#PDBTitleRNA source organismCompoundsMethodResolutionDate
11S72 (rep)REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTIONHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42004-06-15
21VQOThe structure of CCPMN bound to the large ribosomal subunit haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(PPU))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.22005-11-29
31VQPThe structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*(DC)P*(DC)P*(PPU)*(LOF)P*(PO2)P*AP*C*C)-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.252005-11-29
41VQ6The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*(5AA)*(HFA))-3', 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72005-11-29
51VQKThe structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.32005-11-29
63CC2The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-ProteinsHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42008-05-20
73CPWThe structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUIHALOARCULA MARISMORTUI23S RIBOSOMAL RNA, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3', 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37Ae, 50S ribosomal protein L37eX-RAY DIFFRACTION2.72008-07-22
83CCUStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482CHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.82008-05-20
91K73Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION3.012003-07-22
101JJ2Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom ResolutionHaloarcula marismortui23S RRNA, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32E, RIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37EX-RAY DIFFRACTION2.42001-08-01
111M90Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunitHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, CCA, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION2.82002-09-06
121VQ4The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3'), 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72005-11-29
131VQ8The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.22005-11-29
143CC4Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72008-05-20
151VQMThe structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(PPU)P*(PO2)P*(DA)P*C*C)-3'), 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.32005-11-29
161VQLThe structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(PPU)*(TSE)*(DA)*CP*C)-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.32005-11-29
173G6ECo-crystal structure of Homoharringtonine bound to the large ribosomal subunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 50S ribosomal protein L11P, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72009-04-28
181VQ9The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42005-11-29
193CCMStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611UHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.552008-05-20
201YHQCrystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiHaloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42005-04-26
211NJIStructure of chloramphenicol bound to the 50S ribosomal subunitHaloarcula marismortui50S ribosomal protein L37AE, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 23S ribosomal RNA, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, 50S ribosomal protein L10e, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18E, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31E, 50S ribosomal protein L32EX-RAY DIFFRACTION32003-07-22
221QVFStructure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L39e, 50S ribosomal protein L44E, Deacylated tRNA minihelix, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S RIBOSOMAL PROTEIN L10E, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, L37Ae 50S ribosomal protein, 50S ribosomal protein L37eX-RAY DIFFRACTION3.12003-11-11
231VQ7The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3'), 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.52005-11-29
241VQNThe structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-R(*CP*CP*(PPU)*(LOF))-3', 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3', 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42005-11-29
254HUBThe re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteinsHaloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44e, 50S ribosomal protein L12, 50S ribosomal protein L12, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.42013-05-29
261KQSThe Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein SynthesisHaloarcula marismortui23S RRNA, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, CCA, CC-Pmn-pcb, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32E, RIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37EX-RAY DIFFRACTION3.12002-02-22
273CXCThe structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortuiHaloarcula marismortui23S RIBOSOMAL RNA, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 5'-R(*CP*CP*A)-3', 5S RIBOSOMAL RNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32E, RIBOSOMAL PROTEIN L37AE, RIBOSOMAL PROTEIN L37EX-RAY DIFFRACTION32009-04-28
283CCVStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616AHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92008-05-20
291KC8Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal SubunitHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION3.012003-07-22
301VQ5The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3'), 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.62005-11-29
313CCQStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488UHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92008-05-20
323CC7Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487UHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72008-05-20
331YI2Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiHaloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.652005-04-26
341Q86Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.Haloarcula marismortuiL37Ae 50S ribosomal protein, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, CCA-phenylalanine-cariotic-acid-biotin, CCA-phenylalanine-cariotic-acid-biotin, 23S ribosomal rna, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32EX-RAY DIFFRACTION32003-10-07
353CCLStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.Haloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92008-05-20
361YITCrystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula MarismortuiHALOARCULA MARISMORTUI23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, VIRGINIAMYCIN S1, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AEX-RAY DIFFRACTION2.82005-04-26
371K9MCo-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortuiHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION32002-07-19
383OW2Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal SubunitHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37Ae, 50S ribosomal protein L37eX-RAY DIFFRACTION2.72012-06-20
393CMAThe structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortuiHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, RNA (5'-R(*CP*CP*A)-3'), RNA (5'-R(*CP*CP*(8AN))-3'), 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.82008-09-23
401YJWCrystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiHALOARCULA MARISMORTUI23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, QUINUPRISTIN, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AEX-RAY DIFFRACTION2.92005-04-26
411YIJCrystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiHaloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.62005-04-26
421N8RStructure of large ribosomal subunit in complex with virginiamycin MHaloarcula marismortui50S ribosomal protein L37AE, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 23S ribosomal RNA, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, 50S ribosomal protein L10e, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18E, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31E, 50S ribosomal protein L32EX-RAY DIFFRACTION32003-07-22
431FFKCRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTIONHaloarcula marismortui23S RRNA, RIBOSOMAL PROTEIN L6, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32E, RIBOSOMAL PROTEIN L37AE, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44EX-RAY DIFFRACTION2.42000-08-14
443G71Co-crystal structure of Bruceantin bound to the large ribosomal subunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 50S ribosomal protein L11P, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.852009-04-28
453CCEStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535AHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.752008-05-20
461Q82Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunitHaloarcula marismortuiL37Ae 50S ribosomal protein, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, CC-puromycin, 23S ribosomal rna, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32EX-RAY DIFFRACTION2.982003-10-07
471M1KCo-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortuiHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION3.22002-07-19
481YJNCrystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiHaloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION32005-04-26
492OTLGirodazole bound to the large subunit of Haloarcula marismortuiHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72007-04-03
501K8ACo-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortuiHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION32002-07-19
511QVGStructure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortuiHaloarcula marismortui23S ribosomal rna, 50S ribosomal protein L39e, 50S ribosomal protein L44E, Oligonucleotide CCA, Oligonucleotide CCA, Oligonucleotide CCA, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S RIBOSOMAL PROTEIN L10E, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, L37Ae 50S ribosomal protein, 50S ribosomal protein L37eX-RAY DIFFRACTION2.92003-11-11
523CD6Co-cystal of large Ribosomal Subunit mutant G2616A with CC-PuromycinHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, RNA (5'-R(*CP*CP*(PPU))-3'), 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.752008-05-20
531Q7YCrystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunitHaloarcula marismortuiL37Ae 50S ribosomal protein, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, CCdA-P-Puromycin, 23S ribosomal rna, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32EX-RAY DIFFRACTION3.22003-10-07
541Q81Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.Haloarcula marismortuiL37Ae 50S ribosomal protein, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, minihelix-puromycin, 23S ribosomal rna, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, L10 Ribosomal Protein, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, L15 Ribosomal Protein, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32EX-RAY DIFFRACTION2.952003-10-07
551KD1Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortuiHaloarcula marismortuiRIBOSOMAL PROTEIN L37Ae, RIBOSOMAL PROTEIN L37E, RIBOSOMAL PROTEIN L39E, RIBOSOMAL PROTEIN L44E, 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L3, RIBOSOMAL PROTEIN L4, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L7AE, RIBOSOMAL PROTEIN L10, RIBOSOMAL PROTEIN L10E, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L15, RIBOSOMAL PROTEIN L15E, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L18E, RIBOSOMAL PROTEIN L19E, RIBOSOMAL PROTEIN L21E, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L24E, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L31E, RIBOSOMAL PROTEIN L32EX-RAY DIFFRACTION32002-07-19
562OTJ13-deoxytedanolide bound to the large subunit of Haloarcula marismortuiHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92007-04-03
571YJ9Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22Haloarcula marismortui23S Ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S Ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4E, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S Ribosomal Protein L15E, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19E, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24E, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32E, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.82005-04-26
583I55Co-crystal structure of Mycalamide A Bound to the Large Ribosomal SubunitHaloarcula marismortui ATCC 4304923S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, DNA/RNA (5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*AP*CP*C)-3'), 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION3.112010-03-09
592QEXNegamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal SubunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44e, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, Acidic ribosomal protein P0 homolog, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92008-09-30
603I56Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal SubunitHaloarcula marismortui ATCC 4304923S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S ribosomal RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.92010-03-09
613CCSStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482AHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.952008-05-20
623CMEThe Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula MarismortuiHaloarcula marismortui50S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, RNA (5'-R(*C*CP*A)-3'), RNA (5'-R(*CP*CP*(8AN))-3'), 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.952008-09-23
633CCRStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.Haloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION32008-05-20
641W2BTRIGGER FACTOR RIBOSOME BINDING DOMAIN IN COMPLEX WITH 50SHALOARCULA MARISMORTUI23S RRNA, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E LA, HLA, RIBOSOMAL PROTEIN L44E, TRIGGER FACTOR, 5S RRNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L5P HMAL5, HL13, RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L22P HMAL22, HL23, RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L23P, RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AE, RIBOSOMAL PROTEIN L37EX-RAY DIFFRACTION3.52004-09-02
653CCJStructure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534UHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION2.72008-05-20
662QA4A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunitHaloarcula marismortui23S RIBOSOMAL RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 5S RIBOSOMAL RNA, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, ACIDIC RIBOSOMAL PROTEIN P0 HOMO, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S RIBOSOMAL PROTEIN L31E, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION32008-04-01
673G4SCo-crystal structure of Tiamulin bound to the large ribosomal subunitHaloarcula marismortui23S ribosomal RNA, 50S ribosomal protein L37e, 50S ribosomal protein L39e, 50S ribosomal protein L44E, 50S ribosomal protein L11P, 50S ribosomal protein L2P, 50S ribosomal protein L3P, 50S ribosomal protein L4P, 50S ribosomal protein L5P, 50S ribosomal protein L6P, 50S ribosomal protein L7Ae, 50S ribosomal protein L10E, 50S ribosomal protein L10e, 50S ribosomal protein L11P, 50S ribosomal protein L13P, 50S ribosomal protein L14P, 50S ribosomal protein L15P, 50S ribosomal protein L15e, 50S ribosomal protein L18P, 50S ribosomal protein L18e, 50S ribosomal protein L19e, 50S ribosomal protein L21e, 50S ribosomal protein L22P, 50S ribosomal protein L23P, 50S ribosomal protein L24P, 50S ribosomal protein L24e, 50S ribosomal protein L29P, 50S ribosomal protein L30P, 50S ribosomal protein L31e, 50S ribosomal protein L32e, 50S ribosomal protein L37AeX-RAY DIFFRACTION3.22009-04-28
681FG0LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUNDHaloarcula marismortui23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'X-RAY DIFFRACTION32000-08-28
691FFZLARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCINHaloarcula marismortui23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU))X-RAY DIFFRACTION3.22000-08-28

