#IFEStandardized nameMoleculeOrganismSourceRfamTitleMethodRes. ÅDate
11QWA|A (rep)NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.Solution NMR2003-11-25
22RPT|AStructure of the CC mismatch from the thymidylate synthase binding site 1 hairpin and analysis of its interaction with paromomycinSolution NMR2009-08-25
32XLI|BPseudomonas aeruginosaCrystal structure of the Csy4-crRNA complex, monoclinic formX-ray diffraction2.332010-09-22
42XLJ|BPseudomonas aeruginosaCrystal structure of the Csy4-crRNA complex, hexagonal formX-ray diffraction2.62010-09-22
52XLK|CPseudomonas aeruginosaCrystal structure of the Csy4-crRNA complex, orthorhombic formX-ray diffraction1.82010-09-22

Release history

Release0.160.170.18
Date2011-05-072011-05-142011-05-21

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5

#S - ordering by similarity (same as in the heat map).
#SPDBTitleMethodResolutionLength
Copyright 2024 BGSU RNA group. Page generated in 0.0318 s