Equivalence class NR_4.0_26150.2 Current
# | IFE | Standardized name | Molecule | Organism | Domain | Rfam | Title | Method | Å | Date |
---|---|---|---|---|---|---|---|---|---|---|
1 | 4V9F|1|0 (rep) | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteins | X-RAY DIFFRACTION | 2.4 | 2014-07-09 |
2 | 1S72|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION | X-RAY DIFFRACTION | 2.4 | 2004-06-15 |
3 | 1JJ2|1|0 | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution | X-RAY DIFFRACTION | 2.4 | 2001-08-01 |
4 | 1YI2|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.65 | 2005-04-26 |
5 | 3CCU|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482C | X-RAY DIFFRACTION | 2.8 | 2008-05-20 |
6 | 3CCL|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model. | X-RAY DIFFRACTION | 2.9 | 2008-05-20 |
7 | 1YHQ|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.4 | 2005-04-26 |
8 | 1YIJ|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.6 | 2005-04-26 |
9 | 3CMA|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.8 | 2008-09-23 |
10 | 3CCV|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616A | X-RAY DIFFRACTION | 2.9 | 2008-05-20 |
11 | 3G6E|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit | X-RAY DIFFRACTION | 2.7 | 2009-04-28 |
12 | 3G71|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Bruceantin bound to the large ribosomal subunit | X-RAY DIFFRACTION | 2.85 | 2009-04-28 |
13 | 3CD6|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Co-cystal of large Ribosomal Subunit mutant G2616A with CC-Puromycin | X-RAY DIFFRACTION | 2.75 | 2008-05-20 |
14 | 2QEX|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 2.9 | 2008-09-30 |
15 | 3CCM|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611U | X-RAY DIFFRACTION | 2.55 | 2008-05-20 |
16 | 3I56|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit | X-RAY DIFFRACTION | 2.9 | 2010-03-09 |
17 | 2OTL|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Girodazole bound to the large subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.7 | 2007-04-03 |
18 | 3CCS|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482A | X-RAY DIFFRACTION | 2.95 | 2008-05-20 |
19 | 1YJN|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 3 | 2005-04-26 |
20 | 1YJ9|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22 | X-RAY DIFFRACTION | 2.8 | 2005-04-26 |
21 | 3CC4|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 2.7 | 2008-05-20 |
22 | 3CCQ|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488U | X-RAY DIFFRACTION | 2.9 | 2008-05-20 |
23 | 1YIT|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.8 | 2005-04-26 |
24 | 3CC2|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-Proteins | X-RAY DIFFRACTION | 2.4 | 2008-05-20 |
25 | 1KQS|1|0 | Large subunit ribosomal RNA | 23S RRNA, CCA, CC-Pmn-pcb | Haloarcula marismortui | Archaea | RF02540 | The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein Synthesis | X-RAY DIFFRACTION | 3.1 | 2002-02-22 |
26 | 2OTJ|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | 13-deoxytedanolide bound to the large subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.9 | 2007-04-03 |
27 | 3CCR|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model. | X-RAY DIFFRACTION | 3 | 2008-05-20 |
28 | 3CC7|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487U | X-RAY DIFFRACTION | 2.7 | 2008-05-20 |
29 | 3G4S|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Tiamulin bound to the large ribosomal subunit | X-RAY DIFFRACTION | 3.2 | 2009-04-28 |
30 | 3I55|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit | X-RAY DIFFRACTION | 3.11 | 2010-03-09 |
31 | 2QA4|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunit | X-RAY DIFFRACTION | 3 | 2008-04-01 |
32 | 3CCJ|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534U | X-RAY DIFFRACTION | 3.3 | 2008-05-20 |
33 | 3CCE|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535A | X-RAY DIFFRACTION | 2.75 | 2008-05-20 |
34 | 3OW2|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal Subunit | X-RAY DIFFRACTION | 2.7 | 2012-06-20 |
35 | 1VQO|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortui | X-RAY DIFFRACTION | 2.2 | 2005-11-29 |
36 | 1VQ8|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.2 | 2005-11-29 |
37 | 1VQP|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*(DC)P*(DC)P*(PPU)*(LOF)P*(PO2)P*AP*C*C)-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.25 | 2005-11-29 |
38 | 1VQK|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.3 | 2005-11-29 |
39 | 1VQN|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.4 | 2005-11-29 |
40 | 1VQ9|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.4 | 2005-11-29 |
41 | 1VQ7|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.5 | 2005-11-29 |
42 | 1VQ4|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.7 | 2005-11-29 |
43 | 1VQ6|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.7 | 2005-11-29 |
44 | 3CPW|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI | X-RAY DIFFRACTION | 2.7 | 2008-07-22 |
45 | 3CME|1|0 | Large subunit ribosomal RNA | 50S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3') | Haloarcula marismortui | Archaea | RF02540 | The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.95 | 2008-09-23 |
46 | 1M90|1|A | Large subunit ribosomal RNA | 23S RRNA, CCA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunit | X-RAY DIFFRACTION | 2.8 | 2002-09-06 |
47 | 3CXC|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*A)-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortui | X-RAY DIFFRACTION | 3 | 2009-04-28 |
48 | 1QVG|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, Oligonucleotide CCA | Haloarcula marismortui | Archaea | RF02540 | Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.9 | 2003-11-11 |
49 | 1NJI|1|A | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of chloramphenicol bound to the 50S ribosomal subunit | X-RAY DIFFRACTION | 3 | 2003-07-22 |
50 | 1VQ5|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.6 | 2005-11-29 |
51 | 1KC8|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 3.01 | 2003-07-22 |
52 | 1K73|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 3.01 | 2003-07-22 |
53 | 1Q81|1|A | Large subunit ribosomal RNA | 23S ribosomal rna, minihelix-puromycin | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit. | X-RAY DIFFRACTION | 2.95 | 2003-10-07 |
54 | 1Q82|1|A | Large subunit ribosomal RNA | 23S ribosomal rna, CC-puromycin | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunit | X-RAY DIFFRACTION | 2.98 | 2003-10-07 |
55 | 1QVF|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3.1 | 2003-11-11 |
56 | 1K9M|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3 | 2002-07-19 |
57 | 1KD1|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3 | 2002-07-19 |
58 | 1K8A|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3 | 2002-07-19 |
59 | 1M1K|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3.2 | 2002-07-19 |
60 | 1Q86|1|A | Large subunit ribosomal RNA | 23S ribosomal rna, CCA-phenylalanine-cariotic-acid-biotin | Haloarcula marismortui | Archaea | RF02540 | Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit. | X-RAY DIFFRACTION | 3 | 2003-10-07 |
