Motif IL_02957.1 Version IL_02957.1 of this group appears in releases 0.6 to 1.18
| #S | Loop id | PDB | Disc | #Non-core | Annotation | Chain(s) | Standardized name | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | break | 22 | 23 | 24 | 25 | 26 | 1-26 | 2-15 | 3-14 | 3-18 | 4-13 | 12-19 | 15-16 | 20-23 | 21-22 | ||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | IL_3U5H_150 | 3U5H | 0 | 0 | 8 | 5.8S rRNA | A | 44 | C | 45 | G | 46 | C | 47 | A | 48 | G | 49 | C | 50 | G | 51 | A | 52 | A | 53 | A | 54 | U | 55 | G | 56 | C | 57 | G | 58 | A | 59 | U | 60 | A | 61 | C | 62 | G | 63 | U | 64 | * | A | 96 | A | 97 | U | 98 | C | 99 | U | 100 | cWW | cWW | cWW | tsS | cWW | cWW | ncSs | cWW | cWW |
3D structures
Complete motif including flanking bases
| Sequence | Counts |
|---|---|
| ACGCAGCGAAAUGCGAUACGU*AAUCU | 1 |
Non-Watson-Crick part of the motif
| Sequence | Counts |
|---|---|
| CGCAGCGAAAUGCGAUACG*AUC | 1 |
Release history
| Release | 0.6 | 0.7 | 0.8 | 0.9 | 0.10 | 0.11 | 0.12 | 1.0 | 1.1 | 1.2 | 1.3 | 1.4 | 1.5 | 1.6 | 1.7 | 1.8 | 1.9 | 1.10 | 1.11 | 1.12 | 1.13 | 1.14 | 1.15 | 1.17 | 1.18 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Date | 2012-04-02 | 2013-02-17 | 2013-02-17 | 2013-02-17 | 2013-02-17 | 2013-02-17 | 2013-02-17 | 2013-03-04 | 2013-04-08 | 2013-05-04 | 2013-06-01 | 2013-07-01 | 2013-08-03 | 2013-08-31 | 2013-09-28 | 2013-11-05 | 2013-12-07 | 2014-01-04 | 2014-02-01 | 2014-03-01 | 2014-03-29 | 2014-04-27 | 2014-06-20 | 2014-09-04 | 2014-10-07 |
| Status | New id, no parents | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
- Basepair signature
- cWW-R-R-cWW-tSS-cWW-cWW-L-L-L-L-L-L-L-cWW-cSS-cSS-L-cWW-cWW
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: