Motif IL_52610.1 Version IL_52610.1 of this group appears in releases 1.1 to 2.0
#S | Loop id | PDB | Disc | #Non-core | Chain(s) | Standardized name | 1 | 2 | 3 | 4 | 5 | 6 | 7 | break | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | 32 | 33 | 34 | 35 | 36 | 1-17 | 1-36 | 2-35 | 3-13 | 7-8 | 14-18 | 17-36 | 19-34 | 22-33 | 24-32 | 25-30 | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | IL_4IOA_040 | 4IOA | 0 | 1 | X | LSU rRNA | G | 1066 | G | 1067 | A | 1068 | G | 1069 | G | 1070 | U | 1071 | G | 1073 | * | C | 1087 | A | 1088 | C | 1089 | C | 1090 | C | 1091 | U | 1092 | U | 1093 | C | 1094 | A | 1095 | A | 1096 | A | 1097 | G | 1098 | A | 1099 | G | 1100 | U | 1101 | G | 1102 | C | 1103 | G | 1104 | U | 1105 | A | 1106 | A | 1107 | U | 1108 | A | 1109 | G | 1110 | C | 1111 | U | 1112 | C | 1113 | A | 1114 | C | 1115 | ntsS | cWW | tSH | ncWW | cWW | ntWW | cSs | cWW | cWw | cwW | tSH |
3D structures
Complete motif including flanking bases
Sequence | Counts |
---|---|
GGAGGUUG*CACCCUUCAAAGAGUGCGUAAUAGCUCAC | 1 |
Non-Watson-Crick part of the motif
Sequence | Counts |
---|---|
GAGGUU*ACCCUUCAAAGAGUGCGUAAUAGCUCA | 1 |
Release history
Release | 1.1 | 1.2 | 1.3 | 1.4 | 1.5 | 1.6 | 1.7 | 1.8 | 1.9 | 1.10 | 1.11 | 1.12 | 1.13 | 1.14 | 1.15 | 1.17 | 1.18 | 2.0 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Date | 2013-04-08 | 2013-05-04 | 2013-06-01 | 2013-07-01 | 2013-08-03 | 2013-08-31 | 2013-09-28 | 2013-11-05 | 2013-12-07 | 2014-01-04 | 2014-02-01 | 2014-03-01 | 2014-03-29 | 2014-04-27 | 2014-06-20 | 2014-09-04 | 2014-10-07 | 2017-04-24 |
Status | New id, no parents | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
-
- (1)
- Basepair signature
- cWW-tSS-tSH-L-L-L-L-cWW-L-L-L-L-L-L-L-L-cSS-L-L-L-cSW-cWW-L-cWW-R-tSH-R-R-R-R
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: