Equivalence class NR_2.0_56789.1 Obsolete
| # | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | Date |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 1QWA|A (rep) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Solution NMR | 2003-11-25 | ||||||
| 2 | 2RPT|A | Structure of the CC mismatch from the thymidylate synthase binding site 1 hairpin and analysis of its interaction with paromomycin | Solution NMR | 2009-08-25 | ||||||
| 3 | 2XLI|B | Pseudomonas aeruginosa | Crystal structure of the Csy4-crRNA complex, monoclinic form | X-ray diffraction | 2.33 | 2010-09-22 | ||||
| 4 | 2XLJ|B | Pseudomonas aeruginosa | Crystal structure of the Csy4-crRNA complex, hexagonal form | X-ray diffraction | 2.6 | 2010-09-22 | ||||
| 5 | 2XLK|C | Pseudomonas aeruginosa | Crystal structure of the Csy4-crRNA complex, orthorhombic form | X-ray diffraction | 1.8 | 2010-09-22 |
Parents
| This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
|---|
Children
| This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
|---|
Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.
| #S | View | PDB | Title | Method | Resolution | Length |
|---|
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.
Coloring options: