#IFEStandardized nameMoleculeOrganismSourceRfamTitleMethodRes. ÅDate
11QWB|4|A (rep)sNRE26NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12Solution NMR2003-11-25

Release history

Release2.02.12.22.32.42.52.62.72.82.92.102.112.122.132.142.152.162.172.182.192.202.212.222.232.242.252.262.272.282.292.302.312.322.332.342.352.362.372.382.392.402.412.422.432.442.452.462.472.482.492.502.512.522.532.542.552.562.572.582.592.602.612.622.632.642.652.662.672.682.692.702.712.722.732.742.752.762.772.782.792.802.812.822.832.842.852.862.872.882.892.902.912.922.932.942.952.962.972.982.992.1002.1012.1022.1032.1042.1052.1062.1072.1082.1092.1102.1112.1122.1132.1142.1152.1162.1172.1182.1192.1202.1212.1222.1232.1242.1252.1262.1272.1282.1292.1302.1312.1322.1332.1342.1352.1362.1372.1382.1392.1402.1412.1422.1432.1442.1452.1462.1472.1482.1492.1502.1512.1522.1532.1542.1552.1562.1572.1583.03.13.23.33.43.53.63.73.83.93.103.113.123.133.143.153.163.173.183.193.203.213.223.233.243.253.263.273.283.293.303.313.323.333.343.353.363.373.383.393.403.413.423.433.443.453.463.473.483.493.503.513.523.533.543.553.563.573.583.593.603.613.623.633.643.653.663.673.683.693.703.713.723.733.743.753.763.773.783.793.803.813.823.833.843.853.863.873.883.893.903.913.923.933.943.953.963.973.983.993.1003.1013.1023.1033.1043.1053.1063.1073.1083.1093.1103.1113.1123.1133.1143.1153.1163.1173.1183.1193.1203.1213.1223.1233.1243.1253.1263.1273.1283.1293.1303.1313.1323.1333.1343.1353.1363.1373.1383.1393.1403.1413.1423.1433.1443.1453.1463.1473.1483.1493.1503.1513.1523.1533.1543.1553.1563.1573.1583.1593.1603.1613.1623.1633.1643.1653.1663.1673.1683.1693.1703.1713.1723.1733.1743.1753.1763.1773.1783.1793.1803.1813.1823.1833.1843.1853.1863.1873.1883.1893.1903.1913.1923.1933.1943.1953.1963.1973.1983.1993.2003.2013.2023.2033.2043.2053.2063.2073.2083.2093.2103.2113.2123.2133.2143.2153.2163.2173.2183.2193.2203.2213.2223.2233.2243.2253.2263.2273.2283.2293.2303.2313.2323.2333.2343.2353.2363.2373.2383.2393.2403.2413.2423.2433.2443.2453.2463.2473.2483.2493.2503.2513.2523.2533.2543.2553.2563.2573.2583.2593.2603.2613.2623.2633.2643.2653.2663.2673.2683.2693.2703.2713.2723.2733.2743.2753.2763.2773.2783.2793.2803.2813.2823.2833.2843.2853.2863.2873.2883.2893.2903.2913.2923.2933.2943.2953.2963.2973.2983.2993.3003.3013.3023.3033.3043.3053.3063.3073.3083.3093.3103.3113.3123.3133.3143.3153.3163.3173.3183.3193.3203.3213.3223.3233.3243.3253.3263.3273.3283.3293.3303.3313.3323.3333.3343.3353.3363.3373.3383.3393.3403.3413.3423.3433.3443.3453.3463.3473.3483.3493.3503.3513.3523.3533.3543.355
Date2014-12-052014-12-122014-12-192014-12-262015-01-022015-01-092015-01-162015-01-232015-01-302015-02-062015-02-132015-02-202015-02-272015-03-062015-03-132015-03-202015-03-272015-04-032015-04-102015-04-172015-04-242015-05-012015-05-082015-05-152015-05-222015-05-292015-06-052015-06-122015-06-192015-06-262015-07-032015-07-102015-07-172015-07-242015-07-312015-08-072015-08-142015-08-212015-08-282015-09-042015-09-112015-09-182015-09-252015-10-022015-10-092015-10-162015-10-232015-10-302015-11-062015-11-132015-11-202015-11-272015-12-042015-12-112015-12-182015-12-252016-01-012016-01-082016-01-152016-01-222016-01-292016-02-052016-02-122016-02-192016-02-262016-03-042016-03-112016-03-182016-03-252016-04-012016-04-082016-04-152016-