NR_3.0_26150.1

Members (59)
History
Heat map

#	IFE	Standardized name	Molecule	Organism	Source	Rfam	Title	Method	Res. Å	#NTs	Date
1	4V9F\|1\|0 (rep)	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteins	X-ray diffraction	2.4	2808	2014-07-09
2	1S72\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION	X-ray diffraction	2.4	2754	2004-06-15
3	1VQO\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna	Haloarcula marismortui	Archaea	RF02540	The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortui	X-ray diffraction	2.2	2754	2005-11-29
4	3CC2\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-Proteins	X-ray diffraction	2.4	2754	2008-05-20
5	1VQK\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna	Haloarcula marismortui	Archaea	RF02540	The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.3	2754	2005-11-29
6	1VQP\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R((DC)P(DC)P(PPU)(LOF)P(PO2)PAPCC)-3'	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.25	2754	2005-11-29
7	3CCU\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482C	X-ray diffraction	2.8	2754	2008-05-20
8	1JJ2\|1\|0	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution	X-ray diffraction	2.4	2754	2001-08-01
9	1VQ6\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCPAP(PHE)(ACA)(BTN))-3'	Haloarcula marismortui	Archaea	RF02540	The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.7	2754	2005-11-29
10	3CPW\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA, 5'-R(CPCPAP(PHE)*(ACA))-3'	Haloarcula marismortui	Archaea	RF02540	The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI	X-ray diffraction	2.7	2754	2008-07-22
11	1VQM\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.3	2754	2005-11-29
12	3CC4\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit	X-ray diffraction	2.7	2754	2008-05-20
13	3G6E\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit	X-ray diffraction	2.7	2754	2009-04-28
14	1VQ4\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCP(5AA)P(2OP)P(PO2)P(DA)PCC)-3')	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortui	X-ray diffraction	2.7	2754	2005-11-29
15	1VQ8\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCP(DA)(PHE)*(ACA))-3'	Haloarcula marismortui	Archaea	RF02540	The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.2	2754	2005-11-29
16	1VQL\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.3	2754	2005-11-29
17	1M90\|1\|A	Large subunit ribosomal RNA	23S RRNA, CCA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunit	X-ray diffraction	2.8	2754	2002-09-06
18	3CCM\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611U	X-ray diffraction	2.55	2754	2008-05-20
19	1VQ9\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCPAP(PHE)*(ACA))-3'	Haloarcula marismortui	Archaea	RF02540	The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.4	2754	2005-11-29
20	1YHQ\|1\|0	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	2.4	2754	2005-04-26
21	1NJI\|1\|A	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Structure of chloramphenicol bound to the 50S ribosomal subunit	X-ray diffraction	3	2754	2003-07-22
22	1VQ7\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCP(5AA)P(2OP)P(PAE)PAPCC)-3')	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.5	2754	2005-11-29
23	1VQN\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCPAP(PHE)(ACA)(BTN))-3'	Haloarcula marismortui	Archaea	RF02540	The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.4	2754	2005-11-29
24	1YI2\|1\|0	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	2.65	2754	2005-04-26
25	3CC7\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487U	X-ray diffraction	2.7	2754	2008-05-20
26	3CXC\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA, 5'-R(CPCP*A)-3'	Haloarcula marismortui	Archaea	RF02540	The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortui	X-ray diffraction	3	2754	2009-04-28
27	1K9M\|1\|A	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortui	X-ray diffraction	3	2754	2002-07-19
28	1VQ5\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-D((DC)P(DC)P(5AA)P(2OP)P(PO2)PAPCC)-3')	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.6	2754	2005-11-29
29	3OW2\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal Subunit	X-ray diffraction	2.7	2754	2012-06-20
