SequenceLength# of motifsMotifs
UGGCCUUUCUUAAAAAAAAA202
CAUUGCACUCCG122
GUGCAGCCCGUC122
CAGCCUGGUAG112
CAGGCGGUUAG112
CAGUCGGUAG104
UCAAGCCUAG102
ACUCUAAAU92
ACUGAAAAU92
ACUGCAGAU92
AUUGAAAAU92
CAAUGGUAG92
CAGUGGUAG93
CCUUUCACG92
GGUAAGUUC92
GUGAGAAUC93
GUGAGAGUC92
GUGCAACUC92
GUGCAAGUC92
GUUCAAAUC92
GUUCAAGUC93
GUUCGAAUC92
GUUCGACUC92
GUUCGAGUC92
GUUCGAUCC92
GUUCGAUUC92
AGGCAAUU82
CGUAAUAG82
GGUUGGCC82
GUUAAAAC82
CGAACAG72
CGAAUAG72
CGCAUAG72
CGGCGAG72
CUGUUCG72
GAAACAC72
GUUUAUC72
UGAAAAG72
AGAAAU63
CAACCG62
CAUUCG62
CGAAAG63
CGAACG62
CGAGAG64
CGCAAG63
CGCGUG65
CGGAAG62
CGUAAG63
CGUAGG62
CGUGAG64
CUAACG62
CUACGG62
CUCUUG62
CUGAUG62
CUUCGG63
GGAAAC66
GGCGAC62
GGGAAC62
GUGGUC62
GUGUCC62
GUUCGC62
UGAAAA63
UGGAAA62
UGUAAG63
CAUUG52
CUCUG52
CUGGG52
CUUUG52
GAUAC52
GGUAC52
CUCG42
CUUG44

Copyright 2024 BGSU RNA group. Page generated in 0.0160 s