Equivalence class NR_3.5_15391.1 Obsolete
| # | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | Date |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 1QWA|A (rep) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Solution NMR | 2003-11-25 | ||||||
| 2 | 2RPT|A | Structure of the CC mismatch from the thymidylate synthase binding site 1 hairpin and analysis of its interaction with paromomycin | Solution NMR | 2009-08-25 | ||||||
| 3 | 2XLI|B | Pseudomonas aeruginosa | Bacteria | Crystal structure of the Csy4-crRNA complex, monoclinic form | X-ray diffraction | 2.33 | 2010-09-22 | |||
| 4 | 2XLJ|B | Pseudomonas aeruginosa | Bacteria | Crystal structure of the Csy4-crRNA complex, hexagonal form | X-ray diffraction | 2.6 | 2010-09-22 | |||
| 5 | 2XLK|C | Pseudomonas aeruginosa | Bacteria | Crystal structure of the Csy4-crRNA complex, orthorhombic form | X-ray diffraction | 1.8 | 2010-09-22 |
Parents
| This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
|---|
Children
| This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
|---|
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5
#S - ordering by similarity (same as in the heat map).| #S | PDB | Title | Method | Resolution | Length |
|---|