#IFECompound(s)RNA source organismTitleMethodResolutionDate
11QWA|1|A (rep)18S ribosomal RNA, 5'ETSNMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.SOLUTION NMR2003-11-25

Release history

Release2.932.942.952.962.972.982.992.1002.1012.1022.1032.1042.1052.1062.1072.1082.1092.1102.1112.1122.1132.1142.1152.1162.1172.1182.1192.1202.1212.1222.1232.1242.1252.1262.1272.1282.1292.1302.1312.1322.1332.1342.1352.1362.1372.1382.1392.1402.1412.1422.1432.1442.1452.1462.1472.1482.1492.1502.1512.1522.1532.1542.1552.1562.1572.1583.03.13.23.33.43.53.63.73.83.93.103.113.123.133.143.153.163.173.183.193.203.213.223.233.243.253.263.273.283.293.303.313.323.333.343.353.363.373.383.393.403.413.423.433.443.453.463.473.483.493.503.513.523.533.543.553.563.573.583.593.603.613.623.633.643.653.663.673.683.693.703.713.723.733.743.753.763.773.783.793.803.813.823.833.843.853.863.873.883.893.903.913.923.933.943.953.963.973.983.993.1003.101
Date2016-09-162016-09-232016-09-302016-10-072016-10-142016-10-212016-10-282016-11-042016-11-112016-11-182016-11-252016-12-022016-12-092016-12-162016-12-232016-12-302017-01-062017-01-132017-01-202017-01-272017-02-032017-02-102017-02-172017-02-242017-03-032017-03-102017-03-172017-03-242017-03-312017-04-112017-04-152017-04-262017-04-292017-05-092017-05-152017-05-202017-05-272017-06-072017-06-112017-06-212017-06-242017-06-282017-07-042017-07-102017-07-152017-07-262017-07-312017-08-052017-08-122017-08-192017-08-262017-09-032017-09-092017-09-162017-09-232017-09-302017-10-072017-10-142017-10-212017-10-282017-11-032017-11-102017-11-172017-11-242017-12-012017-12-082017-12-152017-12-222017-12-292018-01-052018-01-122018-01-192018-01-262018-02-022018-02-092018-02-162018-02-232018-03-012018-03-082018-03-152018-03-222018-03-292018-04-062018-04-132018-04-202018-04-272018-05-042018-05-112018-05-182018-05-252018-06-012018-06-082018-06-152018-06-222018-06-292018-07-062018-07-132018-07-202018-07-272018-08-032018-08-102018-08-172018-08-242018-08-312018-09-072018-09-142018-09-212018-09-282018-10-052018-10-122018-10-192018-10-262018-11-022018-11-092018-11-162018-11-232018-11-302018-12-072018-12-142018-12-212018-12-282019-01-042019-01-112019-01-182019-01-252019-02-012019-02-082019-02-152019-02-222019-03-012019-03-082019-03-152019-03-222019-03-292019-04-052019-04-122019-04-192019-04-262019-05-032019-05-102019-05-172019-05-242019-05-312019-06-072019-06-142019-06-212019-06-282019-07-052019-07-122019-07-192019-07-262019-08-022019-08-092019-08-162019-08-232019-08-282019-09-042019-09-112019-09-192019-09-252019-10-032019-10-092019-10-162019-10-232019-10-302019-11-062019-11-132019-11-20

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent
NR_all_52004.1NR_all_70966.12.93(1) 1QWA|1|A(0) (1) 1RKJ|1|B

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5

#S - ordering by similarity (same as in the heat map).
#SPDBTitleMethodResolutionLength
11QWA|1|ANMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.SOLUTION NMR21