, 6D8A|1|H, 6D9K|1|H, 6D9K|1|C, 6D95|1|B, 6D95|1|H, 6D8F|1|C, 6D8F|1|H
1331NR_all_13250.1
Exact match
4QIK|1|C+4QIK|1|D (4QIK)
  • 5'-R(*AP*C*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, J, P; model(s): 1
1.9 Å18(1) 4QIK|1|C+4QIK|1|D
1332NR_all_18404.1
Exact match
Escherichia coli
3J45|1|3 (3J45)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
9.5 Å18(1) 3J45|1|3
1333NR_all_24738.1
Exact match
2Y9H|1|H (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å18(2) 2Y9H|1|H, 2Y9H|1|D
1334NR_all_25125.1
Exact match
3GM7|1|G+3GM7|1|H (3GM7)
  • 5'-R(*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): G, H, J, P; model(s): 1
1.6 Å18(2) 3GM7|1|G+3GM7|1|H, 1ZEV|1|A+1ZEV|1|B
1335NR_all_27182.1
Exact match
4M59|1|D (4M59)
  • psaJ RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å18(2) 4M59|1|D, 4OE1|1|D
1336NR_all_30288.1
Exact match
4IG8|1|B+4IG8|1|C (4IG8)
  • RNA (5'-R(*GP*GP*CP*UP*UP*UP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, J, P; model(s): 1
2.7 Å18(1) 4IG8|1|B+4IG8|1|C
1337NR_all_30784.1
Exact match
Rotavirus A
6OGZ|1|B+6OGZ|1|C (6OGZ)
  • RNA (5'-R(P*UP*AP*UP*AP*UP*AP*UP*AP*UP*A[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B, C, J, P; model(s): 1
3.6 Å18(1) 6OGZ|1|B+6OGZ|1|C
1338NR_all_31750.1
Exact match
1F5U|1|A (1F5U)
  • RNA (5'-R(*GP*GP*UP*GP*GP*GP*AP*GP*AP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
18(2) 1F5U|1|A, 1F5U|1|B
1339NR_all_33059.1
Exact match
Homo sapiens
4X4U|1|G (4X4U)
  • human MenBeta minihelix
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.7 Å18(1) 4X4U|1|G
1340NR_all_33897.1
Exact match
2QH4|19|A (2QH4)
  • Human U85 C/D-H/ACA scaRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 19
18(1) 2QH4|19|A
1341NR_all_38877.1
Exact match
1KFO|1|A (1KFO)
  • 5'-R(*GP*AP*AP*UP*GP*CP*CP*UP*GP*CP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å18(1) 1KFO|1|A
1342NR_all_43992.1
Exact match
synthetic construct
5AWH|1|C (5AWH)
  • RNA (5'-D(P*UP*UP*AP*CP*AP*AP*CP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å18(2) 5AWH|1|C, 5AWH|1|E
1343NR_all_46586.1
Exact match
2Y9H|1|J (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): J; model(s): 1
2.5 Å18(2) 2Y9H|1|J, 2Y9H|1|L
1344NR_all_50559.1
Exact match
Escherichia coli
3DEG|1|J (3DEG)
  • 50S RNA helix 71
  • ELECTRON MICROSCOPY
  • Chain(s): J; model(s): 1
10.9 Å18(1) 3DEG|1|J
1345NR_all_51674.1
Exact match
3BT7|1|D (3BT7)
  • RNA (5'-D(P*GP*CP*UP*GP*UP*GP*(5MU)P*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å18(2) 3BT7|1|D, 3BT7|1|C
1346NR_all_52453.4
Exact match
3OL9|1|B+3OL9|1|F+3OL9|1|C+3OL9|1|G+ 3OL9|1|D+3OL9|1|H (3OL9)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.3 Å18(10) 3OL9|1|B+3OL9|1|F+3OL9|1|C+3OL9|1|G+ 3OL9|1|D+3OL9|1|H, 3OL9|1|J+3OL9|1|N+3OL9|1|K+3OL9|1|O+ 3OL9|1|L+3OL9|1|P, 3OLB|1|J+3OLB|1|N+3OLB|1|K+3OLB|1|O+ 3OLB|1|L+3OLB|1|P, 3OLB|1|B+3OLB|1|F+3OLB|1|C+3OLB|1|G+ 3OLB|1|D+3OLB|1|H, 3OL6|1|B+3OL6|1|F+3OL6|1|C+3OL6|1|G+ 3OL6|1|D+3OL6|1|H, 3OL6|1|J+3OL6|1|N+3OL6|1|K+3OL6|1|O+ 3OL6|1|L+3OL6|1|P, 3OL8|1|B+3OL8|1|F+3OL8|1|C+3OL8|1|G+ 3OL8|1|D+3OL8|1|H, 3OL7|1|J+3OL7|1|N+3OL7|1|K+3OL7|1|O+ 3OL7|1|L+3OL7|1|P, 3OL7|1|B+3OL7|1|F+3OL7|1|C+3OL7|1|G+ 3OL7|1|D+3OL7|1|H, 3OL8|1|J+3OL8|1|N+3OL8|1|K+3OL8|1|O+ 3OL8|1|L+3OL8|1|P
1347NR_all_53005.1
Exact match
synthetic construct
5NXT|1|U (5NXT)
  • RNA (5'-R(*UP*GP*UP*UP*CP*UP*CP*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
1.4 Å18(1) 5NXT|1|U
1348NR_all_54156.1
Exact match
Homo sapiens
5EME|1|A (5EME)
  • RNA (5'-R(*GP*CP*AP*GP*CP*AP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å18(1) 5EME|1|A
1349NR_all_54661.1
Exact match
2GJW|1|I+2GJW|1|J+2GJW|1|L (2GJW)
  • 5'-R(*GP*CP*GP*AP*CP*CP*GP*AP*CP*CP*AP*([...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H, I, J, L; model(s): 1
2.9 Å18(2) 2GJW|1|I+2GJW|1|J+2GJW|1|L, 2GJW|1|E+2GJW|1|F+2GJW|1|H
1350NR_all_55443.1
Exact match
Enterobacteria phage lambda
6JNX|1|R (6JNX)
  • RNA (5'-R(P*AP*UP*AP*AP*GP*GP*UP*GP*GP*G[...]
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
4.1 Å18(1) 6JNX|1|R
1351NR_all_56450.1
Exact match
3QRQ|1|B (3QRQ)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å18(1) 3QRQ|1|B
1352NR_all_62040.1
Exact match
1AJF|1|A (1AJF)
  • RNA (5'-R(*GP*AP*CP*AP*GP*GP*GP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
18(1) 1AJF|1|A
1353NR_all_63269.1
Exact match
Haloarcula marismortui
6Q8V|1|A (6Q8V)
  • RNA (5'-R(*GP*GP*CP*GP*AP*AP*GP*(6MZ)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å18(1) 6Q8V|1|A
1354NR_all_70335.1
Exact match
Homo sapiens
5A8L|1|P (5A8L)
  • P-SITE TRNA, MRNA
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
3.8 Å18(1) 5A8L|1|P
1355NR_all_72322.1
Exact match
2Y9H|1|F (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å18(2) 2Y9H|1|F, 2Y9H|1|B
1356NR_all_72335.1
Exact match
5MSF|1|R (5MSF)
  • 5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*UP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å18(2) 5MSF|1|R, 5MSF|1|S
1357NR_all_73487.1
Exact match
2QK9|1|B (2QK9)
  • 5'-R(*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å18(1) 2QK9|1|B
1358NR_all_78183.1
Exact match
2Y8Y|1|B (2Y8Y)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å18(1) 2Y8Y|1|B
1359NR_all_81739.1
Exact match
1F6U|2|B (1F6U)
  • HIV-1 STEM-LOOP SL2 FROM PSI-RNA PACKAGI[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 2
18(1) 1F6U|2|B
1360NR_all_83036.1
Exact match
synthetic construct
4W5N|1|B (4W5N)
  • RNA (5'-R(P*UP*UP*CP*AP*CP*AP*UP*UP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å18(1) 4W5N|1|B
1361NR_all_83715.1
Exact match
synthetic construct
5DV7|1|A+5DV7|1|B (5DV7)
  • RNA (5'-R(*CP*CP*AP*GP*CP*AP*UP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, G, H, L; model(s): 1
3.5 Å18(1) 5DV7|1|A+5DV7|1|B
1362NR_all_86185.1
Exact match
Pseudomonas aeruginosa
6O1K|1|O (6O1K)
  • RNA (5'-R(*AP*AP*AP*AP*AP*UP*AP*AP*CP*AP[...]
  • ELECTRON MICROSCOPY
  • Chain(s): O; model(s): 1
3.1 Å18(6) 6O1K|1|O, 6O1K|1|P, 6O1M|1|O, 6O1M|1|P, 6O1L|1|O, 6O1L|1|P
1363NR_all_88536.1
Exact match
Saccharomyces cerevisiae
2WW9|1|G (2WW9)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
8.6 Å18(2) 2WW9|1|G, 2WWA|1|G
1364NR_all_91999.1
Exact match
Human gammaherpesvirus 8
5HSW|1|B (5HSW)
  • RNA (5'-R(P*UP*CP*UP*UP*GP*AP*AP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.3 Å18(1) 5HSW|1|B
1365NR_all_96357.1
Exact match
1Z30|1|A (1Z30)
  • 5'-R(*GP*GP*CP*GP*UP*UP*CP*GP*UP*UP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
18(1) 1Z30|1|A
1366NR_all_02491.1
Exact match
4V6E|1|AX (4V6E)
  • P-site tRNA ASL fragment, messenger RNA
  • X-RAY DIFFRACTION
  • Chain(s): AX; model(s): 1
3.7 Å17(3) 4V6E|1|AX, 4V6E|1|CV, 4V6E|1|CX
1367NR_all_04268.1
Exact match
Panicum mosaic virus
4V99|1|C2 (4V99)
  • 5'-R(P*UP*UP*AP*AP*UP*AP*UP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C2; model(s): 1
2.9 Å17(120) 4V99|1|C2, 4V99|1|Ec, 4V99|1|FD, 4V99|1|Ac, 4V99|1|AX, 4V99|1|GX, 4V99|1|FI, 4V99|1|Bh, 4V99|1|AN, 4V99|1|F7, 4V99|1|CS, 4V99|1|Ch, 4V99|1|AS, 4V99|1|Am, 4V99|1|DS, 4V99|1|Dc, 4V99|1|Jw, 4V99|1|Eh, 4V99|1|Bw, 4V99|1|Fw, 4V99|1|HS, 4V99|1|HX, 4V99|1|B7, 4V99|1|E7, 4V99|1|Aw, 4V99|1|FS, 4V99|1|Bc, 4V99|1|Bm, 4V99|1|ED, 4V99|1|EN, 4V99|1|Ic, 4V99|1|BN, 4V99|1|Em, 4V99|1|AI, 4V99|1|Er, 4V99|1|JD, 4V99|1|G7, 4V99|1|G2, 4V99|1|Iw, 4V99|1|EX, 4V99|1|HI, 4V99|1|Jh, 4V99|1|Jr, 4V99|1|B2, 4V99|1|D2, 4V99|1|DD, 4V99|1|BX, 4V99|1|Ah, 4V99|1|EI, 4V99|1|Gr, 4V99|1|Ir, 4V99|1|ES, 4V99|1|Br, 4V99|1|Cw, 4V99|1|I2, 4V99|1|C7, 4V99|1|D7, 4V99|1|Hr, 4V99|1|GS, 4V99|1|I7, 4V99|1|BI, 4V99|1|Fh, 4V99|1|Hc, 4V99|1|Dw, 4V99|1|Gc, 4V99|1|BS, 4V99|1|Jc, 4V99|1|Dm, 4V99|1|Ew, 4V99|1|Ar, 4V99|1|Cr, 4V99|1|CN, 4V99|1|IX, 4V99|1|IN, 4V99|1|J7, 4V99|1|E2, 4V99|1|DI, 4V99|1|Jm, 4V99|1|DN, 4V99|1|Cc, 4V99|1|BD, 4V99|1|FX, 4V99|1|DX, 4V99|1|AD, 4V99|1|Ih, 4V99|1|A2, 4V99|1|JX, 4V99|1|HD, 4V99|1|JN, 4V99|1|CI, 4V99|1|Fr, 4V99|1|CX, 4V99|1|CD, 4V99|1|Cm, 4V99|1|HN, 4V99|1|H7, 4V99|1|II, 4V99|1|H2, 4V99|1|Im, 4V99|1|Fm, 4V99|1|F2, 4V99|1|Fc, 4V99|1|GI, 4V99|1|A7, 4V99|1|Gh, 4V99|1|ID, 4V99|1|Hm, 4V99|1|Hh, 4V99|1|GN, 4V99|1|JI, 4V99|1|Dr, 4V99|1|FN, 4V99|1|Hw, 4V99|1|Gw, 4V99|1|J2, 4V99|1|GD, 4V99|1|Dh, 4V99|1|JS, 4V99|1|IS, 4V99|1|Gm
1368NR_all_06683.1
Exact match
4NGF|1|G+4NGF|1|H (4NGF)
  • 5'-R(P*UP*CP*GP*AP*AP*GP*GP*UP*CP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H, L; model(s): 1
3.1 Å17(2) 4NGF|1|G+4NGF|1|H, 4NGF|1|E+4NGF|1|F
1369NR_all_07425.1
Exact match
1ATV|1|A (1ATV)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*AP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1ATV|1|A
1370NR_all_09443.2
Exact match
4K4S|1|B+4K4S|1|F+4K4S|1|C+4K4S|1|G+ 4K4S|1|D+4K4S|1|H (4K4S)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.4 Å17(3) 4K4S|1|B+4K4S|1|F+4K4S|1|C+4K4S|1|G+ 4K4S|1|D+4K4S|1|H, 4K4T|1|F+4K4T|1|G+4K4T|1|H, 4K4T|1|B+4K4T|1|C+4K4T|1|D
1371NR_all_10812.1
Exact match
2LBJ|5|A (2LBJ)
  • RNA (5'-R(*GP*GP*GP*CP*CP*UP*UP*GP*CP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
17(1) 2LBJ|5|A
1372NR_all_10920.1
Exact match
Homo sapiens
4ZLD|1|B (4ZLD)
  • RNA (5'-R(*UP*AP*AP*CP*UP*UP*CP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å17(1) 4ZLD|1|B
1373NR_all_13392.1
Exact match
2LBK|1|A (2LBK)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*UP*CP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 2LBK|1|A
1374NR_all_14975.1
Exact match
2KRP|1|A (2KRP)
  • RNA (5'-R(*CP*UP*CP*GP*GP*CP*UP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 2KRP|1|A
1375NR_all_15533.1
Exact match
2Y9H|1|N (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.5 Å17(2) 2Y9H|1|N, 2Y9H|1|P
1376NR_all_15678.1
Exact match
Escherichia coli
3EP2|1|E (3EP2)
  • Fragment H69 of the 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
9.0 Å17(3) 3EP2|1|E, 3EQ3|1|E, 3EQ4|1|E
1377NR_all_17333.1
Exact match
4V6D|1|CV (4V6D)
  • P-site tRNA ASL fragment, messenger RNA,[...]
