#IFECompound(s)RNA source organismTitleMethodResolutionDate
14V9F|1|0 (rep)23S Ribosomal RNAHaloarcula marismortuiThe re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteinsX-RAY DIFFRACTION2.42014-07-09
21S72|1|023S ribosomal RNAHaloarcula marismortuiREFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTIONX-RAY DIFFRACTION2.42004-06-15
31VQO|1|023S ribosomal rnaHaloarcula marismortuiThe structure of CCPMN bound to the large ribosomal subunit haloarcula marismortuiX-RAY DIFFRACTION2.22005-11-29
43CC2|1|023S RIBOSOMAL RNAHaloarcula marismortuiThe Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-ProteinsX-RAY DIFFRACTION2.42008-05-20
51VQK|1|023S ribosomal rnaHaloarcula marismortuiThe structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32005-11-29
61VQP|1|023S ribosomal rna, 5'-R(*(DC)P*(DC)P*(PPU)*(LOF)P*(PO2)P*AP*C*C)-3'Haloarcula marismortuiThe structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.252005-11-29
73CCU|1|023S RIBOSOMAL RNAHaloarcula marismortuiStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482CX-RAY DIFFRACTION2.82008-05-20
81JJ2|1|023S RRNAHaloarcula marismortuiFully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom ResolutionX-RAY DIFFRACTION2.42001-08-01
91K73|1|A23S RRNAHaloarcula marismortuiCo-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION3.012003-07-22
101VQ6|1|023S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3'Haloarcula marismortuiThe structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.72005-11-29
113CPW|1|023S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3'Haloarcula marismortuiThe structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUIX-RAY DIFFRACTION2.72008-07-22
121VQM|1|023S ribosomal rnaHaloarcula marismortuiThe structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32005-11-29
133CC4|1|023S ribosomal RNAHaloarcula marismortuiCo-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION2.72008-05-20
143G6E|1|023S ribosomal RNAHaloarcula marismortuiCo-crystal structure of Homoharringtonine bound to the large ribosomal subunitX-RAY DIFFRACTION2.72009-04-28
151VQ4|1|023S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3')Haloarcula marismortuiThe structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.72005-11-29
161VQ8|1|023S ribosomal rna, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3'Haloarcula marismortuiThe structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.22005-11-29
171QVF|1|023S ribosomal rnaHaloarcula marismortuiStructure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION3.12003-11-11
181VQL|1|023S ribosomal rnaHaloarcula marismortuiThe structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32005-11-29
191M90|1|A23S RRNA, CCAHaloarcula marismortuiCo-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunitX-RAY DIFFRACTION2.82002-09-06
203CCM|1|023S RIBOSOMAL RNAHaloarcula marismortuiStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611UX-RAY DIFFRACTION2.552008-05-20
211VQ9|1|023S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3'Haloarcula marismortuiThe structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.42005-11-29
221YHQ|1|023S Ribosomal RNAHaloarcula marismortuiCrystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.42005-04-26
231NJI|1|A23S ribosomal RNAHaloarcula marismortuiStructure of chloramphenicol bound to the 50S ribosomal subunitX-RAY DIFFRACTION32003-07-22
241VQ7|1|023S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3')Haloarcula marismortuiThe structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.52005-11-29
251VQN|1|023S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3'Haloarcula marismortuiThe structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.42005-11-29
261YI2|1|023S Ribosomal RNAHaloarcula marismortuiCrystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.652005-04-26
273CC7|1|023S ribosomal RNAHaloarcula marismortuiStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487UX-RAY DIFFRACTION2.72008-05-20
281KQS|1|023S RRNA, CCA, CC-Pmn-pcbHaloarcula marismortuiThe Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein SynthesisX-RAY DIFFRACTION3.12002-02-22
