SequenceLength# of motifsMotifs
GAAACAAUACAGAGAUGAUCA*UUUAC262
CAUGGUCCCAG*CG132
CGUAAC*GGAGAAG132
GGGAG*CGAAGAAC132
CCGAAGCGAG*UG122
GAUGAAA*UAACC122
GGGAAC*GGGAAC122
ACCCC*GAACU102
AGAG*CAAGUU102
CGGCCAAC*GG102
UCCUGC*GAAA102
UGUAC*GGUAG102
UGUAG*CGAAG102
AAAAG*CGCU92
ACGA*UCUAU92
CACC*GCAAG92
CGCU*AAAAG93
CGGGAG*CAG92
CUAAG*UAUG93
CUACC*GAUG92
GAACUAC*GC93
GAGAG*UGGU92
GCAAG*CACC92
GCACU*AAAC92
GCCC*GUAAC92
GGGC*GGUAC92
UAUG*CUAAG92
UUAG*CGAAG92
AUC*GGUUU82
GAAA*UAAC82
GGAAG*CGC82
GGAC*GGAC82
GGUUC*GUC82
UAG*CGAAA82
UGCAU*AUG82
UUCG*UUCG84
AAAG*CGU72
AUCUG*CU72
CAC*GAAG73
CGC*GAAG72
CGU*AGUG72
GAAG*CAC72
GAAG*CGC72
GACAU*AC72
GAUG*CGC72
GG*UCAGC72
GUUG*CUC72
UAG*CGGG72
AAAC*GU62
CAG*CAG62
CAGC*GG62
CAUC*GG62
CC*GAAG62
CC*GUCG62
CC*GUUG62
CCG*CCG62
CCGG*CG62
CG*CAAG62
CGAA*UG62
CGG*CGG63
CUG*CUG62
GA*UGAC62
GAAG*CC62
GAU*GUC62
GC*GCAC62
GC*GCAU62
GCC*GCC62
GG*CGUC62
GGAA*UC62
GGC*GCC62
GUC*GUC62
GUG*UGC62
UAG*CAG62
UCA*UCA62
UG*CAAG62
UG*UGAA62
UGA*UGA63
UUA*UUA63
AAG*CU52
AC*GAU53
CA*UAG54
CAA*UG52
CAC*GG52
CAG*CG53
CC*GAG55
CC*GCG52
CC*GUG52
CG*CAG53
CG*CUG53
CG*UGG53
CGC*GG53
CGG*CG52
CU*AAG52
CUG*CG52
GA*UAC52
GAC*GC52
GAG*CC53
GC*GUC54
GCC*GC52
GCG*CC52
GG*CAC53
GG*CCC52
GG*CGC52
GG*UAC53
GG*UGC53
GU*GGC52
UAG*CA52
UAG*CG54
UC*GAA53
UC*GUA53
UG*CAA53
UG*UUA52
UUG*UG52

Copyright 2024 BGSU RNA group. Page generated in 0.0316 s