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.8 Å17(4) 4V6D|1|CV, 4V6D|1|AV, 4V50|1|CW, 4V50|1|AW
1378NR_all_17900.1
Exact match
Escherichia coli
3J0E|1|B (3J0E)
  • ribosomal 23S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
9.9 Å17(2) 3J0E|1|B, 3J0D|1|C
1379NR_all_21206.1
Exact match
2D19|1|B+2D19|1|A (2D19)
  • 5'-R(*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, G, H; model(s): 1
17(1) 2D19|1|B+2D19|1|A
1380NR_all_23218.1
Exact match
3QRR|1|B (3QRR)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å17(1) 3QRR|1|B
1381NR_all_24471.1
Exact match
4V4T|1|AX (4V4T)
  • 5'-D(*AP*UP*GP*UP*UP*CP*UP*AP*GP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): AX; model(s): 1
6.5 Å17(2) 4V4T|1|AX, 4V4R|1|AX
1382NR_all_24553.1
Exact match
4V4S|1|AX (4V4S)
  • 5'-D(*AP*UP*GP*UP*UP*CP*UP*AP*GP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): AX; model(s): 1
6.8 Å17(1) 4V4S|1|AX
1383NR_all_25417.1
Exact match
1BZ2|1|A (1BZ2)
  • TRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1BZ2|1|A
1384NR_all_26846.1
Exact match
1JBR|1|C+1JBR|1|F (1JBR)
  • 5'-R(*GP*CP*GP*CP*UP*CP*CP*UP*CP*AP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, G, H; model(s): 1
2.2 Å17(1) 1JBR|1|C+1JBR|1|F
1385NR_all_28467.1
Exact match
2M4W|7|A (2M4W)
  • RNA (5'-R(*GP*GP*AP*AP*UP*CP*GP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
17(1) 2M4W|7|A
1386NR_all_29353.1
Exact match
4QQB|1|P (4QQB)
  • msl2 mRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.8 Å17(2) 4QQB|1|P, 4QQB|1|C
1387NR_all_29537.1
Exact match
synthetic construct
6BHJ|1|E (6BHJ)
  • 38-MER RNA-DNA Aptamer
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.8 Å17(2) 6BHJ|1|E, 6BHJ|1|F
1388NR_all_31352.3
Exact match
Bacillus subtilis
2LAC|1|A (2LAC)
  • RNA (5'-R(*GP*GP*GP*GP*AP*CP*UP*GP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(3) 2LAC|1|A, 2LBQ|4|A, 2LA9|1|A
1389NR_all_32754.1
Exact match
2KVN|19|A (2KVN)
  • RNA (5'-R(*GP*GP*UP*GP*AP*UP*UP*GP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 19
17(1) 2KVN|19|A
1390NR_all_33835.1
Exact match
Escherichia coli
2JLT|1|A (2JLT)
  • R06, TAR
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å17(1) 2JLT|1|A
1391NR_all_38606.3
Exact match
1YN2|1|A (1YN2)
  • VS RIBOZYME STEM-LOOP V
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(2) 1YN2|1|A, 1YN1|1|A
1392NR_all_39077.1
Exact match
2JR4|4|A (2JR4)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*UP*AP*CP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
17(1) 2JR4|4|A
1393NR_all_41718.1
Exact match
4KYY|1|A+4KYY|1|B (4KYY)
  • RNA 17-mer
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
2.4 Å17(1) 4KYY|1|A+4KYY|1|B
1394NR_all_43408.1
Exact match
2LBL|3|A (2LBL)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*UP*CP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
17(1) 2LBL|3|A
1395NR_all_43622.1
Exact match
Homo sapiens
1E7K|1|C (1E7K)
  • RNA (5'-R(*GP*CP*CP*AP*AP*UP*GP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å17(2) 1E7K|1|C, 1E7K|1|D
1396NR_all_43901.1
Exact match
1R3E|1|D+1R3E|1|E (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*UP*CP*GP*AP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, G, H; model(s): 1
2.1 Å17(1) 1R3E|1|D+1R3E|1|E
1397NR_all_45251.1
Exact match
Escherichia coli
5VPO|1|XV (5VPO)
  • P-site ASL SufA6, messenger RNA
  • X-RAY DIFFRACTION
  • Chain(s): XV; model(s): 1
3.3 Å17(2) 5VPO|1|XV, 5VPO|1|QV
1398NR_all_46633.1
Exact match
2D18|1|A+2D18|1|B (2D18)
  • 5'-R(*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, G, H; model(s): 1
17(1) 2D18|1|A+2D18|1|B
1399NR_all_54314.1
Exact match
Thermus thermophilus
5XPG|1|G (5XPG)
  • 5'-R(*UP*AP*U*AP*CP*AP*AP*CP*CP*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.8 Å17(2) 5XPG|1|G, 5XOW|1|G
1400NR_all_62142.1
Exact match
Oryctolagus cuniculus
3J0O|1|c (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): c; model(s): 1
9.0 Å17(4) 3J0O|1|c, 3J0L|1|c, 3J0Q|1|c, 3J0P|1|c
1401NR_all_62991.1
Exact match
Oryctolagus cuniculus
4CXG|1|b (4CXG)
  • 18S RRNA - H8
  • ELECTRON MICROSCOPY
  • Chain(s): b; model(s): 1
8.7 Å17(2) 4CXG|1|b, 4CXH|1|b
1402NR_all_63765.1
Exact match
1KKA|1|A (1KKA)
  • anticodon stem-loop of tRNA(PHE)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1KKA|1|A
1403NR_all_70040.1
Exact match
synthetic construct
5K36|1|L (5K36)
  • RNA (17-MER)
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.1 Å17(1) 5K36|1|L
1404NR_all_72539.1
Exact match
1WKS|1|A (1WKS)
  • 5'-R(*GP*GP*CP*UP*UP*UP*GP*GP*AP*UP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1WKS|1|A
1405NR_all_72946.1
Exact match
2KPD|10|A (2KPD)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*CP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 10
17(1) 2KPD|10|A
1406NR_all_73746.1
Exact match
2OE5|1|B+2OE5|1|A (2OE5)
  • RNA (5'-R(*GP*GP*UP*AP*CP*UP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.5 Å17(1) 2OE5|1|B+2OE5|1|A
1407NR_all_73803.1
Exact match
synthetic construct
5VOE|1|A (5VOE)
  • Aptamer 11F7t (36-MER), DNA/RNA (36-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å17(2) 5VOE|1|A, 5VOF|1|A
1408NR_all_75422.3
Exact match
5UP6|1|R (5UP6)
  • RNA (5'-R(*GP*CP*AP*UP*UP*CP*AP*AP*AP*GP[...]
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
17(11) 5UP6|1|R, 5UPA|1|R, 6J9E|1|I, 5UPC|1|R, 6C6T|1|R, 6J9F|1|I, 6C6U|1|R, 6ALG|1|R, 6C6S|1|R, 6ALF|1|R, 6ALH|1|R
1409NR_all_75945.1
Exact match
2OE8|1|B+2OE8|1|A (2OE8)
  • RNA (5'-R(*CP*GP*GP*UP*AP*CP*UP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.8 Å17(2) 2OE8|1|B+2OE8|1|A, 2OE6|1|B+2OE6|1|A
1410NR_all_81203.2
Exact match
4K4Z|1|N+4K4Z|1|O+4K4Z|1|P (4K4Z)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H, N, O, P; model(s): 1
2.2 Å17(8) 4K4Z|1|N+4K4Z|1|O+4K4Z|1|P, 4K4Z|1|B+4K4Z|1|C+4K4Z|1|D, 4K4X|1|J+4K4X|1|K+4K4X|1|L, 4K4Z|1|J+4K4Z|1|K+4K4Z|1|L, 4K4X|1|B+4K4X|1|C+4K4X|1|D, 4K4Z|1|F+4K4Z|1|G+4K4Z|1|H, 4K4X|1|F+4K4X|1|G+4K4X|1|H, 4K4X|1|N+4K4X|1|O+4K4X|1|P
1411NR_all_81830.1
Exact match
Canis lupus
4V5Z|1|BC (4V5Z)
  • RNA Expansion segment ES5
  • ELECTRON MICROSCOPY
  • Chain(s): BC; model(s): 1
8.7 Å17(1) 4V5Z|1|BC
1412NR_all_81896.1
Exact match
3GLP|1|B+3GLP|1|A (3GLP)
  • 5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, G, H, P; model(s): 1
1.2 Å17(3) 3GLP|1|B+3GLP|1|A, 3GLP|1|C+3GLP|1|D, 3GLP|1|E
1413NR_all_82766.1
Exact match
2KPC|6|A (2KPC)
  • RNA (5'-R(*UP*GP*AP*GP*CP*AP*CP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
17(1) 2KPC|6|A
1414NR_all_83745.1
Exact match
synthetic construct
5T3K|1|A+5T3K|1|B (5T3K)
  • RNA (5'-R(*GP*GP*UP*GP*GP*UP*GP*AP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, G, H, P; model(s): 1
2.1 Å17(4) 5T3K|1|A+5T3K|1|B, 5T3K|1|C+5T3K|1|D, 1T0D|1|C+1T0D|1|D, 1T0D|1|A+1T0D|1|B
1415NR_all_84251.1
Exact match
1TBK|1|A (1TBK)
  • VS ribozyme stem-loop V
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1TBK|1|A
1416NR_all_91124.3
Exact match
Gloeobacter violaceus
6HC5|1|A (6HC5)
  • RNA (5'-R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.4 Å17(9) 6HC5|1|A, 5NEP|1|A, 6HBX|1|A, 6HBT|1|A, 5NEX|1|A, 5NEO|1|A, 5NEQ|1|A, 5NEF|1|A, 5NOM|1|A
1417NR_all_91413.1
Exact match
4OL8|1|C (4OL8)
  • 5'-R(*CP*UP*GP*AP*GP*AP*GP*AP*GP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.1 Å17(2) 4OL8|1|C, 4OL8|1|G
1418NR_all_93158.1
Exact match
Human immunodeficiency virus 1
6GML|1|P (6GML)
  • TAR RNA
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
3.2 Å17(1) 6GML|1|P
1419NR_all_94445.1
Exact match
1J4Y|1|A (1J4Y)
  • anticodon stem-loop of tRNA(Phe)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1J4Y|1|A
1420NR_all_00144.1
Exact match
Canis lupus
4V5Z|1|BW (4V5Z)
  • RNA Expansion segment ES10
  • ELECTRON MICROSCOPY
  • Chain(s): BW; model(s): 1
8.7 Å16(1) 4V5Z|1|BW
1421NR_all_02070.1
Exact match
Senecavirus A
5CNR|1|A+5CNR|1|B (5CNR)
  • RNA (5'-R(*GP*UP*CP*UP*AP*CP*CP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, G, H, P; model(s): 1
2.6 Å16(2) 5CNR|1|A+5CNR|1|B, 5CNR|1|E+5CNR|1|F
1422NR_all_04426.1
Exact match
4NHA|1|B (4NHA)
  • 5'-R(P*GP*CP*GP*UP*UP*GP*GP*CP*CP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.4 Å16(1) 4NHA|1|B
1423NR_all_06213.1
Exact match
2JSG|1|A (2JSG)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*UP*AP*CP*(6MZ[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2JSG|1|A
1424NR_all_06970.1
Exact match
4GG4|1|H (4GG4)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*AP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å16(1) 4GG4|1|H
1425NR_all_07880.1
Exact match
2LP9|1|A (2LP9)
  • RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2LP9|1|A
1426NR_all_12687.1
Exact match
synthetic construct
4RBZ|1|A (4RBZ)
  • 5'-R(*CP*GP*CP*GP*(A2M)P*(ADS)P*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å16(1) 4RBZ|1|A
1427NR_all_13485.1
Exact match
1U1Y|1|R (1U1Y)
  • 5'-R(*CP*CP*GP*GP*(2PR)P*GP*GP*AP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å16(2) 1U1Y|1|R, 1U1Y|1|S
1428NR_all_16304.1
Exact match
1BZT|1|A (1BZT)
  • TRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(2) 1BZT|1|A, 1BZ3|1|A
1429NR_all_16624.1
Exact match
Saccharomyces cerevisiae
1LU3|1|A (1LU3)
  • PHENYLALANINE TRANSFER RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
16.8 Å16(1) 1LU3|1|A
1430NR_all_17203.1
Exact match
Escherichia coli
3DEG|1|E (3DEG)
  • 30S RNA helix 8
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
10.9 Å16(1) 3DEG|1|E
1431NR_all_17816.1
Exact match
1FEQ|1|A (1FEQ)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*UP*UP*(T6A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 1FEQ|1|A
1432NR_all_19377.2
Exact match
Influenza A virus
5M3H|1|V+5M3H|1|R (5M3H)
  • RNA 5'-pAGUAGUAACAAGAGGG, RNA (5'-R(*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H, P, R, V; model(s): 1
2.5 Å16(6) 5M3H|1|V+5M3H|1|R, 6FHH|1|V+6FHH|1|R, 6FHI|1|V+6FHI|1|R, 6EVK|1|V+6EVK|1|R, 6EVJ|1|V+6EVJ|1|R, 6EVJ|1|U+6EVJ|1|S
1433NR_all_21999.1
Exact match
synthetic construct
6IR9|1|P (6IR9)
  • RNA (5'-R(P*GP*CP*CP*UP*GP*GP*UP*GP*UP*C[...]
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
3.8 Å16(3) 6IR9|1|P, 6J4Z|1|P, 6J50|1|P
1434NR_all_22464.1
Exact match
1R3E|1|C (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*(FHU)P*CP*GP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å16(1) 1R3E|1|C
1435NR_all_22508.1
Exact match
2KRZ|1|A (2KRZ)
  • RNA (5'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2KRZ|1|A
1436NR_all_26549.1
Exact match
1D0T|1|A (1D0T)
  • PHOSPHOROTHIOATE SUBSTITUTED PHAGE MS2 R[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 1D0T|1|A
1437NR_all_27657.1
Exact match
Pseudomonas aeruginosa
5VJ9|1|C (5VJ9)
  • RNA (5'-R(*GP*CP*GP*GP*GP*GP*AP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.6 Å16(8) 5VJ9|1|C, 5VJ9|1|D, 5VJ9|1|B, 5VJ9|1|A, 5VJB|1|D, 5VJB|1|A, 5VJB|1|C, 5VJB|1|B
1438NR_all_29002.1
Exact match
unidentified influenza virus
4WSB|1|V+4WSB|1|R (4WSB)
  • Influenza A polymerase vRNA promoter 5' [...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H, P, R, V; model(s): 1
2.7 Å16(1) 4WSB|1|V+4WSB|1|R
1439NR_all_29649.1
Exact match
3ND3|1|A (3ND3)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.4 Å16(1) 3ND3|1|A
1440NR_all_32676.1
Exact match
2F8K|1|B (2F8K)
  • 5'-R(*UP*AP*AP*UP*CP*UP*UP*UP*GP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å16(1) 2F8K|1|B
1441NR_all_33763.1
Exact match
3D0M|1|X (3D0M)
  • RNA (5'-R(*GP*UP*GP*GP*UP*CP*UP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.0 Å16(1) 3D0M|1|X
1442NR_all_34432.1
Exact match
synthetic construct
5XON|1|P (5XON)
  • RNA (30-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
3.8 Å16(1) 5XON|1|P
1443NR_all_34704.1
Exact match
1AM0|2|A (1AM0)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
16(1) 1AM0|2|A
1444NR_all_34948.1
Exact match
synthetic construct
6J51|1|P (6J51)
  • RNA (5'-R(P*CP*CP*UP*GP*GP*UP*GP*UP*CP*U[...]
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
4.2 Å16(3) 6J51|1|P, 6J4Y|1|P, 6J4X|1|P
1445NR_all_35312.1
Exact match
2D17|2|A+2D17|2|B (2D17)
  • 5'-R(*CP*GP*GP*CP*AP*AP*GP*AP*GP*GP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, G, H, P; model(s): 1, 2
16(1) 2D17|2|A+2D17|2|B
1446NR_all_35629.1
Exact match
2O5I|1|Y (2O5I)
  • 5'-R(P*GP*AP*GP*UP*CP*UP*GP*CP*GP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.5 Å16(6) 2O5I|1|Y, 2O5J|1|H, 2O5I|1|H, 2O5J|1|Y, 2PPB|1|Y, 2PPB|1|H
1447NR_all_37285.1
Exact match
1JTW|5|A (1JTW)
  • 5'-R(*GP*GP*GP*UP*GP*CP*GP*AP*GP*AP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
16(1) 1JTW|5|A
1448NR_all_37454.1
Exact match
synthetic construct
5XWG|1|A (5XWG)
  • RNA (5'-R(P*CP*GP*CP*UP*(5BU)P*CP*GP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å16(1) 5XWG|1|A
1449NR_all_39439.2
Exact match
1JWC|1|A (1JWC)
  • 5'-R(*GP*GP*CP*CP*AP*AP*AP*GP*GP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(2) 1JWC|1|A, 1JU7|1|A
1450NR_all_41594.1
Exact match
4ILM|1|C (4ILM)
  • RNA (5'-R(*GP*CP*UP*AP*AP*UP*CP*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.1 Å16(8) 4ILM|1|C, 4ILM|1|K, 4ILM|1|R, 4ILM|1|E, 4ILM|1|M, 4ILM|1|G, 4ILM|1|I, 4ILM|1|O
1451NR_all_42712.1
Exact match
1XWU|1|A (1XWU)
  • 5'-R(*CP*GP*AP*AP*AP*CP*AP*UP*AP*GP*AP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 1XWU|1|A
1452NR_all_43274.1
Exact match
Senecavirus A
4P97|1|A+4P97|1|B (4P97)
  • RNA (5'-R(*CP*GP*UP*CP*UP*AP*CP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, G, H, P; model(s): 1
1.9 Å16(2) 4P97|1|A+4P97|1|B, 4P97|1|C+4P97|1|D
1453NR_all_43598.1
Exact match
synthetic construct
5KVJ|1|A+5KVJ|1|B (5KVJ)
  • RNA (5'-R(P*CP*CP*AP*UP*CP*CP*UP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, G, H, P; model(s): 1
2.3 Å16(1) 5KVJ|1|A+5KVJ|1|B
1454NR_all_44263.1
Exact match
2AWQ|3|A (2AWQ)
  • 5'-R(*GP*GP*GP*GP*AP*(PSU)P*UP*GP*AP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
16(1) 2AWQ|3|A
1455NR_all_44431.1
Exact match
2KRW|1|A (2KRW)
  • RNA (5'-R(*CP*UP*CP*GP*GP*(N)P*UP*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2KRW|1|A
1456NR_all_45368.1
Exact match
2MNC|1|A (2MNC)
  • RNA (5'-R(*GP*GP*GP*UP*UP*GP*AP*CP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2MNC|1|A
1457NR_all_47141.1
Exact match
synthetic construct
4RC0|1|A (4RC0)
  • 5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*(A2M)P*(2S[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å16(1) 4RC0|1|A
1458NR_all_48491.1
Exact match
2L6I|1|A (2L6I)
  • RNA (5'-R(*GP*AP*UP*CP*UP*CP*UP*UP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2L6I|1|A
1459NR_all_51034.1
Exact match
4HKQ|1|E (4HKQ)
  • RNA (5'-R(*AP*AP*CP*AP*GP*AP*GP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å16(1) 4HKQ|1|E
1460NR_all_51266.2
Exact match
Enterobacteria phage MS2
2C4Q|1|R (2C4Q)
  • 5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP *PYO[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å16(38) 2C4Q|1|R, 2C4Y|1|R, 2C4Q|1|S, 2BU1|1|R, 2C4Y|1|S, 2IZ8|1|R, 2C4Z|1|S, 2C4Z|1|R, 2C51|1|R, 2BU1|1|S, 2C50|1|R, 2C51|1|S, 2IZ8|1|S, 2C50|1|S, 1ZDH|1|R, 1ZDH|1|S, 2IZ9|1|R, 2IZ9|1|S, 2BQ5|1|R, 2BNY|1|R, 2BQ5|1|S, 2BNY|1|S, 1AQ4|1|R, 1AQ3|1|R, 1AQ3|1|S, 1AQ4|1|S, 2IZM|1|R, 2IZM|1|S, 1ZDI|1|R, 2B2E|1|R, 1KUO|1|R, 1KUO|1|S, 2B2G|1|R, 1ZDK|1|R, 1ZDK|1|S, 1ZDI|1|S, 2B2E|1|S, 2B2G|1|S
1461NR_all_51779.4
Exact match
1Z7F|1|A (1Z7F)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å16(8) 1Z7F|1|A, 1Z79|1|C, 1Z79|1|A+1Z79|1|B, 1YRM|1|C, 1YRM|1|A+1YRM|1|B, 1YY0|1|C, 1YY0|1|A+1YY0|1|B, 405D|1|A+405D|1|B
1462NR_all_52445.1
Exact match
California encephalitis orthobunyavirus
5AMR|1|B+5AMR|1|C (5AMR)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, G, H, P; model(s): 1
2.6 Å16(2) 5AMR|1|B+5AMR|1|C, 5AMQ|1|B+5AMQ|1|c
1463NR_all_56484.1
Exact match
2RN1|3|A (2RN1)
  • RNA (5'-R(P*GP*AP*GP*CP*CP*CP*UP*GP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
16(1) 2RN1|3|A
1464NR_all_58318.1
Exact match
406D|1|A+406D|1|E (406D)
  • RNA (5'-R(*CP*AP*CP*CP*GP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, E, G, H, P; model(s): 1
1.8 Å16(1) 406D|1|A+406D|1|E
1465NR_all_60168.1
Exact match
2OOM|3|A (2OOM)
  • RNA 16-mer, TAR RNA element of HIV-1
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
16(1) 2OOM|3|A
1466NR_all_61892.1
Exact match
4QIL|1|C (4QIL)
  • 5'-R(*CP*UP*CP*CP*CP*UP*UP*CP*UP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å16(2) 4QIL|1|C, 4QIL|1|D
1467NR_all_65186.1
Exact match
2KRQ|1|A (2KRQ)
  • RNA (5'-R(*CP*UP*CP*GP*GP*CP*UP*IP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2KRQ|1|A
1468NR_all_66026.1
Exact match
2PN9|1|A+2PN9|1|B (2PN9)
  • 5'-R(*GP*GP*AP*GP*CP*CP*UP*GP*GP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, G, H, P; model(s): 1
16(1) 2PN9|1|A+2PN9|1|B
1469NR_all_69912.1
Exact match
1BZU|1|A (1BZU)
  • TRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 1BZU|1|A
1470NR_all_71588.1
Exact match
synthetic construct
6J4W|1|P (6J4W)
  • RNA (5'-R(P*GP*UP*GP*UP*UP*UP*GP*GP*GP*U[...]
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
7.9 Å16(1) 6J4W|1|P
1471NR_all_72481.1
Exact match
4KJI|1|C (4KJI)
  • RsmZ-2
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.2 Å16(2) 4KJI|1|C, 4KJI|1|D
1472NR_all_73721.1
Exact match
Canis lupus
4V5Z|1|BD (4V5Z)
  • RNA Expansion segment ES7 part I
  • ELECTRON MICROSCOPY
  • Chain(s): BD; model(s): 1
8.7 Å16(1) 4V5Z|1|BD
1473NR_all_74336.1
Exact match
1ZBH|1|F (1ZBH)
  • 5'-R(*CP*CP*GP*GP*CP*UP*CP*UP*UP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å16(2) 1ZBH|1|F, 1ZBH|1|E
1474NR_all_75931.1
Exact match
Bacillus subtilis
5ZW4|1|D (5ZW4)
  • RNA (5'-R(*CP*CP*UP*GP*CP*UP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.7 Å16(1) 5ZW4|1|D
1475NR_all_76611.1
Exact match
2G1G|1|A (2G1G)
  • 5'-R(*AP*CP*GP*GP*GP*CP*UP*CP*AP*UP*(T6A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2G1G|1|A
1476NR_all_78686.1
Exact match
synthetic construct
1KIS|1|A (1KIS)
  • RNA (5'-R(*GP*AP*GP*CP*CP*CP*UP*GP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 1KIS|1|A
1477NR_all_82939.1
Exact match
3ND4|1|A (3ND4)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*CP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.5 Å16(1) 3ND4|1|A
1478NR_all_83369.1
Exact match
Escherichia coli
6P19|1|R (6P19)
  • Transcribed RNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.8 Å16(1) 6P19|1|R
1479NR_all_84353.1
Exact match
Thermus thermophilus
1ZC8|1|B (1ZC8)
  • H2 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
13.0 Å16(1) 1ZC8|1|B
1480NR_all_89129.1
Exact match
1Z7F|1|B+1Z7F|1|C (1Z7F)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, G, H, P; model(s): 1
2.1 Å16(1) 1Z7F|1|B+1Z7F|1|C
1481NR_all_90197.1
Exact match
2JRQ|6|A (2JRQ)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0)P*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
16(1) 2JRQ|6|A
1482NR_all_90823.1
Exact match
Escherichia coli
5D0B|1|F (5D0B)
  • RNA (5'-D(*GP*CP*AP*GP*AP*CP*UP*(56B)P*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å16(1) 5D0B|1|F
1483NR_all_92312.1
Exact match
Canis lupus
4V5Z|1|BU (4V5Z)
  • RNA Expansion segment ES41
  • ELECTRON MICROSCOPY
  • Chain(s): BU; model(s): 1
8.7 Å16(1) 4V5Z|1|BU
1484NR_all_93941.1
Exact match
2KYD|1|A+2KYD|1|B (2KYD)
  • RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, G, H, P; model(s): 1
16(1) 2KYD|1|A+2KYD|1|B
1485NR_all_94897.1
Exact match
1N53|1|A+1N53|1|B (1N53)
  • RNA (5'-R(*GP*AP*GP*GP*GP*UP*GP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, G, H, P; model(s): 1
16(1) 1N53|1|A+1N53|1|B
1486NR_all_04124.1
Exact match
1A4T|1|A (1A4T)
  • BOXB RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1A4T|1|A
1487NR_all_07779.1
Exact match
1NUV|1|A+1NUV|1|B (1NUV)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, G, H, P; model(s): 1
1.8 Å15(5) 1NUV|1|A+1NUV|1|B, 1NUV|1|G+1NUV|1|H, 429D|1|A+429D|1|B, 1NUJ|1|A+1NUJ|1|B, 1NUJ|1|G+1NUJ|1|H
1488NR_all_10487.1
Exact match
4NFQ|1|A (4NFQ)
  • GCAG(7AT)CUUAAGUCUGC, GCAGACUUAAGUCUGC, [...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å15(7) 4NFQ|1|A, 4NFQ|1|B+4NFQ|1|C, 4NFO|1|A, 4NFP|1|B+4NFP|1|C, 4NFP|1|A, 4NFO|1|B+4NFO|1|C, 1YZD|1|C
1489NR_all_13312.1
Exact match
synthetic construct
5Y6Z|1|B+5Y6Z|1|C (5Y6Z)
  • Template RNA (33-MER), Product RNA (14-M[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, G, H, P; model(s): 1
2.5 Å15(2) 5Y6Z|1|B+5Y6Z|1|C, 5Y6Z|1|F+5Y6Z|1|G
1490NR_all_14161.1
Exact match
1Q75|1|A (1Q75)
  • DKC mutant P2b telomerase RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1Q75|1|A
1491NR_all_15428.1
Exact match
Escherichia coli
3DEG|1|K (3DEG)
  • 50S RNA helix 92
  • ELECTRON MICROSCOPY
  • Chain(s): K; model(s): 1
10.9 Å15(1) 3DEG|1|K
1492NR_all_16585.1
Exact match
3PO2|1|P (3PO2)
  • RNA product strand
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.3 Å15(1) 3PO2|1|P
1493NR_all_19387.1
Exact match
synthetic construct
5W0O|1|C+5W0O|1|D (5W0O)
  • double-stranded RNA
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H, P; model(s): 1
2.5 Å15(1) 5W0O|1|C+5W0O|1|D
1494NR_all_19413.1
Exact match
2I91|1|F+2I91|1|E (2I91)
  • 5'-R(*C*GP*GP*UP*AP*GP*GP*CP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, G, H, P; model(s): 1
2.7 Å15(2) 2I91|1|F+2I91|1|E, 2I91|1|D+2I91|1|C
1495NR_all_26629.1
Exact match
3HK2|1|F (3HK2)
  • 5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å15(8) 3HK2|1|F, 3HK2|1|D, 3HVR|1|D, 3HM9|1|Y, 3HVR|1|N, 3F73|1|Y, 3HXM|1|Y, 3F73|1|H
1496NR_all_28474.1
Exact match
1OQ0|1|A (1OQ0)
  • P6.1 RNA hairpin from hTR
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1OQ0|1|A
1497NR_all_29253.1
Exact match
synthetic construct
6BGB|1|A+6BGB|1|B (6BGB)
  • (5'-R(*GP*CP*AP*GP*(A7C)P*CP*UP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, G, H, P; model(s): 1
1.7 Å15(2) 6BGB|1|A+6BGB|1|B, 6BGB|1|C
1498NR_all_30965.1
Exact match
Pseudomonas phage phi6
6GKH|1|X+6GKH|1|Y (6GKH)
  • RNA (5'-R(P*GP*UP*CP*AP*AP*GP*CP*CP*GP*A[...]
  • ELECTRON MICROSCOPY
  • Chain(s): D, G, H, P, X, Y; model(s): 1
4.1 Å15(1) 6GKH|1|X+6GKH|1|Y
1499NR_all_31133.1
Exact match
Enterobacteria phage lambda
1HJI|1|A (1HJI)
  • RNA (5-R(P*GP*CP*CP*CP*UP*GP*AP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(2) 1HJI|1|A, 1QFQ|1|A
1500NR_all_32430.1
Exact match
Insect cell expression vector pTIE1
5VM9|1|D (5VM9)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.3 Å15(1) 5VM9|1|D
1501NR_all_33125.1
Exact match
4NH6|1|B (4NH6)
  • 5'-R(P*UP*UP*UP*GP*CP*GP*AP*AP*UP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å15(1) 4NH6|1|B
1502NR_all_33604.1
Exact match
1ZZ5|1|A+1ZZ5|1|C+1ZZ5|1|B+1ZZ5|1|D (1ZZ5)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
3.0 Å15(2) 1ZZ5|1|A+1ZZ5|1|C+1ZZ5|1|B+1ZZ5|1|D, 2A04|1|A+2A04|1|C+2A04|1|B+2A04|1|D
1503NR_all_36248.1
Exact match
Pseudomonas phage phi6
6G1X|1|X+6G1X|1|Y (6G1X)
  • RNA (5'-R(P*UP*CP*CP*AP*UP*GP*CP*GP*CP*A[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B, D, H, X, Y; model(s): 1
3.9 Å15(4) 6G1X|1|X+6G1X|1|Y, 6G1S|1|X+6G1S|1|Y, 6H61|1|X+6H61|1|Y, 6H66|1|X+6H66|1|Y
1504NR_all_38795.1
Exact match
1YZD|1|A+1YZD|1|B (1YZD)
  • RNA 5'-R(*GP*CP*AP*GP*AP*(A5M)P*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.4 Å15(1) 1YZD|1|A+1YZD|1|B
1505NR_all_41639.1
Exact match
Canis lupus
4V5Z|1|BP (4V5Z)
  • RNA Expansion segment ES31 part I
  • ELECTRON MICROSCOPY
  • Chain(s): BP; model(s): 1
8.7 Å15(1) 4V5Z|1|BP
1506NR_all_43510.1
Exact match
3J2K|1|3 (3J2K)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
15(1) 3J2K|1|3
1507NR_all_43988.1
Exact match
Homo sapiens
5EMF|1|A (5EMF)
  • RNA (5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å15(1) 5EMF|1|A
1508NR_all_44402.1
Exact match
Homo sapiens
5VH8|1|A+5VH8|1|B (5VH8)
  • RNA (5'-R(*GP*AP*CP*CP*UP*GP*CP*UP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, H; model(s): 1
15(1) 5VH8|1|A+5VH8|1|B
1509NR_all_44916.1
Exact match
3HJF|1|Y (3HJF)
  • 5'-R(*CP*AP*AP*CP*CP*UP*AP*CP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
3.1 Å15(1) 3HJF|1|Y
1510NR_all_45442.1
Exact match
397D|1|A+397D|1|B (397D)
  • RNA (5'-R(*GP*GP*CP*CP*AP*GP*AP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.3 Å15(1) 397D|1|A+397D|1|B
1511NR_all_45930.1
Exact match
Thermus thermophilus
6CAP|1|W+6CAP|1|Y (6CAP)
  • RNA (5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, H, W, Y; model(s): 1
3.4 Å15(10) 6CAP|1|W+6CAP|1|Y, 6CAQ|1|W+6CAQ|1|Y, 4DR4|1|W+4DR4|1|V, 1IBL|1|Y+1IBL|1|Z, 6CAO|1|W+6CAO|1|Y, 1IBM|1|Y+1IBM|1|Z, 6CAS|1|W+6CAS|1|Y, 4DR5|1|W+4DR5|1|V, 6CAR|1|W+6CAR|1|Y, 4AQY|1|Z+4AQY|1|W
1512NR_all_47291.1
Exact match
1T0K|1|D+1T0K|1|C (1T0K)
  • 5'-R(*G*GP*AP*CP*GP*CP*AP*GP*AP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
3.2 Å15(1) 1T0K|1|D+1T0K|1|C
1513NR_all_51186.1
Exact match
2LBR|1|A (2LBR)
  • RNA (5'-R(*GP*GP*GP*GP*AP*CP*UP*GP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 2LBR|1|A
1514NR_all_53157.1
Exact match
1CSL|1|B+1CSL|1|A (1CSL)
  • 5'-R(*UP*CP*UP*GP*AP*CP*GP*GP*UP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.6 Å15(1) 1CSL|1|B+1CSL|1|A
1515NR_all_54825.1
Exact match
1KOS|1|A (1KOS)
  • 5'-R(*CP*UP*GP*UP*GP*(5MU)P*UP*CP*GP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1KOS|1|A
1516NR_all_56975.1
Exact match
synthetic construct
5CKI|1|D (5CKI)
  • RNA (5'-R(P*GP*CP*AP*CP*UP*AP*GP*AP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å15(2) 5CKI|1|D, 5CKK|1|D
1517NR_all_62747.1
Exact match
Flock house virus
4FTB|1|R (4FTB)
  • Flock House virus genomic RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å15(1) 4FTB|1|R
1518NR_all_63200.1
Exact match
2KRV|1|A (2KRV)
  • RNA (5'-R(*CP*UP*CP*GP*GP*(RSP)P*UP*IP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 2KRV|1|A
1519NR_all_65600.1
Exact match
Pseudomonas aeruginosa
