Motif J3_97456.1 Version J3_97456.1 of this group appears in releases 4.0 to 4.7

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name for chain		1		2		3		4		5	break		6		7		8		9		10		11		12		13		14	break		15		16		17		18		19		20	1-20	2-19	3-9	3-16	4-8	5-6	9-12	11-17	13-16	14-15
1	J3_8OI5_003	8OI5	0.0000	1	1	LSU rRNA	C	184	U	185	A	186	U	187	G	188	*	C	204	G	205	U	206	C	207	A	208	A	210	G	211	A	212	G	213	*	C	225	G	226	U	227	G	228	C	229	G	230	cWW	ncWW	ncsS	cHH	cSs	cWW	cWW	cSW	tHS	cWW
2	J3_8P9A_044	8P9A	0.1026	1	AR	LSU rRNA	C	185	U	186	A	187	U	188	G	189	*	C	205	G	206	U	207	C	208	A	209	A	211	G	212	A	213	G	214	*	C	226	G	227	U	228	G	229	U	230	G	231	cWW	cwW			ncSs	cWW	cWW	cSW	tHS	cWW

3D structures

Complete motif including flanking bases

Sequence	Counts
CUAUGCGUCACAGAGCGUGCG	1
CUAUGCGUCAUAGAGCGUGUG	1

Non-Watson-Crick part of the motif

Sequence	Counts
UAUGUCACAGAGUGC	1
UAUGUCAUAGAGUGU	1

Release history

Release	4.0	4.1	4.2	4.3	4.4	4.5	4.6	4.7
Date	2025-08-13	2025-09-10	2025-10-08	2025-11-05	2025-12-03	2025-12-31	2026-01-28	2026-02-25
Status	New id, 1 parent	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (2)
Basepair signature: cWW-cWW-F-F-cSS-cSW-cWW-tHS-cWW-F-cWW-F
Heat map statistics: Min 0.10 | Avg 0.05 | Max 0.10

Help

Coloring options: Nucleotide numbers

Copyright 2026 BGSU RNA group. Page generated in 0.1482 s