| Column number: Node in JAR3D model: Insertion positions indicated by I: Position in motif group: | 1 1 I | 2 2 1 | 3 2 I | 4 3 2 | 5 3 I | 6 3 3 | 7 3 I | 8 3 4 | 9 3 I | 10 3 5 | 11 3 I | 12 3 6 | 13 3 I | 14 3 7 | 15 3 I | 16 3 8 | 17 3 I | 18 3 9 | 19 3 I | 20 3 10 | 21 3 I | 22 3 | 23 4 I | 24 5 11 | 25 4 I | 26 3 12 | 27 3 I | 28 3 13 | 29 3 I | 30 3 14 | 31 3 I | 32 3 15 | 33 3 I | 34 3 16 | 35 3 I | 36 3 17 | 37 3 I | 38 3 18 | 39 3 I | 40 3 19 | 41 3 I | 42 3 20 | 43 3 I | 44 3 21 | 45 2 I | 46 2 22 | 47 1 I | In acceptance region | Cutoff score | Full edit distance | Interior edit distance | Alignment score deficit |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| HL_46465.1_Instance_1 HL_46465.1_HL_6E8S_001_A8_U31 | A | G | G | A | A | G | G | A | U | U | G | G | U | A | U | G | U | G | G | U | A | U | A | U | ||||||||||||||||||||||||||||
| HL_46465.1_Sequence_1 HL_46465.1_HL_6E8S_001_A8_U31 | A | G | G | A | A | G | G | A | U | U | G | G | U | A | U | G | U | G | G | U | A | U | A | U | true | 96 | 0 | 0 | 0.98 | |||||||||||||||||||||||
| HL_46465.1_Instance_2 HL_46465.1_HL_6E8T_001_A7_U30 | A | G | G | A | A | G | G | U | U | U | G | G | U | A | U | G | U | G | G | U | A | U | A | U | ||||||||||||||||||||||||||||
| HL_46465.1_Sequence_2 HL_46465.1_HL_6E8T_001_A7_U30 | A | G | G | A | A | G | G | U | U | U | G | G | U | A | U | G | U | G | G | U | A | U | A | U | true | 100 | 0 | 0 | 0.00 |
1 15 s33 1 22 cWW 2 3 s35 2 4 s53 2 5 cWH 2 14 s35 2 15 s55 2 16 cHW 3 5 s53 3 6 cWH 3 14 cHW 4 5 s35 5 6 s35 5 9 cWH 6 8 perp 6 9 s53 6 10 cWH 7 8 perp 7 13 tWW 9 10 s35 9 16 cWH 9 21 s55 10 14 cWH 11 12 s35 11 18 tWW 11 19 s35 12 17 s35 12 18 s53 12 19 tHH 14 16 s53 15 16 s55 15 21 tSW 16 17 s33 16 21 s55 17 20 cSH 19 20 s35 21 22 s35 12 19 6BPh 6 8 2BR 16 15 2BR 21 16 7BRJAR3D SCFG/MRF model for HL_46465.1:
Character Definition | A,C,G,U,* // Define characters here InitialNode | Left Length Distribution [0.999900000,0.000100000] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.999900000,0.000100000] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [1] | Right Index [22] // Initial node A8 - U31 from junction BasepairNode | Deletion Probability [0.0000229437914523] | Pair Probability [[0.009282926,0.022010543,0.009914366,0.223723012,0.000000000],[0.017518170,0.009580259,0.194165974,0.010358839,0.000000000],[0.009895067,0.196683142,0.002041152,0.053213779,0.000000000],[0.196023621,0.011028161,0.023012614,0.011548375,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] | Left Length Distribution [0.991950402,0.007999600,0.000049998] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.991950402,0.007999600,0.000049998] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [1] | Right Index [22] // Basepair A8 - U31 cWW ClusterNode | Deletion Probability [0.000000000000000000000000000000000000000000000000002324854825] | Num Left Bases [10] | Num Right Bases [10] | Left Index [2] | Right Index [21] | Norm Constant [0.021746083431234] // Cluster node G9:U20 and A21:A30 Interaction | Interacting Bases [6,12] | Pair Probability [[0.021092272,0.036425574,0.004478161,0.208014926,0.000000000],[0.031991796,0.034671284,0.016991909,0.034459906,0.000000000],[0.004478161,0.017978475,0.021445131,0.163657287,0.000000000],[0.043876651,0.031832799,0.038700931,0.289904738,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction A15 - U22 tWW Interaction | Interacting Bases [2,13] | Pair Probability [[0.004917740,0.004917740,0.204479002,0.016996810,0.000000000],[0.004917740,0.052126028,0.004917740,0.004917740,0.000000000],[0.050576271,0.004917740,0.511381834,0.015383823,0.000000000],[0.041662297,0.017736492,0.004917740,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction G10 - G23 cHW Interaction | Interacting Bases [9,13] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction G19 - G23 cWH Interaction | Interacting Bases [1,15] | Pair Probability [[0.001267184,0.001267184,0.263446768,0.004379672,0.000000000],[0.001267184,0.013431632,0.006335920,0.001267184,0.000000000],[0.013032297,0.001267184,0.653199885,0.003964044,0.000000000],[0.010735378,0.004570270,0.006335920,0.014232292,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction G9 - G25 cHW Interaction | Interacting Bases [8,15] | Pair Probability [[0.001492205,0.001492205,0.076732572,0.012641719,0.000000000],[0.001492205,0.015816762,0.007461025,0.005381839,0.000000000],[0.062045696,0.001492205,0.765710357,0.001492205,0.000000000],[0.005157395,0.001492205,0.023339805,0.016759600,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction G18 - G25 cWH Interaction | Interacting Bases [10,17] | Pair