SequenceLength# of motifsMotifs
UGUGGAAGGAGUGGCUGGGUUG222
GACCUAGAUCACCC142
CAUUGCACCUCG122
CAUUGCACUCCG123
CAAGCGGUAAG112
CAGCCUGGUAG112
CAGUCGGUAG103
CUCCUCGCUG102
ACUCUAAAU92
ACUGCAGAU92
CAGUGGUAG92
CCUUUCACG93
GGUAAGUUC92
GUGAGAAUC92
GUGAGAGUC92
GUUCGAAUC92
AGGCAAUU82
GAUAAUGC82
GUUAAAAC82
GUUUCUAC82
CGAAUAG72
CGGCGAG72
CUGUUCG72
GAAACAC72
GGAAUAC72
GUUUAUC72
UACUAUA72
AGAAAU62
CAACCG62
CAUUCG62
CCUCGG62
CGAAAG63
CGAACG62
CGAGAG63
CGCAAG62
CGCGUG65
CGUAAG63
CGUAGG62
CGUGAG63
CUGUUG62
CUUCGG64
GGAAAC66
GGCGAC63
GGGAAC62
GUGUCC62
UGAAAA62
UGUAAG62
CUCUG52
CUUCG52
CUUUG52
GCAUC52
GGUAC52
GUCUC53
CUUG42
GGUC42

Copyright 2024 BGSU RNA group. Page generated in 0.0190 s