293CXC|1|023S RIBOSOMAL RNA, 5'-R(*CP*CP*A)-3'Haloarcula marismortuiThe structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortuiX-RAY DIFFRACTION32009-04-28
301KC8|1|A23S RRNAHaloarcula marismortuiCo-crystal Structure of Blasticidin S Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION3.012003-07-22
311K9M|1|A23S RRNAHaloarcula marismortuiCo-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION32002-07-19
321VQ5|1|023S ribosomal rna, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3')Haloarcula marismortuiThe structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.62005-11-29
333OW2|1|023S RIBOSOMAL RNAHaloarcula marismortuiCrystal Structure of Enhanced Macrolide Bound to 50S Ribosomal SubunitX-RAY DIFFRACTION2.72012-06-20
343CCL|1|023S RIBOSOMAL RNAHaloarcula marismortuiStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.X-RAY DIFFRACTION2.92008-05-20
353CMA|1|023S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3')Haloarcula marismortuiThe structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.82008-09-23
361YIT|1|023S RIBOSOMAL RNAHaloarcula marismortuiCrystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.82005-04-26
373CCV|1|023S RIBOSOMAL RNAHaloarcula marismortuiStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616AX-RAY DIFFRACTION2.92008-05-20
383CCQ|1|023S RIBOSOMAL RNAHaloarcula marismortuiStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488UX-RAY DIFFRACTION2.92008-05-20
391YIJ|1|023S Ribosomal RNAHaloarcula marismortuiCrystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.62005-04-26
401YJW|1|023S RIBOSOMAL RNAHaloarcula marismortuiCrystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.92005-04-26
413G71|1|023S ribosomal RNAHaloarcula marismortuiCo-crystal structure of Bruceantin bound to the large ribosomal subunitX-RAY DIFFRACTION2.852009-04-28
421M1K|1|A23S RRNAHaloarcula marismortuiCo-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION3.22002-07-19
431N8R|1|A23S ribosomal RNAHaloarcula marismortuiStructure of large ribosomal subunit in complex with virginiamycin MX-RAY DIFFRACTION32003-07-22
441Q86|1|A23S ribosomal rna, CCA-phenylalanine-cariotic-acid-biotinHaloarcula marismortuiCrystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.X-RAY DIFFRACTION32003-10-07
451YJN|1|023S Ribosomal RNAHaloarcula marismortuiCrystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION32005-04-26
461Q82|1|A23S ribosomal rna, CC-puromycinHaloarcula marismortuiCrystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunitX-RAY DIFFRACTION2.982003-10-07
471FFK|1|023S RRNAHaloarcula marismortuiCRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTIONX-RAY DIFFRACTION2.42000-08-14
482OTL|1|023S ribosomal RNAHaloarcula marismortuiGirodazole bound to the large subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.72007-04-03
493CD6|1|023S RIBOSOMAL RNAHaloarcula marismortuiCo-cystal of large Ribosomal Subunit mutant G2616A with CC-PuromycinX-RAY DIFFRACTION2.752008-05-20
501Q81|1|A23S ribosomal rna, minihelix-puromycinHaloarcula marismortuiCrystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.X-RAY DIFFRACTION2.952003-10-07
511K8A|1|A23S RRNAHaloarcula marismortuiCo-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION32002-07-19
521YJ9|1|023S Ribosomal RNAHaloarcula marismortuiCrystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22X-RAY DIFFRACTION2.82005-04-26
533CCE|1|023S RIBOSOMAL RNAHaloarcula marismortuiStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535AX-RAY DIFFRACTION2.752008-05-20
541KD1|1|A23S RRNAHaloarcula marismortuiCo-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortuiX-RAY DIFFRACTION32002-07-19
553I55|1|023S ribosomal RNAHaloarcula marismortuiCo-crystal structure of Mycalamide A Bound to the Large Ribosomal SubunitX-RAY DIFFRACTION3.112010-03-09
563I56|1|023S ribosomal RNAHaloarcula marismortuiCo-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal SubunitX-RAY DIFFRACTION2.92010-03-09
571Q7Y|1|A23S ribosomal rnaHaloarcula marismortuiCrystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunitX-RAY DIFFRACTION3.22003-10-07
581QVG|1|023S ribosomal rna, Oligonucleotide CCAHaloarcula marismortuiStructure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.92003-11-11
592OTJ|1|023S ribosomal RNAHaloarcula marismortui13-deoxytedanolide bound to the large subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.92007-04-03
603CCS|1|023S RIBOSOMAL RNAHaloarcula marismortuiStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482AX-RAY DIFFRACTION2.952008-05-20
612QEX|1|023S ribosomal RNAHaloarcula marismortuiNegamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal SubunitX-RAY DIFFRACTION2.92008-09-30
623CME|1|050S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3')Haloarcula marismortuiThe Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula MarismortuiX-RAY DIFFRACTION2.952008-09-23
633CCR|1|023S RIBOSOMAL RNAHaloarcula marismortuiStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.X-RAY DIFFRACTION32008-05-20
641W2B|1|023S RRNAHaloarcula marismortuiTrigger Factor ribosome binding domain in complex with 50SX-RAY DIFFRACTION3.52004-09-02
653CCJ|1|023S RIBOSOMAL RNAHaloarcula marismortuiStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534UX-RAY DIFFRACTION3.32008-05-20
662QA4|1|023S RIBOSOMAL RNAHaloarcula marismortuiA more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunitX-RAY DIFFRACTION32008-04-01
673G4S|1|023S ribosomal RNAHaloarcula marismortuiCo-crystal structure of Tiamulin bound to the large ribosomal subunitX-RAY DIFFRACTION3.22009-04-28
681FG0|1|A23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'Haloarcula marismortuiLARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUNDX-RAY DIFFRACTION32000-08-28
691FFZ|1|A23S RIBOSOMAL RNAHaloarcula marismortuiLARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCINX-RAY DIFFRACTION3.22000-08-28

Release history

Release2.02.12.22.32.42.52.62.72.82.92.102.112.122.132.142.152.162.172.182.192.202.212.222.232.242.252.262.272.282.292.302.312.322.332.342.352.362.372.382.392.402.412.422.432.442.452.462.472.482.492.502.512.522.532.542.552.562.572.582.592.602.612.622.632.642.652.662.672.682.692.702.712.722.732.742.752.762.772.782.792.802.812.822.832.842.852.862.872.882.892.902.912.922.932.942.952.962.972.982.992.1002.1012.1022.1032.1042.1052.1062.1072.1082.1092.1102.1112.1122.1132.1142.1152.1162.1172.1182.1192.1202.1212.1222.1232.1242.1252.1262.1272.1282.1292.1302.1312.1322.1332.1342.1352.1362.1372.1382.1392.1402.1412.1422.1432.1442.1452.1462.1472.1482.1492.1502.1512.1522.1532.1542.1552.1562.1572.158
Date2014-12-052014-12-122014-12-192014-12-262015-01-022015-01-092015-01-162015-01-232015-01-302015-02-062015-02-132015-02-202015-02-272015-03-062015-03-132015-03-202015-03-272015-04-032015-04-102015-04-172015-04-242015-05-012015-05-082015-05-152015-05-222015-05-292015-06-052015-06-122015-06-192015-06-262015-07-032015-07-102015-07-172015-07-242015-07-312015-08-072015-08-142015-08-212015-08-282015-09-042015-09-112015-09-182015-09-252015-10-022015-10-092015-10-162015-10-232015-10-302015-11-062015-11-132015-11-202015-11-272015-12-042015-12-112015-12-182015-12-252016-01-012016-01-082016-01-152016-01-222016-01-292016-02-052016-02-122016-02-192016-02-262016-03-042016-03-112016-03-182016-03-252016-04-012016-04-082016-04-152016-04-222016-04-292016-05-062016-05-132016-05-202016-05-272016-06-032016-06-102016-06-172016-06-242016-07-012016-07-082016-07-152016-07-222016-07-292016-08-052016-08-122016-08-192016-08-262016-09-022016-09-092016-09-162016-09-232016-09-302016-10-072016-10-142016-10-212016-10-282016-11-042016-11-112016-11-182016-11-252016-12-022016-12-092016-12-162016-12-232016-12-302017-01-062017-01-132017-01-202017-01-272017-02-032017-02-102017-02-172017-02-242017-03-032017-03-102017-03-172017-03-242017-03-312017-04-112017-04-152017-04-262017-04-292017-05-092017-05-152017-05-202017-05-272017-06-072017-06-112017-06-212017-06-242017-06-282017-07-042017-07-102017-07-152017-07-262017-07-312017-08-052017-08-122017-08-192017-08-262017-09-032017-09-092017-09-162017-09-232017-09-302017-10-072017-10-142017-10-212017-10-282017-11-032017-11-102017-11-172017-11-242017-12-012017-12-08

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5

#S - ordering by similarity (same as in the heat map).