Probability [[0.024978059,0.030331969,0.005356900,0.036479807,0.000000000],[0.047086784,0.030567281,0.018993974,0.027347187,0.000000000],[0.005356900,0.018115093,0.025662695,0.038984076,0.000000000],[0.046635242,0.029148575,0.059657587,0.555297871,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction U20 - U27 tWW Interaction | Interacting Bases [1,4] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction G9 - G13 cWH Interaction | Interacting Bases [2,5] | Pair Probability [[0.001492205,0.001492205,0.076732572,0.012641719,0.000000000],[0.001492205,0.015816762,0.007461025,0.005381839,0.000000000],[0.062045696,0.001492205,0.765710357,0.001492205,0.000000000],[0.005157395,0.001492205,0.023339805,0.016759600,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction G10 - G14 cWH Interaction | Interacting Bases [4,8] | Pair Probability [[0.004917740,0.004917740,0.050576271,0.041662297,0.000000000],[0.004917740,0.052126028,0.004917740,0.017736492,0.000000000],[0.204479002,0.004917740,0.511381834,0.004917740,0.000000000],[0.016996810,0.004917740,0.015383823,0.055233263,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction G13 - G18 cWH Interaction | Interacting Bases [5,9] | Pair Probability [[0.001267184,0.001267184,0.013032297,0.010735378,0.000000000],[0.001267184,0.013431632,0.001267184,0.004570270,0.000000000],[0.263446768,0.006335920,0.653199885,0.006335920,0.000000000],[0.004379672,0.001267184,0.003964044,0.014232292,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction G14 - G19 cWH Interaction | Interacting Bases [11,18] | Pair Probability [[0.431873884,0.331200569,0.019765828,0.020165858,0.000000000],[0.051813191,0.000588951,0.050208540,0.005596268,0.000000000],[0.002936349,0.049566880,0.001470022,0.000588951,0.000000000],[0.004000200,0.029046605,0.000588951,0.000588951,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction A21 - A28 tHH Interaction | Interacting Bases [16,19] | Pair Probability [[0.079296878,0.080799881,0.004442628,0.078964610,0.000000000],[0.059200300,0.089215891,0.000983673,0.079130149,0.000000000],[0.069281848,0.000983673,0.084512044,0.117975163,0.000000000],[0.080527243,0.080043827,0.000983673,0.093658519,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction G26 - U29 cSH Interaction | Interacting Bases [14,20] | Pair Probability [[0.233349860,0.004938038,0.000525442,0.002449099,0.000000000],[0.233744771,0.002515764,0.000525442,0.002092228,0.000000000],[0.227358206,0.000525442,0.000525442,0.001662399,0.000000000],[0.282328755,0.002403502,0.002606074,0.002449536,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Cluster Interaction U24 - A30 tSW Interaction | Interacting Bases [3,3] | Pair Probability [[0.625000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.125000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.125000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Left strand conserved insertion A12 Interaction | Interacting Bases [7,7] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.125000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.625000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Left strand conserved insertion U17 Insertion | Location [2] | Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.625000000,0.125000000,0.125000000,0.125000000,0.000000000]// Insertion after nucleotide 3, position 2 in cluster node Insertion | Location [6] | Length Distribution [0.023781213,0.951248514,0.023781213,0.001189061] | Letter Distribution [0.125000000,0.125000000,0.125000000,0.625000000,0.000000000]// Insertion after nucleotide 7, position 6 in cluster node InitialNode | Left Length Distribution [0.999900000,0.000100000] | Left Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Right Length Distribution [0.999900000,0.000100000] | Right Letter Distribution [0.250000000,0.250000000,0.250000000,0.250000000,0.000000000] | Left Index [12] | Right Index [11] // New Initial node after Cluster HairpinNode | Num Bases [1] | Left Index [11] | Right Index [11] | Norm Constant [1.000000000000000] // Hairpin node U20:U20 Interaction | Interacting Bases [1,1] | Pair Probability [[0.125000000,0.000000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.125000000,0.000000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.125000000,0.000000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.625000000,0.000000000],[0.000000000,0.000000000,0.000000000,0.000000000,0.000000000]] // Hairpin conserved non-basepairing position U20Sequences of instances from HL_46465.1:
> HL_46465.1 HL_6E8S_001 A 8 U 31 AGGAAGGAUUGGUAUGUGGUAUAU > HL_46465.1 HL_6E8T_001 A 7 U 30 AGGAAGGUUUGGUAUGUGGUAUAU