61 | 1Q7Y|1|A | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunit | X-RAY DIFFRACTION | 3.2 | 2003-10-07 |
62 | 1FFK|1|0 | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | X-RAY DIFFRACTION | 2.4 | 2000-08-14 |
63 | 1FG0|1|A | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Haloarcula marismortui | Archaea | RF02540 | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | X-RAY DIFFRACTION | 3 | 2000-08-28 |
64 | 1FFZ|1|A | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | X-RAY DIFFRACTION | 3.2 | 2000-08-28 |
65 | 1N8R|1|A | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of large ribosomal subunit in complex with virginiamycin M | X-RAY DIFFRACTION | 3 | 2003-07-22 |
66 | 1W2B|1|0 | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Trigger Factor ribosome binding domain in complex with 50S | X-RAY DIFFRACTION | 3.5 | 2004-09-02 |
Release history
Release | 3.0 | 3.1 | 3.2 | 3.3 | 3.4 | 3.5 | 3.6 | 3.7 | 3.8 | 3.9 | 3.10 | 3.11 | 3.12 | 3.13 | 3.14 | 3.15 | 3.16 | 3.17 | 3.18 | 3.19 | 3.20 | 3.21 | 3.22 | 3.23 | 3.24 | 3.25 | 3.26 | 3.27 | 3.28 | 3.29 | 3.30 | 3.31 | 3.32 | 3.33 | 3.34 | 3.35 | 3.36 | 3.37 | 3.38 | 3.39 | 3.40 | 3.41 | 3.42 | 3.43 | 3.44 | 3.45 | 3.46 | 3.47 | 3.48 | 3.49 | 3.50 | 3.51 | 3.52 | 3.53 | 3.54 | 3.55 | 3.56 | 3.57 | 3.58 | 3.59 | 3.60 | 3.61 | 3.62 | 3.63 | 3.64 | 3.65 | 3.66 | 3.67 | 3.68 | 3.69 | 3.70 | 3.71 | 3.72 | 3.73 | 3.74 | 3.75 | 3.76 | 3.77 | 3.78 | 3.79 | 3.80 | 3.81 | 3.82 | 3.83 | 3.84 | 3.85 | 3.86 | 3.87 | 3.88 | 3.89 | 3.90 | 3.91 | 3.92 | 3.93 | 3.94 | 3.95 | 3.96 | 3.97 | 3.98 | 3.99 | 3.100 | 3.101 | 3.102 | 3.103 | 3.104 | 3.105 | 3.106 | 3.107 | 3.108 | 3.109 | 3.110 | 3.111 | 3.112 | 3.113 | 3.114 | 3.115 | 3.116 | 3.117 | 3.118 | 3.119 | 3.120 | 3.121 | 3.122 | 3.123 | 3.124 | 3.125 | 3.126 | 3.127 | 3.128 | 3.129 | 3.130 | 3.131 | 3.132 | 3.133 | 3.134 | 3.135 | 3.136 | 3.137 | 3.138 | 3.139 | 3.140 | 3.141 | 3.142 | 3.143 | 3.144 | 3.145 | 3.146 | 3.147 | 3.148 | 3.149 | 3.150 | 3.151 | 3.152 | 3.153 | 3.154 | 3.155 | 3.156 | 3.157 | 3.158 | 3.159 | 3.160 | 3.161 | 3.162 | 3.163 | 3.164 | 3.165 | 3.166 | 3.167 | 3.168 | 3.169 | 3.170 | 3.171 | 3.172 | 3.173 | 3.174 | 3.175 | 3.176 | 3.177 | 3.178 | 3.179 | 3.180 | 3.181 | 3.182 | 3.183 | 3.184 | 3.185 | 3.186 | 3.187 | 3.188 | 3.189 | 3.190 | 3.191 | 3.192 | 3.193 | 3.194 | 3.195 | 3.196 | 3.197 | 3.198 | 3.199 | 3.200 | 3.201 | 3.202 | 3.203 | 3.204 | 3.205 | 3.206 | 3.207 | 3.208 | 3.209 | 3.210 | 3.211 | 3.212 | 3.213 | 3.214 | 3.215 | 3.216 | 3.217 | 3.218 | 3.219 | 3.220 | 3.221 | 3.222 | 3.223 | 3.224 | 3.225 | 3.226 | 3.227 | 3.228 | 3.229 | 3.230 | 3.231 | 3.232 | 3.233 | 3.234 | 3.235 | 3.236 | 3.237 | 3.238 | 3.239 | 3.240 | 3.241 | 3.242 | 3.243 | 3.244 | 3.245 | 3.246 | 3.247 | 3.248 | 3.249 | 3.250 | 3.251 | 3.252 | 3.253 | 3.254 | 3.255 | 3.256 | 3.257 | 3.258 | 3.259 | 3.260 | 3.261 | 3.262 | 3.263 | 3.264 | 3.265 | 3.266 | 3.267 | 3.268 | 3.269 | 3.270 | 3.271 | 3.272 | 3.273 | 3.274 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Date | 2017-12-15 | 2017-12-22 | 2017-12-29 | 2018-01-05 | 2018-01-12 | 2018-01-19 | 2018-01-26 | 2018-02-02 | 2018-02-09 | 2018-02-16 | 2018-02-23 | 2018-03-01 | 2018-03-08 | 2018-03-15 | 2018-03-22 | 2018-03-29 | 2018-04-06 | 2018-04-13 | 2018-04-20 | 2018-04-27 | 2018-05-04 | 2018-05-11 | 2018-05-18 | 2018-05-25 | 2018-06-01 | 2018-06-08 | 2018-06-15 | 2018-06-22 | 2018-06-29 | 2018-07-06 | 2018-07-13 | 2018-07-20 | 2018-07-27 | 2018-08-03 | 2018-08-10 | 