#SLoop idPDBDisc#Non-coreChain(s)Standardized name 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20break 21 22 23break 24 25 26 27break 28 291-292-82-143-64-185-176-168-1318-2220-2123-2427-28
1 J4_4WSM_0304WSM0.000021K tRNAG7U8G9G10U11G12G13A14A15U16G19U20A21G22A23C24A25C26G27C28*G44U45G46*C57U58U59A60*U76C77ncWWntWHntWScWHncWSncWWncWWncWwncWWcWWcWWcWW

3D structures

Complete motif including flanking bases
SequenceCounts
GUGGUGGAAUUGGUAGACACGC*GUG*CUUA*UC1
Non-Watson-Crick part of the motif
SequenceCounts
UGGUGGAAUUGGUAGACACG*U*UU*1

Release history

Release3.23.33.43.53.63.73.83.93.103.113.123.133.143.153.163.173.183.193.203.213.223.233.243.253.263.273.283.293.303.313.323.333.343.353.363.373.383.393.403.413.423.433.443.453.463.473.483.493.503.513.523.533.543.553.563.573.583.593.603.613.623.633.643.653.663.673.683.693.703.713.723.733.743.753.763.773.783.793.803.813.823.833.843.853.863.873.883.893.903.913.923.933.943.953.963.97
Date2018-02-092018-03-082018-04-062018-05-042018-06-012018-06-292018-07-272018-08-242018-09-212018-10-192018-11-162018-12-142019-01-112019-02-082019-03-082019-04-052019-05-032019-05-312019-06-282019-07-262019-08-232019-09-192019-10-162019-11-132019-12-112020-01-082020-02-052020-03-042020-04-012020-04-292020-05-272020-06-242020-07-222020-08-192020-09-162020-10-142020-11-112020-12-092021-01-062021-02-032021-03-032021-03-312021-04-282021-05-262021-06-232021-07-212021-08-182021-09-152021-10-132021-11-102021-12-082022-01-052022-02-022022-03-022022-03-302022-04-272022-05-252022-06-222022-07-202022-08-172022-09-142022-10-122022-11-092022-12-072023-01-042023-02-012023-03-012023-03-292023-04-262023-05-242023-06-212023-07-192023-08-162023-09-132023-10-112023-11-082023-12-062024-01-032024-01-312024-02-282024-03-272024-04-242024-05-222024-06-192024-07-172024-08-142024-09-112024-10-092024-11-062024-12-042025-01-012025-01-292025-02-262025-03-262025-04-232025-05-21
StatusNew id, no parentsExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.
Annotations
  • (1)
  • Basepair signature
    cWW-F-F-F-cWH-F-F-F-F-cWW-F-F-F-F-cWW-F-F-F-F-F-F-F-F-F-F
    Heat map statistics
    Min 0.00 | Avg 0.00 | Max 0.00
    Help

    Coloring options:

    Copyright 2025 BGSU RNA group. Page generated in 0.1902 s