Release history

Release1.131.141.151.161.171.181.191.201.211.221.231.241.251.261.271.281.291.301.311.321.331.341.351.361.371.381.391.401.411.421.431.441.451.461.471.481.491.501.511.521.531.541.551.561.571.581.591.601.611.621.631.641.651.661.671.681.69
Date2013-06-012013-06-082013-06-152013-06-222013-06-292013-07-062013-07-132013-07-202013-07-272013-08-032013-08-102013-08-172013-08-242013-08-312013-09-072013-09-142013-09-212013-09-282013-10-052013-10-122013-10-192013-10-262013-11-092013-11-162013-11-232013-11-302013-12-072013-12-142013-12-212013-12-282014-01-042014-01-112014-01-182014-01-252014-02-012014-02-082014-02-152014-02-222014-03-012014-03-082014-03-172014-03-222014-03-292014-04-052014-04-122014-04-192014-04-262014-05-032014-05-102014-05-172014-05-312014-06-072014-06-132014-06-202014-06-272014-07-042014-07-18

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent
NR_all_00542.3NR_all_00542.21.131YHQ, 1VQ5, 3CXC, 1Q86, 3CPW, 1K73, 1YIJ, 3CMA, 1Q7Y, 1Q81, 1VQN, 1VQO, 1VQL, 1VQM, 1VQK, 2OTL, 1NJI, 1N8R, 1FG0, 3G4S, 3G6E, 1FFK, 3CCE, 1YIT, 1YJW, 3CD6, 1QVF, 3CCM, 3CCL, 3CCS, 3CCR, 3CCQ, 1QVG, 1FFZ, 3CCU, 1KQS, 1JJ2, 1YJ9, 1YJN, 3OW2, 1YI2, 2QA4, 1M1K, 3CME, 3CC2, 1Q82, 2OTJ, 3CC7, 1VQP, 1M90, 3CC4, 1K9M, 3G71, 3CCV, 1KC8, 1VQ8, 1KD1, 1VQ6, 1VQ7, 1VQ4, 1VQ9, 2QEX, 1S72, 3CCJ, 1W2B, 3I56, 3I55, 1K8A4HUB

Children

This classDescendant classesRelease idIntersectionOnly in this classAdded to child