2018-08-17 | 2018-08-24 | 2018-08-31 | 2018-09-07 | 2018-09-14 | 2018-09-21 | 2018-09-28 | 2018-10-05 | 2018-10-12 | 2018-10-19 | 2018-10-26 | 2018-11-02 | 2018-11-09 | 2018-11-16 | 2018-11-23 | 2018-11-30 | 2018-12-07 | 2018-12-14 | 2018-12-21 | 2018-12-28 | 2019-01-04 | 2019-01-11 | 2019-01-18 | 2019-01-25 | 2019-02-01 | 2019-02-08 | 2019-02-15 | 2019-02-22 | 2019-03-01 | 2019-03-08 | 2019-03-15 | 2019-03-22 | 2019-03-29 | 2019-04-05 | 2019-04-12 | 2019-04-19 | 2019-04-26 | 2019-05-03 | 2019-05-10 | 2019-05-17 | 2019-05-24 | 2019-05-31 | 2019-06-07 | 2019-06-14 | 2019-06-21 | 2019-06-28 | 2019-07-05 | 2019-07-12 | 2019-07-19 | 2019-07-26 | 2019-08-02 | 2019-08-09 | 2019-08-16 | 2019-08-23 | 2019-08-28 | 2019-09-04 | 2019-09-11 | 2019-09-19 | 2019-09-25 | 2019-10-03 | 2019-10-09 | 2019-10-16 | 2019-10-23 | 2019-10-30 | 2019-11-06 | 2019-11-13 | 2019-11-20 | 2019-11-27 | 2019-12-04 | 2019-12-11 | 2019-12-18 | 2019-12-25 | 2020-01-01 | 2020-01-08 | 2020-01-15 | 2020-01-22 | 2020-01-29 | 2020-02-05 | 2020-02-12 | 2020-02-19 | 2020-02-26 | 2020-03-04 | 2020-03-11 | 2020-03-18 | 2020-03-25 | 2020-04-01 | 2020-04-08 | 2020-04-15 | 2020-04-22 | 2020-04-29 | 2020-05-06 | 2020-05-13 | 2020-05-20 | 2020-05-27 | 2020-06-03 | 2020-06-10 | 2020-06-17 | 2020-06-24 | 2020-07-01 | 2020-07-08 | 2020-07-15 | 2020-07-22 | 2020-07-29 | 2020-08-05 | 2020-08-12 | 2020-08-19 | 2020-08-26 | 2020-09-02 | 2020-09-09 | 2020-09-16 | 2020-09-23 | 2020-09-30 | 2020-10-07 | 2020-10-14 | 2020-10-21 | 2020-10-28 | 2020-11-04 | 2020-11-11 | 2020-11-18 | 2020-11-25 | 2020-12-02 | 2020-12-09 | 2020-12-16 | 2020-12-23 | 2020-12-30 | 2021-01-06 | 2021-01-13 | 2021-01-20 | 2021-01-27 | 2021-02-03 | 2021-02-10 | 2021-02-17 | 2021-02-24 | 2021-03-03 | 2021-03-10 | 2021-03-17 | 2021-03-24 | 2021-03-31 | 2021-04-07 | 2021-04-14 | 2021-04-21 | 2021-04-28 | 2021-05-05 | 2021-05-12 | 2021-05-19 | 2021-05-26 | 2021-06-02 | 2021-06-09 | 2021-06-16 | 2021-06-23 | 2021-06-30 | 2021-07-07 | 2021-07-14 | 2021-07-21 | 2021-07-28 | 2021-08-04 | 2021-08-11 | 2021-08-18 | 2021-08-25 | 2021-09-01 | 2021-09-08 | 2021-09-15 | 2021-09-22 | 2021-09-29 | 2021-10-06 | 2021-10-13 | 2021-10-20 | 2021-10-27 | 2021-11-03 | 2021-11-10 | 2021-11-17 | 2021-11-24 | 2021-12-01 | 2021-12-08 | 2021-12-15 | 2021-12-22 | 2021-12-29 | 2022-01-05 | 2022-01-12 | 2022-01-19 | 2022-01-26 | 2022-02-02 | 2022-02-09 | 2022-02-16 | 2022-02-23 | 2022-03-02 | 2022-03-09 | 2022-03-16 | 2022-03-23 | 2022-03-30 | 2022-04-06 | 2022-04-13 | 2022-04-20 | 2022-04-27 | 2022-05-04 | 2022-05-11 | 2022-05-18 | 2022-05-25 | 2022-06-01 | 2022-06-08 | 2022-06-15 | 2022-06-22 | 2022-06-29 | 2022-07-06 | 2022-07-13 | 2022-07-20 | 2022-07-27 | 2022-08-03 | 2022-08-10 | 2022-08-17 | 2022-08-24 | 2022-08-31 | 2022-09-07 | 2022-09-14 | 2022-09-21 | 2022-09-28 | 2022-10-05 | 2022-10-12 | 2022-10-19 | 2022-10-26 | 2022-11-02 | 2022-11-09 | 2022-11-16 | 2022-11-23 | 2022-11-30 | 2022-12-07 | 2022-12-14 | 2022-12-21 | 2022-12-28 | 2023-01-04 | 2023-01-11 | 2023-01-18 | 2023-01-25 | 2023-02-01 | 2023-02-08 | 2023-02-15 | 2023-02-22 | 2023-03-01 | 2023-03-08 | 2023-03-15 |
Parents
This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
---|---|---|---|---|---|