2XLK|1|C (2XLK)
  • 5'-R(*CP*UP*GP*CP*CP*GP*UP*AP*UP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.8 Å15(5) 2XLK|1|C, 2XLK|1|D, 2XLI|1|B, 2XLJ|1|B, 4AL6|1|B
1520NR_all_68126.1
Exact match
2H1M|1|A+2H1M|1|B (2H1M)
  • 5'-R(*GP*CP*AP*(XUG)P*AP*GP*UP*UP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.9 Å15(2) 2H1M|1|A+2H1M|1|B, 420D|1|A+420D|1|B
1521NR_all_70406.1
Exact match
1ATW|1|A (1ATW)
  • RNA (5'-R(*GP*CP*UP*CP*CP*AP*GP*AP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1ATW|1|A
1522NR_all_72370.1
Exact match
2L9E|2|A (2L9E)
  • RNA (5'-R(*GP*CP*AP*GP*AP*CP*UP*(70U)P*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
15(1) 2L9E|2|A
1523NR_all_73551.1
Exact match
1SDS|1|D (1SDS)
  • box H/ACA sRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å15(3) 1SDS|1|D, 1SDS|1|E, 1SDS|1|F
1524NR_all_75028.1
Exact match
Enterobacteria phage MS2
2IZN|1|R (2IZN)
  • 5'-R(*AP*CP*AP*UP*CP*GP*CP*GP*AP*UP *UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.6 Å15(2) 2IZN|1|R, 2IZN|1|S
1525NR_all_76431.1
Exact match
2JRG|1|A (2JRG)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0)P*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 2JRG|1|A
1526NR_all_76733.1
Exact match
3DD2|1|B (3DD2)
  • RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å15(1) 3DD2|1|B
1527NR_all_77106.1
Exact match
Homo sapiens
5U9B|4|B (5U9B)
  • RNA (5'-R(P*GP*UP*CP*UP*CP*GP*CP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 4
15(1) 5U9B|4|B
1528NR_all_77294.1
Exact match
Gloeobacter violaceus
5NDH|1|A (5NDH)
  • RNA (5'-R(*GP*(CBV)P*GP*GP*GP*GP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å15(4) 5NDH|1|A, 5NDH|1|B, 5NDH|1|D, 5NDH|1|C
1529NR_all_78890.1
Exact match
Homo sapiens
5VH7|1|A+5VH7|1|B (5VH7)
  • RNA (5'-R(*GP*AP*CP*CP*AP*GP*CP*AP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, H; model(s): 1
15(1) 5VH7|1|A+5VH7|1|B
1530NR_all_80680.1
Exact match
3R1D|1|E (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.5 Å15(1) 3R1D|1|E
1531NR_all_80882.1
Exact match
Homo sapiens
4Z31|1|E (4Z31)
  • RNA (5'-R(*A)-D(P*UP*GP*UP*UP*CP*UP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.5 Å15(2) 4Z31|1|E, 4Z31|1|F
1532NR_all_81284.1
Exact match
2LPA|1|A (2LPA)
  • RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 2LPA|1|A
1533NR_all_82097.1
Exact match
synthetic construct
6ABF|1|V+6ABF|1|R (6ABF)
  • RNA (5'-R(P*AP*GP*CP*AP*GP*UP*AP*GP*CP*A[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B, D, H, R, V; model(s): 1
3.7 Å15(5) 6ABF|1|V+6ABF|1|R, 6ABB|1|V+6ABB|1|R, 6ABG|1|V+6ABG|1|R, 6ABD|1|V+6ABD|1|R, 6ABE|1|V+6ABE|1|R
1534NR_all_82429.1
Exact match
synthetic construct
5V2R|1|A+5V2R|1|B (5V2R)
  • RNA (5'-R(*CP*CP*AP*GP*AP*AP*AP*CP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, H; model(s): 1
15(1) 5V2R|1|A+5V2R|1|B
1535NR_all_83774.1
Exact match
2KRY|1|A (2KRY)
  • RNA (5'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*(RSQ[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 2KRY|1|A
1536NR_all_87784.1
Exact match
1ZX7|1|C+1ZX7|1|E+1ZX7|1|D+1ZX7|1|F (1ZX7)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
2.2 Å15(2) 1ZX7|1|C+1ZX7|1|E+1ZX7|1|D+1ZX7|1|F, 1ZX7|1|A+1ZX7|1|G+1ZX7|1|B+1ZX7|1|H
1537NR_all_89051.1
Exact match
Saccharomyces cerevisiae
2NOQ|1|D+2NOQ|1|C (2NOQ)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): C, D, F, H; model(s): 1
7.3 Å15(1) 2NOQ|1|D+2NOQ|1|C
1538NR_all_90162.1
Exact match
unidentified
4WQS|1|Y (4WQS)
  • RNA (5'-R(P*CP*CP*AP*GP*CP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
4.3 Å15(2) 4WQS|1|Y, 4WQS|1|H
1539NR_all_93219.1
Exact match
2AZ0|1|C+2AZ0|1|D (2AZ0)
  • 5'-R(*GP*CP*AP*(5BU)P*GP*GP*AP*CP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.6 Å15(2) 2AZ0|1|C+2AZ0|1|D, 2AZ2|1|C+2AZ2|1|D
1540NR_all_95734.1
Exact match
Thermus thermophilus
4B3R|1|Z+4B3R|1|W (4B3R)
  • 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, W, Z; model(s): 1
3.0 Å15(4) 4B3R|1|Z+4B3R|1|W, 4B3M|1|Z+4B3M|1|W, 4B3T|1|Z+4B3T|1|W, 4B3S|1|Z+4B3S|1|W
1541NR_all_98387.1
Exact match
1XWP|1|A (1XWP)
  • 5'-R(*GP*GP*AP*GP*AP*UP*CP*GP*CP*AP*CP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1XWP|1|A
1542NR_all_98916.1
Exact match
3CZW|1|X (3CZW)
  • RNA (5'-R(*G*UP*GP*GP*UP*CP*UP*GP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.4 Å15(1) 3CZW|1|X
1543NR_all_99371.1
Exact match
Spodoptera frugiperda
4FTS|1|R (4FTS)
  • Random cellular RNAs
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å15(2) 4FTS|1|R, 4FTE|1|R
1544NR_all_00747.1
Exact match
4H5P|1|F (4H5P)
  • 28-mer poly(U) RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å14(2) 4H5P|1|F, 4H5P|1|E
1545NR_all_00896.1
Exact match
2BX2|1|R (2BX2)
  • RNA (5'-R(*UP*UP*UP*AP*CP*AP*GP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å14(1) 2BX2|1|R
1546NR_all_03202.1
Exact match
1TFY|1|H+1TFY|1|E (1TFY)
  • 5'-R(*GP*CP*GP*GP*AP*UP*AP*UP*CP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
3.2 Å14(2) 1TFY|1|H+1TFY|1|E, 1TFY|1|I+1TFY|1|F
1547NR_all_07899.1
Exact match
1K4A|1|A (1K4A)
  • 5'-R(*GP*GP*UP*UP*CP*AP*GP*AP*AP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1K4A|1|A
1548NR_all_08227.1
Exact match
1LUX|1|A (1LUX)
  • 5'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG)P*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1LUX|1|A
1549NR_all_09578.1
Exact match
1F85|1|A (1F85)
  • HCV-1B IRES RNA DOMAIN IIIE
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1F85|1|A
1550NR_all_09827.1
Exact match
3AVY|1|T+3AVY|1|G (3AVY)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*UP*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
2.6 Å14(1) 3AVY|1|T+3AVY|1|G
1551NR_all_11900.1
Exact match
Triticum aestivum
2WWB|1|G (2WWB)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
6.5 Å14(1) 2WWB|1|G
1552NR_all_13358.1
Exact match
Thermus thermophilus
1N32|1|Y+1N32|1|Z (1N32)
  • ANTICODON STEM-LOOP OF LEU-2 TRANSFER RN[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, Y, Z; model(s): 1
3.0 Å14(1) 1N32|1|Y+1N32|1|Z
1553NR_all_13685.1
Exact match
unidentified
4PMW|1|D (4PMW)
  • U-U-U-U-U-U-U-U-U-U-U-U-U-U
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å14(2) 4PMW|1|D, 4PMW|1|C
1554NR_all_14163.1
Exact match
unidentified
2MN0|2|A (2MN0)
  • 5'-R(*GP*GP*AP*GP*AP*GP*(H2U)P*GP*GP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
14(1) 2MN0|2|A
1555NR_all_14347.1
Exact match
Escherichia coli
5MS0|1|H (5MS0)
  • RNA transcription bubble
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
9.8 Å14(1) 5MS0|1|H
1556NR_all_14903.1
Exact match
Methanococcus maripaludis
4Z7L|1|I (4Z7L)
  • RNA (5'-R(*GP*CP*AP*AP*AP*AP*UP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.5 Å14(3) 4Z7L|1|I, 4Z7L|1|F, 4Z7L|1|C
1557NR_all_15840.1
Exact match
1FL8|1|A (1FL8)
  • ANTICODON DOMAIN OF TRNA(LYS)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1FL8|1|A
1558NR_all_16360.1
Exact match
2EVY|1|A (2EVY)
  • Poliovirus 5'NTR cloverleaf stem loop D [...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 2EVY|1|A
1559NR_all_18222.1
Exact match
1K4B|1|A (1K4B)
  • 5'-R(*GP*GP*UP*UP*CP*AP*GP*UP*UP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1K4B|1|A
1560NR_all_20306.1
Exact match
synthetic construct
4ZLR|1|C (4ZLR)
  • RNA (5'-R(*UP*UP*GP*UP*UP*GP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å14(1) 4ZLR|1|C
1561NR_all_21216.1
Exact match
Canis lupus
4V5Z|1|AG (4V5Z)
  • RNA helix
  • ELECTRON MICROSCOPY
  • Chain(s): AG; model(s): 1
8.7 Å14(1) 4V5Z|1|AG
1562NR_all_21328.1
New id, no parents
Influenza A virus
6RR7|1|D+6RR7|1|E (6RR7)
  • RNA (5'-R(P*AP*GP*UP*AP*GP*AP*AP*AP*CP*A[...]
  • ELECTRON MICROSCOPY
  • Chain(s): D, E, F, H; model(s): 1
3.0 Å14(1) 6RR7|1|D+6RR7|1|E
1563NR_all_22333.1
Exact match
2O32|1|A (2O32)
  • 5'-R(*(PSU)P*CP*UP*CP*(OMG)P*(OMG)P*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 2O32|1|A
1564NR_all_24974.1
Exact match
1DUQ|1|B+1DUQ|1|A (1DUQ)
  • THE REV BINDING ELEMENT
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
2.1 Å14(4) 1DUQ|1|B+1DUQ|1|A, 1DUQ|1|D+1DUQ|1|C, 1DUQ|1|F+1DUQ|1|E, 1DUQ|1|H+1DUQ|1|G
1565NR_all_25771.1
Exact match
Escherichia coli
5D0A|1|F (5D0A)
  • RNA (5'-R(*G*CP*AP*GP*AP*CP*UP*GP*UP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å14(3) 5D0A|1|F, 5D0A|1|E, 5T8Y|1|X
1566NR_all_30499.1
New id, no parents
Influenza A virus
6QWL|1|W+6QWL|1|T (6QWL)
  • 5' cRNA, 3' cRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D, F, H, T, W; model(s): 1
4.1 Å14(1) 6QWL|1|W+6QWL|1|T
1567NR_all_31286.1
Exact match
6MSF|1|R (6MSF)
  • RNA (5'-R(*CP*CP*AP*CP*AP*GP*UP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å14(1) 6MSF|1|R
1568NR_all_33534.1
Exact match
Pseudomonas phage phi6
6G19|1|X+6G19|1|Y (6G19)
  • RNA (5'-R(P*CP*AP*AP*GP*CP*CP*GP*AP*GP*G[...]
