#PDBTitleRNA source organismCompoundsMethodResolutionDate
11S72|0 (rep)REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTIONHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42004-06-15
21FFK|0CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTIONHaloarcula marismortui23S RRNA, RIBOSOMAL PROTEIN L6, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32E, RIBOSOMAL PROTEIN L37AE, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44EX-RAY DIFFRACTION2.42000-08-14
31FFZ|ALARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCINHaloarcula marismortui23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU))X-RAY DIFFRACTION3.22000-08-28
41FG0|ALARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUNDHaloarcula marismortui23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'X-RAY DIFFRACTION32000-08-28
51JJ2|0Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom ResolutionHaloarcula marismortui23S RRNA, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32E, RIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37EX-RAY DIFFRACTION2.42001-08-01
61K73|ACo-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION3.012003-07-22
71K8A|ACo-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortuiHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION32002-07-19
81K9M|ACo-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortuiHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION32002-07-19
91KC8|ACo-crystal Structure of Blasticidin S Bound to the 50S Ribosomal SubunitHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION3.012003-07-22
101KD1|ACo-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortuiHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION32002-07-19
111KQS|0The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein SynthesisHaloarcula marismortui23S RRNA, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, CCA, CC-Pmn-pcb, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32E, RIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37EX-RAY DIFFRACTION3.12002-02-22
121M1K|ACo-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortuiHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION3.22002-07-19
131M90|ACo-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunitHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, CCA, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION2.82002-09-06
141N8R|AStructure of large ribosomal subunit in complex with virginiamycin MHaloarcula marismortui50S ribosomal protein L37AE, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 23S ribosomal RNA, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, 50S ribosomal protein L10e, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18E, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31E, 50S ribosomal protein L32EX-RAY DIFFRACTION32003-07-22
151NJI|AStructure of chloramphenicol bound to the 50S ribosomal subunitHaloarcula marismortui50S ribosomal protein L37AE, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 23S ribosomal RNA, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, 50S ribosomal protein L10e, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18E, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31E, 50S ribosomal protein L32EX-RAY DIFFRACTION32003-07-22
161Q7Y|ACrystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunitHaloarcula marismortuiL37Ae 50S ribosomal protein, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, CCdA-P-Puromycin, 23S ribosomal rna, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32EX-RAY DIFFRACTION3.22003-10-07
171Q81|ACrystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.Haloarcula marismortuiL37Ae 50S ribosomal protein, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, minihelix-puromycin, 23S ribosomal rna, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32EX-RAY DIFFRACTION2.952003-10-07
181Q82|ACrystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunitHaloarcula marismortuiL37Ae 50S ribosomal protein, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, CC-puromycin, 23S ribosomal rna, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32EX-RAY DIFFRACTION2.982003-10-07
191Q86|ACrystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.Haloarcula marismortuiL37Ae 50S ribosomal protein, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, CCA-phenylalanine-cariotic-acid-biotin, CCA-phenylalanine-cariotic-acid-biotin, 23S ribosomal rna, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32EX-RAY DIFFRACTION32003-10-07
201QVF|0Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L39e, 50S ribosomal protein L44E, Deacylated tRNA minihelix, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S RIBOSOMAL PROTEIN L10E, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, L37Ae 50S ribosomal protein, 50S ribosomal protein L37eX-RAY DIFFRACTION3.12003-11-11
211QVG|0Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L39e, 50S ribosomal protein L44E, Oligonucleotide CCA, Oligonucleotide CCA, Oligonucleotide CCA, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S RIBOSOMAL PROTEIN L10E, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, L37Ae 50S ribosomal protein, 50S ribosomal protein L37eX-RAY DIFFRACTION2.92003-11-11
221VQ4|0The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3'), 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72005-11-29
231VQ5|0The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3'), 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.62005-11-29
241VQ6|0The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*(5AA)*(HFA))-3', 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72005-11-29
251VQ7|0The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3'), 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.52005-11-29
261VQ8|0The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.22005-11-29
271VQ9|0The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42005-11-29
281VQK|0The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.32005-11-29
291VQL|0The structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(PPU)*(TSE)*(DA)*CP*C)-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.32005-11-29
301VQM|0The structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(PPU)P*(PO2)P*(DA)P*C*C)-3'), 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.32005-11-29
311VQN|0The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(PPU)*(LOF))-3', 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42005-11-29
321VQO|0The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(PPU))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.22005-11-29
331VQP|0The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*(DC)P*(DC)P*(PPU)*(LOF)P*(PO2)P*AP*C*C)-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.252005-11-29
341W2B|0TRIGGER FACTOR RIBOSOME BINDING DOMAIN IN COMPLEX WITH 50SHaloarcula marismortui23S RRNA, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E LA, HLA, RIBOSOMAL PROTEIN L44E, TRIGGER FACTOR, 5S RRNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L5P HMAL5, HL13, RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L22P HMAL22, HL23, RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L23P, RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AE, RIBOSOMAL PROTEIN L37EX-RAY DIFFRACTION3.52004-09-02
351YHQ|0Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiHaloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42005-04-26
361YI2|0Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiHaloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.652005-04-26
371YIJ|0Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiHaloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.62005-04-26
381YIT|0Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula MarismortuiHaloarcula marismortui23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, VIRGINIAMYCIN S1, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AEX-RAY DIFFRACTION2.82005-04-26
391YJ9|0Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22Haloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.82005-04-26
401YJN|0Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiHaloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION32005-04-26
411YJW|0Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiHaloarcula marismortui23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, QUINUPRISTIN, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AEX-RAY DIFFRACTION2.92005-04-26
422OTJ|013-deoxytedanolide bound to the large subunit of Haloarcula marismortuiHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92007-04-03
432OTL|0Girodazole bound to the large subunit of Haloarcula marismortuiHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72007-04-03
442QA4|0A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunitHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, ACIDIC RIBOSOMAL PROTEIN P0 HOMO, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S RIBOSOMAL PROTEIN L31E, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION32008-04-01
452QEX|0Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal SubunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44e, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92008-09-30
463CC2|0The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-ProteinsHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42008-05-20
473CC4|0Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72008-05-20
483CC7|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487UHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72008-05-20
493CCE|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535AHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.752008-05-20
503CCJ|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534UHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72008-05-20
513CCL|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.Haloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92008-05-20
523CCM|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611UHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.552008-05-20
533CCQ|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488UHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92008-05-20
543CCR|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.Haloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION32008-05-20
553CCS|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482AHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.952008-05-20
563CCU|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482CHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.82008-05-20
573CCV|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616AHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92008-05-20
583CD6|0Co-cystal of large Ribosomal Subunit mutant G2616A with CC-PuromycinHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, RNA (5'-R(*CP*CP*(PPU))-3'), 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.752008-05-20
593CMA|0The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortuiHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, RNA (5'-R(*CP*CP*A)-3'), RNA (5'-R(*CP*CP*(8AN))-3'), 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.82008-09-23
603CME|0The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula MarismortuiHaloarcula marismortui50S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, RNA (5'-R(*C*CP*A)-3'), RNA (5'-R(*CP*CP*(8AN))-3'), 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.952008-09-23
613CPW|0The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUIHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3', 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37Ae, 50S ribosomal protein L37eX-RAY DIFFRACTION2.72008-07-22
623CXC|0The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortuiHaloarcula marismortui23S RIBOSOMAL RNA, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 5'-R(*CP*CP*A)-3', 5S RIBOSOMAL RNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32E, RIBOSOMAL PROTEIN L37AE, RIBOSOMAL PROTEIN L37EX-RAY DIFFRACTION32009-04-28
633G4S|0Co-crystal structure of Tiamulin bound to the large ribosomal subunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION3.22009-04-28
643G6E|0Co-crystal structure of Homoharringtonine bound to the large ribosomal subunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72009-04-28
653G71|0Co-crystal structure of Bruceantin bound to the large ribosomal subunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.852009-04-28
663I55|0Co-crystal structure of Mycalamide A Bound to the Large Ribosomal SubunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, DNA/RNA (5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*AP*CP*C)-3'), 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION3.112010-03-09
673I56|0Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal SubunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92010-03-09
683OW2|0Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal SubunitHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37Ae, 50S ribosomal protein L37eX-RAY DIFFRACTION2.72012-06-20
694HUB|0The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteinsHaloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44e, 50S ribosomal protein L12, 50S ribosomal protein L12, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42013-05-29