NR_4.0_26150.2 | NR_4.0_26150.1 | 3.0 | (66) 3CCL|1|0, 1Q81|1|A, 3CXC|1|0, 1VQ9|1|0, 1YJ9|1|0, 1K73|1|A, 3CCE|1|0, 1NJI|1|A, 3CME|1|0, 1VQ7|1|0, 1YIT|1|0, 1JJ2|1|0, 3CC7|1|0, 1N8R|1|A, 3CD6|1|0, 1VQ5|1|0, 1YI2|1|0, 1FFZ|1|A, 3CC2|1|0, 1M1K|1|A, 3CCV|1|0, 1VQ4|1|0, 3I56|1|0, 1W2B|1|0, 2QA4|1|0, 1KD1|1|A, 3CCS|1|0, 1QVG|1|0, 3I55|1|0, 1VQP|1|0, 4V9F|1|0, 2OTL|1|0, 1KC8|1|A, 3CCQ|1|0, 1Q86|1|A, 3G6E|1|0, 1VQN|1|0, 3CCM|1|0, 1Q82|1|A, 1YJN|1|0, 1K8A|1|A, 3CCJ|1|0, 1Q7Y|1|A, 3CPW|1|0, 1VQ8|1|0, 3CMA|1|0, 1VQ6|1|0, 1YIJ|1|0, 1FG0|1|A, 3CC4|1|0, 1M90|1|A, 1YHQ|1|0, 1FFK|1|0, 2QEX|1|0, 1KQS|1|0, 3CCU|1|0, 1S72|1|0, 3CCR|1|0, 1QVF|1|0, 3G71|1|0, 1VQO|1|0, 3OW2|1|0, 1K9M|1|A, 3G4S|1|0, 1VQK|1|0, 2OTJ|1|0 | (0) | (3) 1VQM|1|0, 1VQL|1|0, 1YJW|1|0 |
Children
This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
---|
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5
#S - ordering by similarity (same as in the heat map).#S | PDB | Title | Method | Resolution | Length |
---|---|---|---|---|---|
1 | 2QEX|1|0 | Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 2.9 | 2749 |
2 | 2QA4|1|0 | A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunit | X-RAY DIFFRACTION | 3 | 2749 |
3 | 1YJ9|1|0 | Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22 | X-RAY DIFFRACTION | 2.8 | 2750 |
4 | 1VQ4|1|0 | The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.7 | 2749 |
5 | 1QVG|1|0 | Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.9 | 2754 |
6 | 2OTL|1|0 | Girodazole bound to the large subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.7 | 2749 |
7 | 1YJN|1|0 | Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 3 | 2749 |
8 | 1YIT|1|0 | Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.8 | 2749 |
9 | 1YIJ|1|0 | Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.6 | 2749 |
10 | 1YI2|1|0 | Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.65 | 2749 |
11 | 1VQ6|1|0 | The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.7 | 2749 |
12 | 1Q86|1|A | Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit. | X-RAY DIFFRACTION | 3 | 2754 |
13 | 3I56|1|0 | Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit | X-RAY DIFFRACTION | 2.9 | 2749 |
14 | 3CCL|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model. | X-RAY DIFFRACTION | 2.9 | 2749 |
15 | 3CCQ|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488U | X-RAY DIFFRACTION | 2.9 | 2749 |
16 | 3CC7|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487U | X-RAY DIFFRACTION | 2.7 | 2749 |
17 | 3CCE|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535A | X-RAY DIFFRACTION | 2.75 | 2749 |
18 | 3CCU|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482C | X-RAY DIFFRACTION | 2.8 | 2749 |
19 | 3CCV|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616A | X-RAY DIFFRACTION | 2.9 | 2749 |
20 | 3CC4|1|0 | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 2.7 | 2749 |
21 | 3G71|1|0 | Co-crystal structure of Bruceantin bound to the large ribosomal subunit | X-RAY DIFFRACTION | 2.85 | 2749 |
22 | 2OTJ|1|0 | 13-deoxytedanolide bound to the large subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.9 | 2749 |
23 | 3CC2|1|0 | The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-Proteins | X-RAY DIFFRACTION | 2.4 | 2749 |
24 | 1YHQ|1|0 | Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.4 | 2749 |
25 | 3G6E|1|0 | Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit | X-RAY DIFFRACTION | 2.7 | 2749 |
26 | 3I55|1|0 | Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit | X-RAY DIFFRACTION | 3.11 | 2749 |
27 | 3CD6|1|0 | Co-cystal of large Ribosomal Subunit mutant G2616A with CC-Puromycin | X-RAY DIFFRACTION | 2.75 | 2749 |
28 | 3CCS|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482A | X-RAY DIFFRACTION | 2.95 | 2749 |
29 | 3CCR|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model. | X-RAY DIFFRACTION | 3 | 2749 |
30 | 3CCJ|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534U | X-RAY DIFFRACTION | 3.3 | 2749 |