  • ELECTRON MICROSCOPY
  • Chain(s): D, F, H, X, Y; model(s): 1
3.7 Å14(3) 6G19|1|X+6G19|1|Y, 6GKM|1|X+6GKM|1|Y, 6GJZ|1|X+6GJZ|1|Y
1569NR_all_36960.1
Exact match
2KOC|1|A (2KOC)
  • RNA (5'-R(P*GP*GP*CP*AP*CP*UP*UP*CP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(3) 2KOC|1|A, 6BY4|1|A, 6BY5|9|A
1570NR_all_39003.1
Exact match
1MHK|1|L+1MHK|1|S (1MHK)
  • RNA 14-mer BCh12, RNA 12-mer BCh12
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, L, S; model(s): 1
2.5 Å14(1) 1MHK|1|L+1MHK|1|S
1571NR_all_39301.1
Exact match
Spodoptera frugiperda
4FSJ|1|R (4FSJ)
  • Random cellular RNA fragments
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.5 Å14(1) 4FSJ|1|R
1572NR_all_40560.1
Exact match
3OIN|1|C (3OIN)
  • 5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*AP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å14(3) 3OIN|1|C, 3OIJ|1|D, 3OIJ|1|C
1573NR_all_41220.1
Exact match
1KOD|1|B+1KOD|1|A (1KOD)
  • RNA (5'-R(P*AP*CP*GP*GP*UP*UP*AP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, F, H; model(s): 1
14(1) 1KOD|1|B+1KOD|1|A
1574NR_all_42126.1
Exact match
2B3J|1|E (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å14(3) 2B3J|1|E, 2B3J|1|F, 2B3J|1|H
1575NR_all_43127.1
Exact match
Rotavirus A
6OJ6|1|T+6OJ6|1|U (6OJ6)
  • Template, Transcript
  • ELECTRON MICROSCOPY
  • Chain(s): D, F, H, T, U; model(s): 1
4.2 Å14(1) 6OJ6|1|T+6OJ6|1|U
1576NR_all_44959.1
Exact match
1MY9|1|A (1MY9)
  • 5'-R(*GP*GP*AP*GP*GP*UP*UP*UP*UP*GP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1MY9|1|A
1577NR_all_45043.1
Exact match
Influenza B virus
4WRT|1|V+4WRT|1|R (4WRT)
  • Influenza virus polymerase vRNA promoter[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, R, V; model(s): 1
2.7 Å14(10) 4WRT|1|V+4WRT|1|R, 6QCW|1|V+6QCW|1|R+6QCW|1|M, 6QCX|1|V+6QCX|1|R+6QCX|1|M, 6QCV|1|V+6QCV|1|R+6QCV|1|M, 4WSA|1|V+4WSA|1|R, 5M3J|1|V+5M3J|1|R, 5MSG|1|V+5MSG|1|R, 6QCS|1|V+6QCS|1|R, 6QCT|1|V, 6F5O|1|V+6F5O|1|R
1578NR_all_46866.1
Exact match
synthetic construct
4BWM|1|G (4BWM)
  • 5'-R(*AP*AP*AP*GP*GP*GP*CP*GP*CP*CP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
1.8 Å14(1) 4BWM|1|G
1579NR_all_48565.1
Exact match
Tetrahymena thermophila
1C0O|1|A (1C0O)
  • RNA (5'-R(*GP*GP*GP*UP*CP*UP*UP*CP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1C0O|1|A
1580NR_all_51549.1
Exact match
1PJG|1|A (1PJG)
  • 5'-R(*CP*AP*AP*AP*GP*AP*AP*AP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å14(4) 1PJG|1|A, 1PJO|1|A, 1G4Q|1|A, 1JB8|1|A
1581NR_all_51826.1
Exact match
1RNA|1|A+1RNA|1|B (1RNA)
  • RNA (5'-R(*UP*UP*AP*UP*AP*UP*AP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
2.3 Å14(1) 1RNA|1|A+1RNA|1|B
1582NR_all_55785.1
Exact match
4M59|1|C (4M59)
  • psaJ RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å14(2) 4M59|1|C, 4OE1|1|C
1583NR_all_56893.1
Exact match
3P59|1|E+3P59|1|A+3P59|1|C+3P59|1|G+ 3P59|1|B+3P59|1|D+3P59|1|F+3P59|1|H (3P59)
  • RNA (5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, E, F, G, H; model(s): 1
2.2 Å14(1) 3P59|1|E+3P59|1|A+3P59|1|C+3P59|1|G+ 3P59|1|B+3P59|1|D+3P59|1|F+3P59|1|H
1584NR_all_57733.1
Exact match
4H8K|1|C (4H8K)
  • RNA (5'-R(*CP*GP*AP*CP*AP*CP*CP*UP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å14(7) 4H8K|1|C, 2QKK|1|G, 2QKK|1|O, 2QKK|1|T, 2QKK|1|C, 2QKK|1|K, 2QKK|1|X
1585NR_all_58168.1
Exact match
synthetic construct
6AR5|1|B (6AR5)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å14(1) 6AR5|1|B
1586NR_all_60411.1
Exact match
7MSF|1|R (7MSF)
  • 5'-R(*UP*CP*GP*CP*CP*AP*AP*CP*AP*GP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å14(2) 7MSF|1|R, 7MSF|1|S
1587NR_all_61988.1
Exact match
3OG8|1|C+3OG8|1|D (3OG8)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.4 Å14(2) 3OG8|1|C+3OG8|1|D, 3LRN|1|C+3LRN|1|D
1588NR_all_66678.1
Exact match
1ROQ|1|A (1ROQ)
  • 5'-R(*GP*GP*UP*AP*UP*CP*AP*CP*GP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1ROQ|1|A
1589NR_all_68439.1
Exact match
4DB2|1|E+4DB2|1|F (4DB2)
  • 5'-R(*GP*GP*GP*CP*GP*GP*GP*CP*CP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
3.2 Å14(7) 4DB2|1|E+4DB2|1|F, 4DB2|1|I+4DB2|1|J, 4DB4|1|D, 4DB4|1|E, 4DB2|1|H+4DB2|1|G, 4DB4|1|F, 4DB4|1|C
1590NR_all_72256.1
Exact match
1KOC|1|B+1KOC|1|A (1KOC)
  • RNA (5'-R(P*AP*CP*AP*GP*GP*UP*AP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
14(1) 1KOC|1|B+1KOC|1|A
1591NR_all_73713.1
Exact match
Homo sapiens
4Z31|1|C+4Z31|1|D (4Z31)
  • RNA (5'-R(*A)-D(P*UP*GP*UP*UP*CP*UP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.5 Å14(1) 4Z31|1|C+4Z31|1|D
1592NR_all_78685.1
Exact match
4NH5|1|B (4NH5)
  • 5'-R(P*UP*UP*GP*CP*GP*AP*AP*UP*UP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å14(1) 4NH5|1|B
1593NR_all_80768.1
Exact match
synthetic construct
6AR1|1|C (6AR1)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å14(4) 6AR1|1|C, 6AR1|1|F, 6AR3|1|F, 6AR3|1|C
1594NR_all_83520.1
Exact match
1IK1|1|A (1IK1)
  • 5'-R(*GP*GP*UP*AP*CP*UP*AP*UP*GP*UP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1IK1|1|A
1595NR_all_83556.1
Exact match
2R93|1|R (2R93)
  • RNA (5'-R(*UP*GP*AP*UP*UP*CP*UP*CP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.0 Å14(1) 2R93|1|R
1596NR_all_84438.1
Exact match
1FHK|4|A (1FHK)
  • RNA (5'-R(*GP*GP*CP*GP*GP*UP*GP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
14(1) 1FHK|4|A
1597NR_all_88847.1
Exact match
Homo sapiens
4F3T|1|R (4F3T)
  • RNA (5'-R(P*UP*AP*AP*AP*GP*UP*GP*CP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.3 Å14(1) 4F3T|1|R
1598NR_all_90819.1
Exact match
413D|1|A (413D)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*UP*CP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å14(1) 413D|1|A
1599NR_all_90845.1
Exact match
1MY9|1|B (1MY9)
  • 5'-R(*GP*GP*AP*GP*GP*UP*UP*UP*UP*GP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
14(1) 1MY9|1|B
1600NR_all_91199.1
Exact match
1A3M|1|A+1A3M|1|B (1A3M)
  • 16S RRNA (5'-R(*GP*GP*CP*GP*UP*CP*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
14(1) 1A3M|1|A+1A3M|1|B
1601NR_all_91365.1
Exact match
Thermus thermophilus
4C8Z|1|C (4C8Z)
  • R1 REPEAT RNA CLEAVAGE PRODUCT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å14(1) 4C8Z|1|C
1602NR_all_92005.1
Exact match
synthetic construct
4A2X|1|L+4A2X|1|M (4A2X)
  • 5'-R(*GP*GP*GP*AP*GP*AP*AP*CP*AP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, L, M; model(s): 1
4.0 Å14(2) 4A2X|1|L+4A2X|1|M, 4A2X|1|N+4A2X|1|O
1603NR_all_93451.1
Exact match
Oryctolagus cuniculus
3J0O|1|4 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
9.0 Å14(2) 3J0O|1|4, 3J0L|1|4
1604NR_all_95531.1
Exact match
Saccharomyces cerevisiae
5WSG|1|b (5WSG)
  • 3'-exon-intron
  • ELECTRON MICROSCOPY
  • Chain(s): b; model(s): 1
4.0 Å14(1) 5WSG|1|b
1605NR_all_98018.1
Exact match
Homo sapiens
2Y95|1|A (2Y95)
  • 5'-R(*GP*GP*CP*GP*CP*AP*UP*CP*GP*GP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 2Y95|1|A
1606NR_all_99000.1
New id, no parents
synthetic construct
6OZR|1|C+6OZR|1|D (6OZR)
  • DNA/RNA (23-MER), DNA/RNA (5'-R(P*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.2 Å14(7) 6OZR|1|C+6OZR|1|D, 6OZJ|1|C+6OZJ|1|D, 6OZQ|1|C+6OZQ|1|D, 6OZN|1|C+6OZN|1|D, 6OZM|1|C+6OZM|1|D, 6OZL|1|D+6OZL|1|C, 6OZK|1|C+6OZK|1|D
1607NR_all_99184.1
Exact match
433D|1|A+433D|1|B (433D)
  • 5'-R(*GP*GP*UP*AP*UP*UP*GP*CP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.1 Å14(1) 433D|1|A+433D|1|B
1608NR_all_00844.2
Exact match
Escherichia coli
3J0E|1|C (3J0E)
  • ribosomal 23S RNA, 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
9.9 Å13(3) 3J0E|1|C, 3J0D|1|D, 1VOP|1|A
1609NR_all_08389.1
Exact match
synthetic construct
6D6R|1|N (6D6R)
  • RNA (5'-R(*AP*GP*CP*AP*CP*CP*GP*UP*AP*AP[...]
