Motif J3_46317.4 Version J3_46317.4 of this group appears in releases 3.96 to 3.97

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name		1		2		3		4		5		6		7	break		8		9		10		11		12		13		14		15		16	break		17		18		19	1-19	2-10	4-11	4-14	5-9	5-11	5-14	6-9	7-8	15-18	16-17
1	J3_4LFB_014	4LFB	0.7959	0	A	SSU rRNA	G	46	C	47	C	48	U	49	A	50	A	51	G	52	*	U	359	A	360	G	361	G	362	A	363	A	364	U	365	C	366	U	367	*	A	393	G	394	C	395	cWW	cWW	cWS	tHW					cWW	cSW	cWW
2	J3_5J7L_050	5J7L	0.7919	0	AA	SSU rRNA	G	46	C	47	C	48	U	49	A	50	A	51	C	52	*	G	359	G	360	G	361	G	362	A	363	A	364	U	365	A	366	U	367	*	A	393	G	394	C	395	cWW	cWW	cWS	tHW	ntSs				cWW	cSW	cWW
3	J3_8CRE_072	8CRE	0.0000	1	CM	SSU rRNA	A	41	G	42	A	43	U	44	U	45	A	46	G	48	*	C	429	G	430	C	431	G	432	C	433	A	434	A	435	A	436	U	437	*	A	462	G	463	U	464	cWW	cWW				ncWS	tHH	tSs	cWW	cSW	cWW
4	J3_8P9A_069	8P9A	0.0569	1	sR	SSU rRNA	A	41	G	42	A	43	U	44	U	45	A	46	G	48	*	C	431	G	432	C	433	G	434	C	435	A	436	A	437	A	438	U	439	*	A	464	G	465	U	466	cWW	cWW				ncWS	tHH	ntSs	cWW	cSW	cWW

3D structures

Complete motif including flanking bases

Sequence	Counts
AGAUUAAGCGCGCAAAUAGU	2
GCCUAAGUAGGAAUCUAGC	1
GCCUAACGGGGAAUAUAGC	1

Non-Watson-Crick part of the motif

Sequence	Counts
GAUUAAGCGCAAAG	2
CCUAAAGGAAUCG	1
CCUAAGGGAAUAG	1

Release history

Release	3.96	3.97
Date	2025-04-23	2025-05-21
Status	Updated, 1 parent	Exact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (4)
Basepair signature: cWW-cWW-cSW-F-cWW-F-F-F-F-cWW-F-F-F-F
Heat map statistics: Min 0.06 | Avg 0.42 | Max 0.80

Help

Coloring options: Nucleotide numbers

Copyright 2025 BGSU RNA group. Page generated in 0.1147 s