#SPDBTitleMethodResolutionLength
12QEX|1|0Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal SubunitX-RAY DIFFRACTION2.92749
21FFZ|1|ALARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCINX-RAY DIFFRACTION3.2496
32QA4|1|0A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunitX-RAY DIFFRACTION32749
43CD6|1|0Co-cystal of large Ribosomal Subunit mutant G2616A with CC-PuromycinX-RAY DIFFRACTION2.752749
53CCS|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482AX-RAY DIFFRACTION2.952749
63CCR|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.X-RAY DIFFRACTION32749
73CCJ|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534UX-RAY DIFFRACTION3.32749
83G4S|1|0Co-crystal structure of Tiamulin bound to the large ribosomal subunitX-RAY DIFFRACTION3.22749
93I55|1|0Co-crystal structure of Mycalamide A Bound to the Large Ribosomal SubunitX-RAY DIFFRACTION3.112749
103CCV|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616AX-RAY DIFFRACTION2.92749
113CCE|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535AX-RAY DIFFRACTION2.752749
123CCU|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482CX-RAY DIFFRACTION2.82749
133CCQ|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488UX-RAY DIFFRACTION2.92749
143CCL|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.X-RAY DIFFRACTION2.92749
153CC7|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487UX-RAY DIFFRACTION2.72749
163G71|1|0Co-crystal structure of Bruceantin bound to the large ribosomal subunitX-RAY DIFFRACTION2.852749
171YJN|1|0Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION32749
183I56|1|0Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal SubunitX-RAY DIFFRACTION2.92749
191YJ9|1|0Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22X-RAY DIFFRACTION2.82750
202OTL|1|0Girodazole bound to the large subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.72749
213CXC|1|0The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortuiX-RAY DIFFRACTION32754
221VQ4|1|0The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.72749
231VQ5|1|0The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.62749
241VQ7|1|0The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.52749
251Q86|1|ACrystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.X-RAY DIFFRACTION32754
261VQ6|1|0The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.72749
271QVG|1|0Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.92754
281Q7Y|1|ACrystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunitX-RAY DIFFRACTION3.22754
291Q81|1|ACrystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.X-RAY DIFFRACTION2.952754
301M1K|1|ACo-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION3.22754
311QVF|1|0Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION3.12754
321S72|1|0REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTIONX-RAY DIFFRACTION2.42749
331JJ2|1|0Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom ResolutionX-RAY DIFFRACTION2.42754
341K73|1|ACo-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION3.012754
351NJI|1|AStructure of chloramphenicol bound to the 50S ribosomal subunitX-RAY DIFFRACTION32754
361M90|1|ACo-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunitX-RAY DIFFRACTION2.82754
371K9M|1|ACo-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION32754
381KD1|1|ACo-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortuiX-RAY DIFFRACTION32754
391K8A|1|ACo-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION32754
401KC8|1|ACo-crystal Structure of Blasticidin S Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION3.012754
411Q82|1|ACrystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunitX-RAY DIFFRACTION2.982754
421N8R|1|AStructure of large ribosomal subunit in complex with virginiamycin MX-RAY DIFFRACTION32754
431KQS|1|0The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein SynthesisX-RAY DIFFRACTION3.12754
441YI2|1|0Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.652749
451YIJ|1|0Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.62749
461YIT|1|0Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.82749
471YJW|1|0Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.92749
482OTJ|1|013-deoxytedanolide bound to the large subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.92749
493G6E|1|0Co-crystal structure of Homoharringtonine bound to the large ribosomal subunitX-RAY DIFFRACTION2.72749
503CC4|1|0Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION2.72749
513CC2|1|0The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-ProteinsX-RAY DIFFRACTION2.42749
521YHQ|1|0Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.42749
533CPW|1|0The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUIX-RAY DIFFRACTION2.72754
543CCM|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611UX-RAY DIFFRACTION2.552749
551VQO|1|0The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortuiX-RAY DIFFRACTION2.22749
561VQK|1|0The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32749
571VQN|1|0The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.42749
581VQP|1|0The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.252749
591VQL|1|0The structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32749
601VQM|1|0The structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32749
611VQ8|1|0The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.22749
621VQ9|1|0The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.42749
633CMA|1|0The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.82749
643CME|1|0The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula MarismortuiX-RAY DIFFRACTION2.952749
653OW2|1|0Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal SubunitX-RAY DIFFRACTION2.72754
661W2B|1|0Trigger Factor ribosome binding domain in complex with 50SX-RAY DIFFRACTION3.52754
671FFK|1|0CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTIONX-RAY DIFFRACTION2.42706
681FG0|1|ALARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUNDX-RAY DIFFRACTION3496
694V9F|1|0The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteinsX-RAY DIFFRACTION2.42803