  • ELECTRON MICROSCOPY
  • Chain(s): N; model(s): 1
3.5 Å13(2) 6D6R|1|N, 6D6Q|1|N
1610NR_all_08416.1
Exact match
1QBP|1|A+1QBP|1|B (1QBP)
  • 5'-R(*UP*GP*(CBV)P*(CBV)P*AP*GP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.1 Å13(3) 1QBP|1|A+1QBP|1|B, 1QBP|1|C+1QBP|1|D, 1QBP|1|E+1QBP|1|F
1611NR_all_10277.1
Exact match
Saccharomyces cerevisiae
5YDT|1|5A (5YDT)
  • 5' ETS RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5A; model(s): 1
4.5 Å13(1) 5YDT|1|5A
1612NR_all_10796.1
Exact match
1BR3|1|A (1BR3)
  • RNA (5'-R(*GP*GP*AP*CP*AP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å13(1) 1BR3|1|A
1613NR_all_12093.1
Exact match
1TFW|1|G+1TFW|1|J (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, J; model(s): 1
2.2 Å13(1) 1TFW|1|G+1TFW|1|J
1614NR_all_12115.1
Exact match
Schizosaccharomyces pombe
6NY5|1|C (6NY5)
  • RNA (5'-R(P*UP*UP*AP*AP*UP*AP*AP*CP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å13(1) 6NY5|1|C
1615NR_all_14518.1
Exact match
1FUF|1|A+1FUF|1|B (1FUF)
  • (5'-R(*GP*GP*UP*AP*UP*UP*UP*CP*GP*GP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.7 Å13(2) 1FUF|1|A+1FUF|1|B, 1IK5|1|A+1IK5|1|B
1616NR_all_14769.1
Exact match
1I4C|1|A (1I4C)
  • RNA (5'-R(*GP*GP*UP*GP*CP*UP*UP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1I4C|1|A
1617NR_all_15462.1
Exact match
4NGG|1|B (4NGG)
  • 5'-R(*AP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å13(1) 4NGG|1|B
1618NR_all_16044.1
Exact match
1I9X|1|A+1I9X|1|B (1I9X)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*GP*UP*AP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.2 Å13(1) 1I9X|1|A+1I9X|1|B
1619NR_all_16232.1
Exact match
synthetic construct
5L00|1|A+5L00|1|B (5L00)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.3 Å13(8) 5L00|1|A+5L00|1|B, 5L00|1|C+5L00|1|D, 5KRG|1|C+5KRG|1|D, 5KRG|1|A+5KRG|1|B, 6C8O|1|A+6C8O|1|B, 5V0H|1|A+5V0H|1|B, 6C8N|1|A+6C8N|1|B, 6C8M|1|A+6C8M|1|B
1620NR_all_17852.1
Exact match
3CGR|1|B+3CGR|1|A (3CGR)
  • RNA (5'-R(*CP*GP*CP*AP*CP*UP*AP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.1 Å13(1) 3CGR|1|B+3CGR|1|A
1621NR_all_18772.1
Exact match
1I46|1|A (1I46)
  • 5'-R(*GP*GP*UP*GP*CP*GP*UP*AP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1I46|1|A
1622NR_all_19209.1
Exact match
synthetic construct
5JAJ|1|X+5JAJ|1|Y (5JAJ)
  • RNA (5'-R(P*GP*GP*UP*AP*CP*GP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, X, Y; model(s): 1
1.5 Å13(2) 5JAJ|1|X+5JAJ|1|Y, 5JB2|1|X+5JB2|1|Y
1623NR_all_22009.1
Exact match
Thermus thermophilus
2OM7|1|D (2OM7)
  • 16S ribosomal RNA (H5)
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
7.3 Å13(1) 2OM7|1|D
1624NR_all_22223.1
Exact match
3CGP|1|B+3CGP|1|A (3CGP)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.6 Å13(2) 3CGP|1|B+3CGP|1|A, 3CGQ|1|B+3CGQ|1|A
1625NR_all_26209.1
Exact match
Caenorhabditis elegans
6FQL|1|B (6FQL)
  • RNA (5'-R(*UP*GP*CP*AP*UP*UP*UP*AP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å13(1) 6FQL|1|B
1626NR_all_26402.1
Exact match
2NUG|1|E+2NUG|1|F+2NUG|1|C+2NUG|1|D (2NUG)
  • 5'-R(P*AP*GP*UP*GP*GP*CP*CP*UP*UP*GP*C)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, H; model(s): 1
1.7 Å13(1) 2NUG|1|E+2NUG|1|F+2NUG|1|C+2NUG|1|D
1627NR_all_27149.1
Exact match
Influenza B virus
6QCT|1|R+6QCT|1|M (6QCT)
  • 3 end, capped RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B, C, D, F, H, M, R; model(s): 1
3.2 Å13(1) 6QCT|1|R+6QCT|1|M
1628NR_all_28179.1
Exact match
3GTP|1|R (3GTP)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.9 Å13(1) 3GTP|1|R
1629NR_all_30874.1
Exact match
1K8S|1|A+1K8S|1|B (1K8S)
  • 5'-R(*GP*GP*CP*AP*GP*AP*GP*UP*GP*CP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, F, H; model(s): 1
13(1) 1K8S|1|A+1K8S|1|B
1630NR_all_31084.1
Exact match
4K4V|1|B (4K4V)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å13(2) 4K4V|1|B, 4K4V|1|F
1631NR_all_31288.1
Exact match
4C8Y|1|C (4C8Y)
  • R1 REPEAT RNA SUBSTRATE MIMIC
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.8 Å13(1) 4C8Y|1|C
1632NR_all_35845.1
Exact match
1LUU|1|A (1LUU)
  • 5'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG)P*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1LUU|1|A
1633NR_all_39732.1
Exact match
1ESH|1|A (1ESH)
  • RNA (5'-R(*GP*GP*UP*GP*CP*AP*UP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1ESH|1|A
1634NR_all_42919.1
Exact match
Escherichia coli
6RIN|1|R (6RIN)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.7 Å13(1) 6RIN|1|R
1635NR_all_46216.1
Exact match
3CGS|1|B+3CGS|1|A (3CGS)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, H; model(s): 1
1.7 Å13(1) 3CGS|1|B+3CGS|1|A
1636NR_all_47915.1
Exact match
3GTK|1|R (3GTK)
  • DNA/RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.8 Å13(1) 3GTK|1|R
1637NR_all_49890.1
Exact match
1NUV|1|E+1NUV|1|F (1NUV)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, H; model(s): 1
1.8 Å13(5) 1NUV|1|E+1NUV|1|F, 1NUV|1|C+1NUV|1|D, 1NUJ|1|C+1NUJ|1|D, 1NUJ|1|E+1NUJ|1|F, 429D|1|C+429D|1|D
1638NR_all_50652.1
Exact match
synthetic construct
4RBY|1|A (4RBY)
  • 5'-R(*CP*GP*CP*(2SG)P*AP*AP*UP*UP*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å13(1) 4RBY|1|A
1639NR_all_51980.1
Exact match
3AVX|1|T+3AVX|1|G (3AVX)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, T; model(s): 1
2.4 Å13(1) 3AVX|1|T+3AVX|1|G
1640NR_all_52164.1
Exact match
1HS3|1|A (1HS3)
  • 5'-R(*GP*CP*GP*UP*UP*AP*AP*UP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1HS3|1|A
1641NR_all_53884.1
Exact match
3O7V|1|A (3O7V)
  • RNA (5'-R(*GP*CP*GP*AP*AP*UP*AP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å13(3) 3O7V|1|A, 3O3I|1|A, 3O6E|1|A
1642NR_all_56203.1
Exact match
synthetic construct
5I4A|1|D (5I4A)
  • RNA (5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å13(2) 5I4A|1|D, 5I4A|1|B
1643NR_all_58575.1
Exact match
1EFS|1|B (1EFS)
  • RNA (5'-R(*UP*UP*CP*UP*CP*UP*UP*CP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
13(1) 1EFS|1|B
1644NR_all_64884.1
Exact match
2KM8|1|A (2KM8)
  • 5'-R(P*UP*AP*UP*AP*UP*AP*UP*AP*AP*UP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 2KM8|1|A
1645NR_all_65166.1
Exact match
Escherichia coli
6RI9|1|R (6RI9)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.7 Å13(2) 6RI9|1|R, 6RIP|1|R
1646NR_all_65598.1
Exact match
1TFW|1|H+1TFW|1|E (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, H; model(s): 1
2.2 Å13(2) 1TFW|1|H+1TFW|1|E, 1TFW|1|I+1TFW|1|F
1647NR_all_65794.1
Exact match
1HS1|1|A (1HS1)
  • 5'-R(*GP*CP*GP*UP*UP*AP*AP*CP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1HS1|1|A
1648NR_all_66418.1
Exact match
Caenorhabditis elegans
6FQ3|1|B (6FQ3)
  • RNA (5'-R(*GP*GP*AP*GP*UP*CP*CP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å13(1) 6FQ3|1|B
1649NR_all_69774.1
Exact match
Homo sapiens
5H1K|1|C+5H1K|1|D (5H1K)
  • U4 snRNA (5'-R(*GP*CP*AP*AP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H; model(s): 1
1.9 Å13(1) 5H1K|1|C+5H1K|1|D
1650NR_all_71246.1
Exact match
Insect cell expression vector pTIE1
5VM9|1|B (5VM9)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.3 Å13(1) 5VM9|1|B
1651NR_all_73378.1
Exact match
4NH3|1|B (4NH3)
  • 5'-R(P*UP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å13(1) 4NH3|1|B
1652NR_all_81464.1
Exact match
2GJE|1|R (2GJE)
  • guide RNA 40-mer
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å13(1) 2GJE|1|R
1653NR_all_84674.1
Exact match
1I4B|1|A (1I4B)
  • 5'-R(*GP*GP*UP*GP*CP*UP*UP*AP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1I4B|1|A
1654NR_all_87560.1
Exact match
1HS2|1|A (1HS2)
  • 5'-R(*GP*CP*GP*UP*UP*AP*AP*GP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1HS2|1|A
1655NR_all_88374.1
Exact match
Thermus thermophilus
4C9D|1|D (4C9D)
  • R3 REPEAT RNA CLEAVAGE PRODUCT
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å13(2) 4C9D|1|D, 4C9D|1|C
1656NR_all_89284.1
Exact match
synthetic construct
6JU2|1|V+6JU2|1|R (6JU2)
  • RNA (5'-R(P*AP*GP*CP*AP*UP*AP*AP*GP*CP*A[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B, C, D, F, H, R, V; model(s): 1
3.4 Å13(2) 6JU2|1|V+6JU2|1|R, 6JU3|1|V+6JU3|1|R
1657NR_all_90481.1
Exact match
1HS8|1|A (1HS8)
  • 5'-R(*GP*CP*GP*UP*CP*AP*AP*UP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1HS8|1|A
1658NR_all_90540.1
Exact match
1JZC|1|A (1JZC)
  • 5'-R(*GP*GP*UP*GP*CP*AP*UP*GP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1JZC|1|A
1659NR_all_91356.1
Exact match
1HS4|1|A (1HS4)
  • 5'-R(*GP*CP*GP*UP*UP*AP*AP*AP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1HS4|1|A
1660NR_all_95407.1
Exact match
3R1D|1|A+3R1D|1|B (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, H; model(s): 1
1.5 Å13(2) 3R1D|1|A+3R1D|1|B, 3R1D|1|C+3R1D|1|D
1661NR_all_96380.1
Exact match
Escherichia coli
2IX1|1|B (2IX1)
  • 5'-D(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP *AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å13(1) 2IX1|1|B
1662NR_all_96977.1
Exact match
3MQK|1|D+3MQK|1|E (3MQK)
  • RNA (5'-R(P*GP*UP*UP*CP*GP*AP*UP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, H; model(s): 1
2.8 Å13(1) 3MQK|1|D+3MQK|1|E
1663NR_all_97306.1
Exact match
Escherichia coli
1ELH|1|B+1ELH|1|A (1ELH)
  • RNA (5'-R(*AP*AP*CP*UP*GP*CP*CP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, F, H; model(s): 1
13(1) 1ELH|1|B+1ELH|1|A
1664NR_all_98573.1
Exact match
synthetic construct
4Z0C|1|C (4Z0C)
  • DNA (5'-R(P*AP*CP*GP*GP*AP*AP*AP*GP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å13(2) 4Z0C|1|C, 4Z0C|1|B
1665NR_all_00518.1
Exact match
synthetic construct
5I9G|1|A (5I9G)
  • RNA (5'-R(*GP*GP*G*GP*UP*UP*UP*UP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å12(1) 5I9G|1|A
1666NR_all_02622.1
Exact match
4GHA|1|I+4GHA|1|J (4GHA)
  • RNA (5'-R(*CP*UP*AP*GP*AP*CP*GP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H, I, J; model(s): 1
2.5 Å12(3) 4GHA|1|I+4GHA|1|J, 4LG2|1|E+4LG2|1|F, 4LG2|1|I+4LG2|1|J
1667NR_all_03445.1
Exact match
1QVF|1|3 (1QVF)
  • Deacylated tRNA minihelix
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
3.1 Å12(1) 1QVF|1|3
1668NR_all_03624.1
Exact match
Drosophila melanogaster
5KL1|1|C (5KL1)
  • RNA (5'-R(*AP*AP*AP*UP*UP*GP*UP*AP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.7 Å12(1) 5KL1|1|C
1669NR_all_04536.1
Exact match
Influenza B virus
5EPI|1|D (5EPI)
  • CRNA 5' END
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
4.1 Å12(6) 5EPI|1|D, 5EPI|1|H, 5EPI|1|T, 5EPI|1|P, 5EPI|1|L, 5EPI|1|X
1670NR_all_05253.1
Exact match
Canis lupus
1RY1|1|Q+1RY1|1|R (1RY1)
  • SRP RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B, C, D, F, H, Q, R; model(s): 1
12.0 Å12(1) 1RY1|1|Q+1RY1|1|R
1671NR_all_05581.1
Exact match
Escherichia coli
3DEG|1|F (3DEG)
  • 30S RNA helix 14
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
10.9 Å12(1) 3DEG|1|F
1672NR_all_06457.1
Exact match
422D|1|A+422D|1|B (422D)
  • 5'-R(*GP*AP*UP*CP*AP*CP*UP*UP*CP*GP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, H; model(s): 1
2.6 Å12(1) 422D|1|A+422D|1|B
1673NR_all_07975.1
Exact match
synthetic construct
1AL5|1|A+1AL5|1|B (1AL5)
  • RNA (5'-R(*CP*GP*CP*AP*AP*AP*UP*UP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, F, H; model(s): 1