31 | 3G4S|1|0 | Co-crystal structure of Tiamulin bound to the large ribosomal subunit | X-RAY DIFFRACTION | 3.2 | 2749 |
32 | 3CCM|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611U | X-RAY DIFFRACTION | 2.55 | 2749 |
33 | 1VQO|1|0 | The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortui | X-RAY DIFFRACTION | 2.2 | 2749 |
34 | 1VQK|1|0 | The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.3 | 2749 |
35 | 1VQ9|1|0 | The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.4 | 2749 |
36 | 1VQ8|1|0 | The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.2 | 2749 |
37 | 1VQN|1|0 | The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.4 | 2749 |
38 | 1VQP|1|0 | The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.25 | 2749 |
39 | 3CMA|1|0 | The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.8 | 2749 |
40 | 3CME|1|0 | The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.95 | 2749 |
41 | 3OW2|1|0 | Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal Subunit | X-RAY DIFFRACTION | 2.7 | 2754 |
42 | 3CPW|1|0 | The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI | X-RAY DIFFRACTION | 2.7 | 2754 |
43 | 1KQS|1|0 | The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein Synthesis | X-RAY DIFFRACTION | 3.1 | 2754 |
44 | 1N8R|1|A | Structure of large ribosomal subunit in complex with virginiamycin M | X-RAY DIFFRACTION | 3 | 2754 |
45 | 1Q82|1|A | Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunit | X-RAY DIFFRACTION | 2.98 | 2754 |
46 | 1KC8|1|A | Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 3.01 | 2754 |
47 | 1K8A|1|A | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3 | 2754 |
48 | 1KD1|1|A | Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3 | 2754 |
49 | 1K9M|1|A | Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3 | 2754 |
50 | 1M1K|1|A | Co-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3.2 | 2754 |
51 | 1QVF|1|0 | Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3.1 | 2754 |
52 | 1S72|1|0 | REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION | X-RAY DIFFRACTION | 2.4 | 2749 |
53 | 1JJ2|1|0 | Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution | X-RAY DIFFRACTION | 2.4 | 2754 |
54 | 1K73|1|A | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 3.01 | 2754 |
55 | 1NJI|1|A | Structure of chloramphenicol bound to the 50S ribosomal subunit | X-RAY DIFFRACTION | 3 | 2754 |
56 | 1M90|1|A | Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunit | X-RAY DIFFRACTION | 2.8 | 2754 |
57 | 3CXC|1|0 | The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortui | X-RAY DIFFRACTION | 3 | 2754 |
58 | 1VQ5|1|0 | The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.6 | 2749 |
59 | 1VQ7|1|0 | The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.5 | 2749 |
60 | 1Q7Y|1|A | Crystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunit | X-RAY DIFFRACTION | 3.2 | 2754 |
61 | 1Q81|1|A | Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit. | X-RAY DIFFRACTION | 2.95 | 2754 |
62 | 1W2B|1|0 | Trigger Factor ribosome binding domain in complex with 50S | X-RAY DIFFRACTION | 3.5 | 2754 |
63 | 1FFK|1|0 | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | X-RAY DIFFRACTION | 2.4 | 2706 |
64 | 4V9F|1|0 | The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteins | X-RAY DIFFRACTION | 2.4 | 2803 |
65 | 1FG0|1|A | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | X-RAY DIFFRACTION | 3 | 496 |
66 | 1FFZ|1|A | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | X-RAY DIFFRACTION | 3.2 | 496 |