SequenceLength# of motifsMotifs
GAAACAAUACAGAGAUGAUCA*UUUAC262
GGAUAAC*GCUAAUAC152
CAUGGUCCCAG*CG132
CGUAAC*GGAGAAG132
GGGAG*CGAAGAAC132
CCGAAGCGAG*UG122
GGGAAC*GGGAAC122
ACCCC*GAACU102
CGUAG*UCAAG102
UCCUGC*GAAA102
UGUAC*GGUAG102
UGUAG*CGAAG102
AAAAG*CGCU92
ACGA*UCUAU92
CGCU*AAAAG93
CUAAG*UAUG93
GAACUAC*GC93
GAGAG*UGGU92
GCAAG*CACC92
GCCC*GUAAC92
GGGAUC*GUC92
GGGC*GGUAC92
GUUAAAA*UC92
UAUG*CUAAG92
UUAG*CGAAG92
AUC*GGUUU83
CGAAG*CAG82
CUUG*CUUG82
GAAA*UAAC82
GAAUG*CGC82
GGAAG*CGC82
GGAC*GGAC82
UAG*CGAAA82
UUCG*UUCG84
AAAG*CGU72
AUCUG*CU72
CAC*GAAG72
CGC*GAAG72
CGU*AGUG72
GAAG*CAC72
GAAG*CGC72
GAUG*CGC72
GUUG*CUC72
UAG*CGGG72
AAAC*GU62
ACA*UUU62
CA*UACG62
CAG*CAG62
CAGC*GG62
CAUC*GG62
CC*GAAG62
CC*GUCG62
CC*GUUG62
CCG*CCG62
CCGG*CG63
CG*CAAG62
CGAA*UG62
CGG*CGG63
CU*AACG62
CUG*CUG62
GAAG*CC62
GC*GCAC62
GC*GCAU62
GCC*GCC62
GCU*GAU62
GG*CAAC62
GG*CGUC62
GGA*UAC62
GGAA*UC62
GGC*GCC62
GGC*GUC62
GUC*GUC62
GUG*UGC62
UAG*CAG62
UAGU*AG63
UCA*UCA62
UG*CAAG63
UG*UAAA62
UG*UGAA62
UGA*UGA63
UGG*CGA62
UUA*UUA62
UUG*UUG62
UUU*AGA62
AAG*CU52
AC*GAU52
CA*UAG54
CAA*UG52
CAC*GG52
CAG*CG53
CAU*AG52
CC*GAG55
CC*GCG52
CC*GUG52
CG*CAG54
CG*CUG53
CG*UGG53
CG*UUG52
CGC*GG53
CGG*CG52
CU*AAG52
CUG*CG52
GA*UAC52
GAC*GC53
GAG*CC53
GC*GAU52
GC*GUC53
GCC*GC52
GCG*CC52
GG*CAC53
GG*CCC52
GG*CGC52
GG*UAC54
GG*UCC52
GG*UUC52
GUA*UC52
GUC*GC52
UAA*UG52
UAG*CA52
UAG*CG54
UC*GAA52
UC*GUA53
UG*CAA53
UG*UUA52
UUG*UG52

Copyright 2024 BGSU RNA group. Page generated in 0.0611 s