30	3CCL\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.	X-ray diffraction	2.9	2754	2008-05-20
31	3CMA\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA, RNA (5'-R(CPCP*(8AN))-3')	Haloarcula marismortui	Archaea	RF02540	The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortui	X-ray diffraction	2.8	2754	2008-09-23
32	1YIT\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	2.8	2754	2005-04-26
33	3CCV\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616A	X-ray diffraction	2.9	2754	2008-05-20
34	3CCQ\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488U	X-ray diffraction	2.9	2754	2008-05-20
35	1YIJ\|1\|0	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	2.6	2754	2005-04-26
36	1YJW\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	2.9	2754	2005-04-26
37	3G71\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of Bruceantin bound to the large ribosomal subunit	X-ray diffraction	2.85	2754	2009-04-28
38	1N8R\|1\|A	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Structure of large ribosomal subunit in complex with virginiamycin M	X-ray diffraction	3	2754	2003-07-22
39	1Q86\|1\|A	Large subunit ribosomal RNA	23S ribosomal rna, CCA-phenylalanine-cariotic-acid-biotin	Haloarcula marismortui	Archaea	RF02540	Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.	X-ray diffraction	3	2754	2003-10-07
40	1YJN\|1\|0	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	3	2754	2005-04-26
41	1Q82\|1\|A	Large subunit ribosomal RNA	23S ribosomal rna, CC-puromycin	Haloarcula marismortui	Archaea	RF02540	Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunit	X-ray diffraction	2.98	2754	2003-10-07
42	1FFK\|1\|0	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION	X-ray diffraction	2.4	2706	2000-08-14
43	2OTL\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Girodazole bound to the large subunit of Haloarcula marismortui	X-ray diffraction	2.7	2754	2007-04-03
44	3CD6\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Co-cystal of large Ribosomal Subunit mutant G2616A with CC-Puromycin	X-ray diffraction	2.75	2754	2008-05-20
45	1Q81\|1\|A	Large subunit ribosomal RNA	23S ribosomal rna, minihelix-puromycin	Haloarcula marismortui	Archaea	RF02540	Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.	X-ray diffraction	2.95	2754	2003-10-07
46	1K8A\|1\|A	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui	X-ray diffraction	3	2754	2002-07-19
47	1YJ9\|1\|0	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22	X-ray diffraction	2.8	2754	2005-04-26
48	3CCE\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535A	X-ray diffraction	2.75	2754	2008-05-20
49	1KD1\|1\|A	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortui	X-ray diffraction	3	2754	2002-07-19
50	3I56\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit	X-ray diffraction	2.9	2754	2010-03-09
51	1QVG\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, Oligonucleotide CCA	Haloarcula marismortui	Archaea	RF02540	Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui	X-ray diffraction	2.9	2754	2003-11-11
52	2OTJ\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	13-deoxytedanolide bound to the large subunit of Haloarcula marismortui	X-ray diffraction	2.9	2754	2007-04-03
53	3CCS\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482A	X-ray diffraction	2.95	2754	2008-05-20
54	2QEX\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal Subunit	X-ray diffraction	2.9	2754	2008-09-30
55	3CME\|1\|0	Large subunit ribosomal RNA	50S RIBOSOMAL RNA, RNA (5'-R(CPCP*(8AN))-3')	Haloarcula marismortui	Archaea	RF02540	The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula Marismortui	X-ray diffraction	2.95	2754	2008-09-23
56	3CCR\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.	X-ray diffraction	3	2754	2008-05-20
57	2QA4\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunit	X-ray diffraction	3	2753	2008-04-01
58	3CCJ\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534U	X-ray diffraction	3.3	2754	2008-05-20
59	1FG0\|1\|A	Large subunit ribosomal RNA	23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'	Haloarcula marismortui	Archaea	RF02540	LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND	X-ray diffraction	3	496	2000-08-28

Release history

Release	2.0	2.1	2.2	2.3	2.4	2.5	2.6	2.7	2.8	2.9	2.10	2.11	2.12	2.13	2.14	2.15	2.16	2.17	2.18	2.19	2.20	2.21	2.22	2.23	2.24	2.25	2.26	2.27	2.28	2.29	2.30	2.31	2.32	2.33	2.34	2.35	2.36	2.37	2.38	2.39	2.40	2.41	2.42	2.43	2.44	2.45	2.46	2.47	2.48	2.49	2.50	2.51	2.52	2.53	2.54	2.55	2.56	2.57	2.58	2.59	2.60	2.61	2.62	2.63	2.64	2.65	2.66	2.67	2.68	2.69	2.70	2.71	2.72	2.73	2.74	2.75	2.76	2.77	2.78	2.79	2.80	2.81	2.82	2.83	2.84	2.85	2.86	2.87	2.88	2.89	2.90	2.91	2.92	2.93	2.94	2.95	2.96	2.97	2.98	2.99	2.100	2.101	2.102	2.103	2.104	2.105	2.106	2.107	2.108	2.109	2.110	2.111	2.112	2.113	2.114	2.115	2.116	2.117	2.118	2.119	2.120	2.121	2.122	2.123	2.124	2.125	2.126	2.127	2.128	2.129	2.130	2.131	2.132	2.133	2.134	2.135	2.136	2.137	2.138	2.139	2.140	2.141	2.142	2.143	2.144	2.145	2.146	2.147	2.148	2.149	2.150	2.151	2.152	2.153	2.154	2.155	2.156	2.157	2.158
Date	2014-12-05	2014-12-12	2014-12-19	2014-12-26	2015-01-02	2015-01-09	2015-01-16	2015-01-23	2015-01-30	2015-02-06	2015-02-13	2015-02-20	2015-02-27	2015-03-06	2015-03-13	2015-03-20	2015-03-27	2015-04-03	2015-04-10	2015-04-17	2015-04-24	2015-05-01	2015-05-08	2015-05-15	2015-05-22	2015-05-29	2015-06-05	2015-06-12	2015-06-19	2015-06-26	2015-07-03	2015-07-10	2015-07-17	2015-07-24	2015-07-31	2015-08-07	2015-08-14	2015-08-21	2015-08-28	2015-09-04	2015-09-11	2015-09-18	2015-09-25	2015-10-02	2015-10-09	2015-10-16	2015-10-23	2015-10-30	2015-11-06	2015-11-13	2015-11-20	2015-11-27	2015-12-04	2015-12-11	2015-12-18	2015-12-25	2016-01-01	2016-01-08	2016-01-15	2016-01-22	2016-01-29	2016-02-05	2016-02-12	2016-02-19	2016-02-26	2016-03-04	2016-03-11	2016-03-18	2016-03-25	2016-04-01	2016-04-08	2016-04-15	2016-04-22	2016-04-29	2016-05-06	2016-05-13	2016-05-20	2016-05-27	2016-06-03	2016-06-10	2016-06-17	2016-06-24	2016-07-01	2016-07-08	2016-07-15	2016-07-22	2016-07-29	2016-08-05	2016-08-12	2016-08-19	2016-08-26	2016-09-02	2016-09-09	2016-09-16	2016-09-23	2016-09-30	2016-10-07	2016-10-14	2016-10-21	2016-10-28	2016-11-04	2016-11-11	2016-11-18	2016-11-25	2016-12-02	2016-12-09	2016-12-16	2016-12-23	2016-12-30	2017-01-06	2017-01-13	2017-01-20	2017-01-27	2017-02-03	2017-02-10	2017-02-17	2017-02-24	2017-03-03	2017-03-10	2017-03-17	2017-03-24	2017-03-31	2017-04-11	2017-04-15	2017-04-26	2017-04-29	2017-05-09	2017-05-15	2017-05-20	2017-05-27	2017-06-07	2017-06-11	2017-06-21	2017-06-24	2017-06-28	2017-07-04	2017-07-10	2017-07-15	2017-07-26	2017-07-31	2017-08-05	2017-08-12	2017-08-19	2017-08-26	2017-09-03	2017-09-09	2017-09-16	2017-09-23	2017-09-30	2017-10-07	2017-10-14	2017-10-21	2017-10-28	2017-11-03	2017-11-10	2017-11-17	2017-11-24	2017-12-01	2017-12-08

