Motif J3_33327.1 Version J3_33327.1 of this group appears in releases 3.88 to 4.7
| #S | Loop id | PDB | Disc | #Non-core | Chain(s) | Standardized name for chain | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | break | 18 | 19 | 20 | 21 | 22 | break | 23 | 24 | 25 | 26 | 1-26 | 2-25 | 3-24 | 6-16 | 7-15 | 13-20 | 17-18 | 22-23 | ||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | J3_7KJT_001 | 7KJT | 0.0000 | 6 | A | tRNA | C | 5 | G | 6 | U | 7 | A | 8 | G | 9 | C | 10 | U | 11 | C | 12 | A | 13 | G | 14 | U | 15 | A | 21 | G | 22 | A | 23 | G | 24 | C | 25 | G | 26 | * | U | 44 | G | 45 | G | 46 | C | 48 | G | 49 | * | U | 65 | C | 66 | G | 67 | G | 68 | cWW | ncwW | ncWW | ncBW | ncWW | tHW | cWW | cWW |
3D structures
Complete motif including flanking bases
| Sequence | Counts |
|---|---|
| CGUAGCUCAGUCUGGCAGAGCG*UGGUCG*UCGG | 1 |
Non-Watson-Crick part of the motif
| Sequence | Counts |
|---|---|
| GUAGCUCAGUCUGGCAGAGC*GGUC*CG | 1 |
Release history
| Release | 3.88 | 3.89 | 3.90 | 3.91 | 3.92 | 3.93 | 3.94 | 3.95 | 3.96 | 3.97 | 3.98 | 3.99 | 4.0 | 4.1 | 4.2 | 4.3 | 4.4 | 4.5 | 4.6 | 4.7 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Date | 2024-09-11 | 2024-10-09 | 2024-11-06 | 2024-12-04 | 2025-01-01 | 2025-01-29 | 2025-02-26 | 2025-03-26 | 2025-04-23 | 2025-05-21 | 2025-06-18 | 2025-07-16 | 2025-08-13 | 2025-09-10 | 2025-10-08 | 2025-11-05 | 2025-12-03 | 2025-12-31 | 2026-01-28 | 2026-02-25 |
| Status | New id, no parents | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
-
- (1)
- Basepair signature
- cWW-F-F-F-F-F-cWW-F-F-F-F-tHW-F-F-F-cWW-F-F-F-F-F-F
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: