Motif HL_90102.1 Version HL_90102.1 of this group appears in releases 0.3 to 1.14
| #S | Loop id | PDB | Disc | #Non-core | Chain(s) | Standardized name for chain | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 1-19 | 2-18 | 3-14 | 3-17 | 4-11 | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | HL_3U5H_075 | 3U5H | 0 | 2 | 8 | 5.8S rRNA | U | 69 | G | 70 | A | 71 | A | 72 | U | 73 | U | 74 | G | 75 | C | 76 | A | 77 | G | 78 | A | 79 | A | 80 | U | 81 | U | 82 | C | 83 | G | 85 | G | 87 | A | 88 | A | 89 | cWW | tSH | ntWW | tHS | ncwW |
3D structures
Complete motif including flanking bases
| Sequence | Counts |
|---|---|
| UGAAUUGCAGAAUUCCGUGAA | 1 |
Non-Watson-Crick part of the motif
| Sequence | Counts |
|---|---|
| GAAUUGCAGAAUUCCGUGA | 1 |
Release history
| Release | 0.3 | 0.4 | 0.5 | 0.6 | 0.7 | 0.8 | 1.0 | 1.1 | 1.2 | 1.3 | 1.4 | 1.5 | 1.6 | 1.7 | 1.8 | 1.9 | 1.10 | 1.11 | 1.12 | 1.13 | 1.14 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Date | 2013-02-17 | 2013-02-17 | 2013-02-17 | 2013-02-17 | 2013-02-17 | 2013-02-17 | 2013-03-04 | 2013-04-06 | 2013-05-04 | 2013-06-01 | 2013-07-03 | 2013-08-03 | 2013-08-31 | 2013-09-28 | 2013-11-04 | 2013-12-07 | 2014-01-04 | 2014-02-01 | 2014-03-01 | 2014-03-29 | 2014-04-27 |
| Status | New id, no parents | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match |
Parent motifs
This motif has no parent motifs.
Children motifs
| Child motif | Common motif instances | Only in HL_90102.1 | Only in the child motif |
|---|---|---|---|
| HL_64438.1 Compare | HL_3U5H_075 | HL_4CUV_076 |
- Annotations
-
- (1)
- Basepair signature
- cWW-tSH-tHS-R-R-R-R-R-R-R-R-R-R-R-R-R
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: