Motif J5_39529.2 Version J5_39529.2 of this group appears in releases 4.0 to 4.5

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name for chain		1		2		3	break		4		5		6		7	break		8		9	break		10		11	break		12		13		14		15		16	1-16	2-3	3-4	3-15	4-15	5-16	7-8	9-10	11-12
1	J5_9DFE_007	9DFE	0.1046	5	1A	LSU rRNA	U	2074	U	2075	A	2077	*	U	2243	U	2244	U	2245	G	2246	*	C	2258	G	2259	*	C	2281	G	2282	*	C	2427	A	2432	A	2433	A	2434	A	2435	cWW	cWH	cWW	ncsS	ntsS	cWH	cWW	cWW	cWW
2	J5_7A0S_007	7A0S	0.0743	5	X	LSU rRNA	U	2057	U	2058	A	2060	*	U	2222	U	2223	U	2224	G	2225	*	C	2237	G	2238	*	C	2260	G	2261	*	C	2406	A	2411	A	2412	A	2413	A	2414	cWW	cWH	cWW			cWH	cWW	cWW	cWW
3	J5_8B0X_009	8B0X	0.0000	5	a	LSU rRNA	U	2078	U	2079	A	2081	*	U	2247	U	2248	U	2249	G	2250	*	C	2262	U	2263	*	A	2285	G	2286	*	C	2431	A	2436	A	2437	A	2438	A	2439	cWW	cWH	cWW	ncsS	ntsS	cWH	cWW	cWW	cWW
4	J5_4WF9_007	4WF9	0.0629	5	X	LSU rRNA	U	2101	U	2102	A	2104	*	U	2270	U	2271	U	2272	G	2273	*	C	2285	G	2286	*	C	2308	G	2309	*	C	2454	A	2459	A	2460	A	2461	A	2462	cWW	cWH	cWW			cWH	cWW	cWW	cWW

3D structures

Complete motif including flanking bases

Sequence	Counts
UUUAUUUGCGCGCGGAUAAAA	3
UUUAUUUGCUAGCGGAUAAAA	1

Non-Watson-Crick part of the motif

Sequence	Counts
UUUU**GGAUAAA	4

Release history

Release	4.0	4.1	4.2	4.3	4.4	4.5
Date	2025-08-13	2025-09-10	2025-10-08	2025-11-05	2025-12-03	2025-12-31
Status	Updated, 1 parent	Exact match	Exact match	Exact match	Exact match	Exact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (4)
Basepair signature: cWW-cWH-cWH-F-cWW-F-F-cWW-F-cWW-cWW
Heat map statistics: Min 0.06 | Avg 0.07 | Max 0.11

Help

Coloring options: Nucleotide numbers

Copyright 2026 BGSU RNA group. Page generated in 0.6564 s