Parents

This class	Parent classes	Release id	Intersection	Added to this class	Only in parent

Children

This class	Descendant classes	Release id	Intersection	Only in this class	Added to child
NR_3.0_26150.1	NR_3.0_26150.2	3.0	(55) 1FFK\|1\|0, 1FG0\|1\|A, 1JJ2\|1\|0, 1K8A\|1\|A, 1K9M\|1\|A, 1KD1\|1\|A, 1M90\|1\|A, 1N8R\|1\|A, 1NJI\|1\|A, 1Q81\|1\|A, 1Q82\|1\|A, 1Q86\|1\|A, 1QVG\|1\|0, 1S72\|1\|0, 1VQ4\|1\|0, 1VQ5\|1\|0, 1VQ6\|1\|0, 1VQ7\|1\|0, 1VQ8\|1\|0, 1VQ9\|1\|0, 1VQK\|1\|0, 1VQN\|1\|0, 1VQO\|1\|0, 1VQP\|1\|0, 1YHQ\|1\|0, 1YI2\|1\|0, 1YIJ\|1\|0, 1YIT\|1\|0, 1YJ9\|1\|0, 1YJN\|1\|0, 2OTJ\|1\|0, 2OTL\|1\|0, 2QA4\|1\|0, 2QEX\|1\|0, 3CC2\|1\|0, 3CC4\|1\|0, 3CC7\|1\|0, 3CCE\|1\|0, 3CCL\|1\|0, 3CCM\|1\|0, 3CCQ\|1\|0, 3CCR\|1\|0, 3CCS\|1\|0, 3CCU\|1\|0, 3CCV\|1\|0, 3CD6\|1\|0, 3CMA\|1\|0, 3CME\|1\|0, 3CPW\|1\|0, 3CXC\|1\|0, 3G6E\|1\|0, 3G71\|1\|0, 3I56\|1\|0, 3OW2\|1\|0, 4V9F\|1\|0	(3) 1VQL\|1\|0, 1VQM\|1\|0, 1YJW\|1\|0	(0)

Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.

#S	PDB	Title	Method	Resolution	#NTs
1	4V9F\|1\|0	The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteins	X-RAY DIFFRACTION	2.4	2808
2	1FFK\|1\|0	CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION	X-RAY DIFFRACTION	2.4	2706
3	1VQ5\|1\|0	The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.6	2754
4	1VQ7\|1\|0	The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.5	2754
5	1M90\|1\|A	Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunit	X-RAY DIFFRACTION	2.8	2754
6	1S72\|1\|0	REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION	X-RAY DIFFRACTION	2.4	2754
7	1JJ2\|1\|0	Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution	X-RAY DIFFRACTION	2.4	2754
8	1NJI\|1\|A	Structure of chloramphenicol bound to the 50S ribosomal subunit	X-RAY DIFFRACTION	3	2754
9	1K9M\|1\|A	Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	3	2754
10	1KD1\|1\|A	Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortui	X-RAY DIFFRACTION	3	2754
11	1K8A\|1\|A	Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	3	2754
12	1N8R\|1\|A	Structure of large ribosomal subunit in complex with virginiamycin M	X-RAY DIFFRACTION	3	2754
13	1Q82\|1\|A	Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunit	X-RAY DIFFRACTION	2.98	2754
14	1Q81\|1\|A	Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.	X-RAY DIFFRACTION	2.95	2754
15	3CXC\|1\|0	The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortui	X-RAY DIFFRACTION	3	2754
16	3CPW\|1\|0	The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI	X-RAY DIFFRACTION	2.7	2754
17	3OW2\|1\|0	Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal Subunit	X-RAY DIFFRACTION	2.7	2754
18	3CME\|1\|0	The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula Marismortui	X-RAY DIFFRACTION	2.95	2754
19	3CMA\|1\|0	The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	2.8	2754
20	1VQP\|1\|0	The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.25	2754
21	1VQL\|1\|0	The structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.3	2754
22	1VQM\|1\|0	The structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.3	2754
23	1VQN\|1\|0	The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.4	2754
24	1VQ9\|1\|0	The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.4	2754
25	1VQ8\|1\|0	The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.2	2754
26	1VQK\|1\|0	The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.3	2754
27	1VQO\|1\|0	The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortui	X-RAY DIFFRACTION	2.2	2754
28	3CCM\|1\|0	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611U	X-RAY DIFFRACTION	2.55	2754
29	3CCJ\|1\|0	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534U	X-RAY DIFFRACTION	3.3	2754
30	3CCR\|1\|0	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.	X-RAY DIFFRACTION	3	2754
31	3CCS\|1\|0	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482A	X-RAY DIFFRACTION	2.95	2754
32	3CD6\|1\|0	Co-cystal of large Ribosomal Subunit mutant G2616A with CC-Puromycin	X-RAY DIFFRACTION	2.75	2754
33	3CCL\|1\|0	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.	X-RAY DIFFRACTION	2.9	2754
34	3CCQ\|1\|0	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488U	X-RAY DIFFRACTION	2.9	2754
35	1YHQ\|1\|0	Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	2.4	2754
36	3CC2\|1\|0	The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-Proteins	X-RAY DIFFRACTION	2.4	2754
37	3G6E\|1\|0	Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit	X-RAY DIFFRACTION	2.7	2754
38	3G71\|1\|0	Co-crystal structure of Bruceantin bound to the large ribosomal subunit	X-RAY DIFFRACTION	2.85	2754
39	2OTJ\|1\|0	13-deoxytedanolide bound to the large subunit of Haloarcula marismortui	X-RAY DIFFRACTION	2.9	2754
40	3CC4\|1\|0	Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit	X-RAY DIFFRACTION	2.7	2754
41	3CCU\|1\|0	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482C	X-RAY DIFFRACTION	2.8	2754
42	3CCV\|1\|0	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616A	X-RAY DIFFRACTION	2.9	2754
43	3CCE\|1\|0	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535A	X-RAY DIFFRACTION	2.75	2754
44	3CC7\|1\|0	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487U	X-RAY DIFFRACTION	2.7	2754
45	1YJN\|1\|0	Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	3	2754
46	1YIT\|1\|0	Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	2.8	2754
47	1YJW\|1\|0	Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	2.9	2754
48	1YIJ\|1\|0	Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	2.6	2754
49	1YI2\|1\|0	Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	2.65	2754
50	3I56\|1\|0	Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit	X-RAY DIFFRACTION	2.9	2754
51	2OTL\|1\|0	Girodazole bound to the large subunit of Haloarcula marismortui	X-RAY DIFFRACTION	2.7	2754
52	1Q86\|1\|A	Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.	X-RAY DIFFRACTION	3	2754
53	1VQ6\|1\|0	The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.7	2754
54	1QVG\|1\|0	Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	2.9	2754
55	1VQ4\|1\|0	The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	2.7	2754
56	1YJ9\|1\|0	Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22	X-RAY DIFFRACTION	2.8	2754
57	2QA4\|1\|0	A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunit	X-RAY DIFFRACTION	3	2753
58	2QEX\|1\|0	Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal Subunit	X-RAY DIFFRACTION	2.9	2754
59	1FG0\|1\|A	LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND	X-RAY DIFFRACTION	3	496

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.

Coloring options: Nucleotide numbers

Equivalence class NR_3.0_26150.1 Obsolete

Release history

Parents

Children