12(1) 1AL5|1|A+1AL5|1|B
1674NR_all_09952.1
Exact match
1B7F|1|Q (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å12(1) 1B7F|1|Q
1675NR_all_11112.1
Exact match
synthetic construct
5C0W|1|R (5C0W)
  • RNA synthetic
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.6 Å12(2) 5C0W|1|R, 5C0W|1|N
1676NR_all_11791.1
Exact match
3BSU|1|D (3BSU)
  • RNA (5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å12(6) 3BSU|1|D, 3BSU|1|I, 4WKJ|1|A, 4WKJ|1|C, 4WKJ|1|G, 4WKJ|1|D
1677NR_all_12608.1
Exact match
Aquifex aeolicus
3R2D|1|R+3R2D|1|S (3R2D)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H, R, S; model(s): 1
2.2 Å12(1) 3R2D|1|R+3R2D|1|S
1678NR_all_13759.1
Exact match
synthetic construct
4EYA|1|g+4EYA|1|h (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H, g, h; model(s): 1
3.2 Å12(2) 4EYA|1|g+4EYA|1|h, 4EYA|1|s+4EYA|1|t
1679NR_all_15427.1
Exact match
2KBP|1|A (2KBP)
  • 5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
12(2) 2KBP|1|A, 2KBP|1|B
1680NR_all_15820.1
Exact match
synthetic construct
4EYA|1|e+4EYA|1|f (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H, e, f; model(s): 1
3.2 Å12(2) 4EYA|1|e+4EYA|1|f, 4EYA|1|q+4EYA|1|r
1681NR_all_17580.1
Exact match
4JRT|1|A+4JRT|1|B (4JRT)
  • RNA (5'-R(P*GP*GP*GP*UP*GP*GP*UP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, H; model(s): 1
2.6 Å12(1) 4JRT|1|A+4JRT|1|B
1682NR_all_17726.1
Exact match
2Q1R|1|A (2Q1R)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å12(2) 2Q1R|1|A, 157D|1|A+157D|1|B
1683NR_all_17854.1
Exact match
synthetic construct
5ZKJ|1|C (5ZKJ)
  • RNA (5'-R(P*CP*GP*GP*GP*AP*UP*GP*UP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å12(2) 5ZKJ|1|C, 5ZKJ|1|E
1684NR_all_19013.1
Exact match
2Z2Q|1|R (2Z2Q)
  • RNA (5'-R(*CP*CP*UP*CP*UP*UP*UP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
12(4) 2Z2Q|1|R, 2Q23|1|R, 2Q25|1|R, 2Q26|1|R
1685NR_all_19715.1
Exact match
255D|1|A (255D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*CP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å12(1) 255D|1|A
1686NR_all_20758.1
Exact match
synthetic construct
5F8J|1|B+5F8J|1|C (5F8J)
  • RNA (35-MER), RNA (5'-R(*UP*GP*UP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H; model(s): 1
2.7 Å12(4) 5F8J|1|B+5F8J|1|C, 5F8G|1|B+5F8G|1|C, 5F8H|1|B+5F8H|1|C, 5F8I|1|B+5F8I|1|C
1687NR_all_23724.1
Exact match
Oryctolagus cuniculus
3J0O|1|b (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): b; model(s): 1
9.0 Å12(2) 3J0O|1|b, 3J0L|1|b
1688NR_all_24161.1
Exact match
Spodoptera frugiperda
4KXT|1|B (4KXT)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å12(1) 4KXT|1|B
1689NR_all_24746.1
Exact match
1YYW|1|I+1YYW|1|J (1YYW)
  • 5'-R(*AP*AP*AP*UP*AP*UP*AP*UP*AP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H, I, J; model(s): 1
2.8 Å12(4) 1YYW|1|I+1YYW|1|J, 1YYW|1|E+1YYW|1|F, 1YYW|1|G+1YYW|1|H, 1YYW|1|K+1YYW|1|L
1690NR_all_26929.1
Exact match
1ZIH|2|A (1ZIH)
  • RNA (5'-R(*GP*GP*GP*CP*GP*CP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
12(1) 1ZIH|2|A
1691NR_all_28090.1
Exact match
Homo sapiens
4BS2|1|B (4BS2)
  • 5'-R(*GP*UP*GP*UP*GP*AP*AP*UP*GP*AP*AP*U[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
12(1) 4BS2|1|B
1692NR_all_28532.1
Exact match
2ATW|1|B (2ATW)
  • ribosomal RNA (5'- AGAACUCAAUAG -3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å12(2) 2ATW|1|B, 2ATW|1|D
1693NR_all_30196.1
Exact match
Tetrahymena thermophila
5C9H|1|C+5C9H|1|D (5C9H)
  • RNA (5'-R(P*UP*CP*AP*UP*UP*CP*AP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H; model(s): 1
3.0 Å12(1) 5C9H|1|C+5C9H|1|D
1694NR_all_32342.1
Exact match
2MGZ|1|C (2MGZ)
  • RNA (5'-R(*UP*GP*CP*AP*UP*GP*GP*UP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): C; model(s): 1
12(1) 2MGZ|1|C
1695NR_all_33458.1
Exact match
Homo sapiens
3MIJ|1|A (3MIJ)
  • RNA (5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å12(1) 3MIJ|1|A
1696NR_all_34288.1
Exact match
3QJL|1|R (3QJL)
  • RNA (5'-R(*GP*UP*UP*AP*CP*AP*AP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å12(2) 3QJL|1|R, 3QJL|1|X
1697NR_all_34353.1
Exact match
3QJJ|1|R (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å12(1) 3QJJ|1|R
1698NR_all_35969.1
Exact match
4NGC|1|B (4NGC)
  • 5'-R(*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å12(1) 4NGC|1|B
1699NR_all_36371.1
Exact match
283D|1|A (283D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å12(1) 283D|1|A
1700NR_all_37706.1
New id, no parents
synthetic construct
6OZP|1|C+6OZP|1|D (6OZP)
  • RNA (5'-R(P*UP*AP*UP*GP*CP*AP*UP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H; model(s): 1
2.0 Å12(2) 6OZP|1|C+6OZP|1|D, 6OZS|1|C+6OZS|1|D
1701NR_all_47507.1
Exact match
1RNG|1|A (1RNG)
  • RNA (5'-R(*GP*GP*CP*GP*CP*UP*UP*GP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
12(1) 1RNG|1|A
1702NR_all_47933.1
Exact match
4NGD|1|B (4NGD)
  • 5'-R(P*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å12(2) 4NGD|1|B, 4NGB|1|B
1703NR_all_48000.1
Exact match
3GTO|1|R (3GTO)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.0 Å12(1) 3GTO|1|R
1704NR_all_48927.1
Exact match
synthetic construct
4EYA|1|m+4EYA|1|n (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H, m, n; model(s): 1
3.2 Å12(2) 4EYA|1|m+4EYA|1|n, 4EYA|1|a+4EYA|1|b
1705NR_all_49362.3
Exact match
280D|1|A+280D|1|B (280D)
  • RNA (5'-R(*GP*GP*CP*GP*CP*UP*UP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, H; model(s): 1
2.4 Å12(2) 280D|1|A+280D|1|B, 280D|1|C+280D|1|D
1706NR_all_51584.1
Exact match
Escherichia coli
1T1M|1|A (1T1M)
  • dodecamer fragment of double helix from [...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
12.0 Å12(1) 1T1M|1|A
1707NR_all_51944.1
Exact match
4GL2|1|C+4GL2|1|D (4GL2)
  • RNA (5'-R(*AP*UP*CP*CP*GP*CP*GP*GP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H; model(s): 1
3.6 Å12(2) 4GL2|1|C+4GL2|1|D, 4GL2|1|E+4GL2|1|F
1708NR_all_52254.1
Exact match
Tetrahymena thermophila
1AJL|1|A+1AJL|1|B (1AJL)
  • RNA (5'-R(*GP*GP*UP*AP*AP*UP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, F, H; model(s): 1
12(1) 1AJL|1|A+1AJL|1|B
1709NR_all_54932.1
Exact match
2K7E|1|A+2K7E|1|B (2K7E)
  • RNA (5'-R(*GP*CP*GP*GP*UP*GP*UP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, F, H; model(s): 1
12(1) 2K7E|1|A+2K7E|1|B
1710NR_all_55371.1
Exact match
3AVW|1|T+3AVW|1|G (3AVW)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, T; model(s): 1
2.6 Å12(1) 3AVW|1|T+3AVW|1|G
1711NR_all_55496.1
Exact match
205D|1|A+205D|1|B (205D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*UP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, H; model(s): 1
2.6 Å12(1) 205D|1|A+205D|1|B
1712NR_all_56560.1
Exact match
3QJJ|1|Q (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.8 Å12(1) 3QJJ|1|Q
1713NR_all_56729.1
Exact match
1ZIG|1|A (1ZIG)
  • RNA (5'-R(*GP*GP*GP*CP*GP*AP*GP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
12(1) 1ZIG|1|A
1714NR_all_57417.1
Exact match
3HO1|1|Y (3HO1)
  • 5'-R(P*CP*CP*UP*AP*CP*UP*AP*CP*CP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.6 Å12(1) 3HO1|1|Y
1715NR_all_57473.1
Exact match
1AJT|1|A+1AJT|1|B (1AJT)
  • RNA (5'-R(*GP*GP*UP*AP*AP*UP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, F, H; model(s): 1
12(1) 1AJT|1|A+1AJT|1|B
1716NR_all_58198.1
Exact match
2R1S|1|A+2R1S|1|B (2R1S)
  • RNA (5'-R(*GP*CP*GP*UP*UP*(5BU)P*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, H; model(s): 1
1.4 Å12(4) 2R1S|1|A+2R1S|1|B, 2R22|1|A+2R22|1|B, 2R21|1|A+2R21|1|B, 2R20|1|A+2R20|1|B
1717NR_all_58977.1
Exact match
synthetic construct
4EYA|1|k+4EYA|1|l (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H, k, l; model(s): 1
3.2 Å12(2) 4EYA|1|k+4EYA|1|l, 4EYA|1|i+4EYA|1|j
1718NR_all_59512.1
Exact match
1ZIF|6|A (1ZIF)
  • RNA (5'-R(*GP*GP*GP*CP*GP*AP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
12(1) 1ZIF|6|A
1719NR_all_60222.1
Exact match
synthetic construct
5JBJ|1|X+5JBJ|1|Y (5JBJ)
  • RNA (5'-R(P*GP*GP*UP*AP*GP*CP*GP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H, X, Y; model(s): 1
3.6 Å12(1) 5JBJ|1|X+5JBJ|1|Y
1720NR_all_60450.1
Exact match
synthetic construct
3GTM|1|M (3GTM)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.8 Å12(2) 3GTM|1|M, 3GTJ|1|R
1721NR_all_61964.1
Exact match
1B7F|1|P (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å12(1) 1B7F|1|P
1722NR_all_63585.1
Exact match
1CX5|1|B (1CX5)
  • 5'-R(*GP*CP*GP*CP*AP*AP*AP*AP*CP*GP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
12(1) 1CX5|1|B
1723NR_all_63943.1
Exact match
Escherichia coli
354D|1|A+354D|1|B (354D)
  • RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, H; model(s): 1
1.5 Å12(1) 354D|1|A+354D|1|B
1724NR_all_64649.1
Exact match
2PY9|1|F (2PY9)
  • 12-mer C-rich strand of human telomeric [...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å12(2) 2PY9|1|F, 2PY9|1|E
1725NR_all_65401.1
Exact match
3IEV|1|D (3IEV)
  • 5'-R(P*AP*UP*CP*AP*CP*CP*UP*CP*CP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.9 Å12(1) 3IEV|1|D
1726NR_all_65601.1
Exact match
2F87|1|A (2F87)
  • SRP RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
12(1) 2F87|1|A
1727NR_all_71842.1
Exact match
Oryctolagus cuniculus
3J0O|1|3 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
9.0 Å12(4) 3J0O|1|3, 3J0L|1|3, 3J0Q|1|3, 3J0P|1|3
1728NR_all_72830.1
Exact match
synthetic construct
5E3H|1|B+5E3H|1|C (5E3H)
  • RNA (5'-R(*CP*GP*AP*CP*GP*CP*UP*AP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H; model(s): 1
2.7 Å12(2) 5E3H|1|B+5E3H|1|C, 6GPG|1|B+6GPG|1|C
1729NR_all_73988.1
Exact match
Saccharomyces cerevisiae
5L2L|1|D (5L2L)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.6 Å12(4) 5L2L|1|D, 5L2L|1|C, 5L2L|1|H, 5L2L|1|G
1730NR_all_74183.1
Exact match
3GTL|1|R (3GTL)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å12(1) 3GTL|1|R
1731NR_all_77812.1
Exact match
unidentified
6N8F|1|A+6N8F|1|B (6N8F)
  • RNA (5'-R(*CP*GP*CP*AP*GP*CP*UP*UP*AP*CP[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, F, H; model(s): 1
12(1) 6N8F|1|A+6N8F|1|B
1732NR_all_78714.1
Exact match
Influenza B virus
5FMZ|1|H (5FMZ)
  • 5'-R(*AP*GP*UP*AP*GP*UP*AP*AP*CP*AP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.4 Å12(2) 5FMZ|1|H, 5FMZ|1|V
1733NR_all_79282.1
Exact match
3FTM|1|D+3FTM|1|C (3FTM)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H; model(s): 1
2.7 Å12(2) 3FTM|1|D+3FTM|1|C, 3FTM|1|B+3FTM|1|A
1734NR_all_81475.1
Exact match
1SDR|1|A+1SDR|1|B (1SDR)
  • RNA (5'-R(*UP*AP*AP*GP*GP*AP*GP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, H; model(s): 1
2.6 Å12(2) 1SDR|1|A+1SDR|1|B, 1SDR|1|C+1SDR|1|D
1735NR_all_82818.1
Exact match
4KRF|1|R (4KRF)
  • RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.1 Å12(1) 4KRF|1|R
1736NR_all_83188.1
Exact match
Homo sapiens
6OON|1|B (6OON)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å12(1) 6OON|1|B
1737NR_all_83599.1
Exact match
Thermus thermophilus
2OM7|1|A (2OM7)
  • Fragment of 16S rRNA (h14)
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
7.3 Å12(1) 2OM7|1|A
1738NR_all_83722.1
Exact match
1AFX|2|A (1AFX)
  • RNA (5'-R(*GP*GP*UP*GP*UP*GP*AP*AP*CP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
12