Release history

Release1.131.141.151.161.171.181.191.201.211.221.231.241.251.261.271.281.291.301.311.321.331.341.351.361.371.381.391.401.411.421.431.441.451.461.471.481.491.501.511.521.531.541.551.561.571.581.591.601.611.621.631.641.651.661.671.681.691.701.711.721.731.741.751.761.771.781.791.801.811.821.831.841.851.861.871.881.89
Date2013-06-012013-06-082013-06-152013-06-222013-06-292013-07-062013-07-132013-07-202013-07-272013-08-032013-08-102013-08-172013-08-242013-08-312013-09-072013-09-142013-09-212013-09-282013-10-052013-10-122013-10-192013-10-262013-11-092013-11-162013-11-232013-11-302013-12-072013-12-142013-12-212013-12-282014-01-042014-01-112014-01-182014-01-252014-02-012014-02-082014-02-152014-02-222014-03-012014-03-082014-03-172014-03-222014-03-292014-04-052014-04-122014-04-192014-04-262014-05-032014-05-102014-05-172014-05-312014-06-072014-06-132014-06-202014-06-272014-07-042014-07-182014-07-252014-08-012014-08-082014-08-152014-08-222014-08-292014-09-052014-09-122014-09-192014-09-262014-10-032014-10-102014-10-172014-10-242014-10-312014-11-072014-11-142014-11-212014-11-282014-12-05

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Children

This classDescendant classesRelease idIntersectionOnly in this classAdded to child

"Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other."

#S - ordering by similarity (same as in the heat map).
#SPDBTitleMethodResolutionLength
13CCM|0 (rep)Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611UX-RAY DIFFRACTION2.552923
21VQK|0The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32922
31VQO|0The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortuiX-RAY DIFFRACTION2.22922
41VQM|0The structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32922
51VQL|0The structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32922
61VQP|0The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.252922
71VQN|0The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.42922
81VQ8|0The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.22922
91VQ9|0The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.42922
103CMA|0The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.82923
113CME|0The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula MarismortuiX-RAY DIFFRACTION2.952923
123OW2|0Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal SubunitX-RAY DIFFRACTION2.72902
134HUB|0The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteinsX-RAY DIFFRACTION2.42910
141FFK|0CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTIONX-RAY DIFFRACTION2.42922
151W2B|0TRIGGER FACTOR RIBOSOME BINDING DOMAIN IN COMPLEX WITH 50SX-RAY DIFFRACTION3.52922
161YJ9|0Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22X-RAY DIFFRACTION2.82922
173I56|0Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal SubunitX-RAY DIFFRACTION2.92923
181YI2|0Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.652922
191YIJ|0Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.62922
201YJW|0Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.92922
211YIT|0Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.82922
221YJN|0Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION32922
232OTL|0Girodazole bound to the large subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.72922
241VQ4|0The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.72922
251VQ5|0The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.62922
261VQ7|0The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.52922
271VQ6|0The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.72922
281M90|ACo-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunitX-RAY DIFFRACTION2.82922
291Q86|ACrystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.X-RAY DIFFRACTION32922
303CXC|0The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortuiX-RAY DIFFRACTION32922
311QVG|0Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.92922
321Q7Y|ACrystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunitX-RAY DIFFRACTION3.22922
331Q81|ACrystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.X-RAY DIFFRACTION2.952922
341Q82|ACrystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunitX-RAY DIFFRACTION2.982922
351KC8|ACo-crystal Structure of Blasticidin S Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION3.012922
361N8R|AStructure of large ribosomal subunit in complex with virginiamycin MX-RAY DIFFRACTION32922
371KQS|0The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein SynthesisX-RAY DIFFRACTION3.12922
381K9M|ACo-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION32922
391K8A|ACo-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION32922
401KD1|ACo-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortuiX-RAY DIFFRACTION32922
411M1K|ACo-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION3.22922
421QVF|0Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION3.12922
431NJI|AStructure of chloramphenicol bound to the 50S ribosomal subunitX-RAY DIFFRACTION32922
441K73|ACo-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION3.012922
451JJ2|0Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom ResolutionX-RAY DIFFRACTION2.42922
461S72|0REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTIONX-RAY DIFFRACTION2.42922
473CC2|0The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-ProteinsX-RAY DIFFRACTION2.42923
481YHQ|0Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.42922
493CPW|0The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUIX-RAY DIFFRACTION2.72922
503CC4|0Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION2.72923
513G6E|0Co-crystal structure of Homoharringtonine bound to the large ribosomal subunitX-RAY DIFFRACTION2.72923
523G71|0Co-crystal structure of Bruceantin bound to the large ribosomal subunitX-RAY DIFFRACTION2.852923
532OTJ|013-deoxytedanolide bound to the large subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.92922
543CCV|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616AX-RAY DIFFRACTION2.92923
553CCE|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535AX-RAY DIFFRACTION2.752923
563CCU|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482CX-RAY DIFFRACTION2.82923
573CC7|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487UX-RAY DIFFRACTION2.72923
583CCQ|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488UX-RAY DIFFRACTION2.92923
593CCL|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.X-RAY DIFFRACTION2.92923
603CD6|0Co-cystal of large Ribosomal Subunit mutant G2616A with CC-PuromycinX-RAY DIFFRACTION2.752923
613CCS|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482AX-RAY DIFFRACTION2.952923
623CCR|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.X-RAY DIFFRACTION32923
633I55|0Co-crystal structure of Mycalamide A Bound to the Large Ribosomal SubunitX-RAY DIFFRACTION3.112923
643G4S|0Co-crystal structure of Tiamulin bound to the large ribosomal subunitX-RAY DIFFRACTION3.22923
653CCJ|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534UX-RAY DIFFRACTION2.72923
661FFZ|ALARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCINX-RAY DIFFRACTION3.2602
672QEX|0Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal SubunitX-RAY DIFFRACTION2.92772
681FG0|ALARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUNDX-RAY DIFFRACTION3602
692QA4|0A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunitX-RAY DIFFRACTION32922