04-222016-04-292016-05-062016-05-132016-05-202016-05-272016-06-032016-06-102016-06-172016-06-242016-07-012016-07-082016-07-152016-07-222016-07-292016-08-052016-08-122016-08-192016-08-262016-09-022016-09-092016-09-162016-09-232016-09-302016-10-072016-10-142016-10-212016-10-282016-11-042016-11-112016-11-182016-11-252016-12-022016-12-092016-12-162016-12-232016-12-302017-01-062017-01-132017-01-202017-01-272017-02-032017-02-102017-02-172017-02-242017-03-032017-03-102017-03-172017-03-242017-03-312017-04-112017-04-152017-04-262017-04-292017-05-092017-05-152017-05-202017-05-272017-06-072017-06-112017-06-212017-06-242017-06-282017-07-042017-07-102017-07-152017-07-262017-07-312017-08-052017-08-122017-08-192017-08-262017-09-032017-09-092017-09-162017-09-232017-09-302017-10-072017-10-142017-10-212017-10-282017-11-032017-11-102017-11-172017-11-242017-12-012017-12-082017-12-152017-12-222017-12-292018-01-052018-01-122018-01-192018-01-262018-02-022018-02-092018-02-162018-02-232018-03-012018-03-082018-03-152018-03-222018-03-292018-04-062018-04-132018-04-202018-04-272018-05-042018-05-112018-05-182018-05-252018-06-012018-06-082018-06-152018-06-222018-06-292018-07-062018-07-132018-07-202018-07-272018-08-032018-08-102018-08-172018-08-242018-08-312018-09-072018-09-142018-09-212018-09-282018-10-052018-10-122018-10-192018-10-262018-11-022018-11-092018-11-162018-11-232018-11-302018-12-072018-12-142018-12-212018-12-282019-01-042019-01-112019-01-182019-01-252019-02-012019-02-082019-02-152019-02-222019-03-012019-03-082019-03-152019-03-222019-03-292019-04-052019-04-122019-04-192019-04-262019-05-032019-05-102019-05-172019-05-242019-05-312019-06-072019-06-142019-06-212019-06-282019-07-052019-07-122019-07-192019-07-262019-08-022019-08-092019-08-162019-08-232019-08-282019-09-042019-09-112019-09-192019-09-252019-10-032019-10-092019-10-162019-10-232019-10-302019-11-062019-11-132019-11-202019-11-272019-12-042019-12-112019-12-182019-12-252020-01-012020-01-082020-01-152020-01-222020-01-292020-02-052020-02-122020-02-192020-02-262020-03-042020-03-112020-03-182020-03-252020-04-012020-04-082020-04-152020-04-222020-04-292020-05-062020-05-132020-05-202020-05-272020-06-032020-06-102020-06-172020-06-242020-07-012020-07-082020-07-152020-07-222020-07-292020-08-052020-08-122020-08-192020-08-262020-09-022020-09-092020-09-162020-09-232020-09-302020-10-072020-10-142020-10-212020-10-282020-11-042020-11-112020-11-182020-11-252020-12-022020-12-092020-12-162020-12-232020-12-302021-01-062021-01-132021-01-202021-01-272021-02-032021-02-102021-02-172021-02-242021-03-032021-03-102021-03-172021-03-242021-03-312021-04-072021-04-142021-04-212021-04-282021-05-052021-05-122021-05-192021-05-262021-06-022021-06-092021-06-162021-06-232021-06-302021-07-072021-07-142021-07-212021-07-282021-08-042021-08-112021-08-182021-08-252021-09-012021-09-082021-09-152021-09-222021-09-292021-10-062021-10-132021-10-202021-10-272021-11-032021-11-102021-11-172021-11-242021-12-012021-12-082021-12-152021-12-222021-12-292022-01-052022-01-122022-01-192022-01-262022-02-022022-02-092022-02-162022-02-232022-03-022022-03-092022-03-162022-03-232022-03-302022-04-062022-04-132022-04-202022-04-272022-05-042022-05-112022-05-182022-05-252022-06-012022-06-082022-06-152022-06-222022-06-292022-07-062022-07-132022-07-202022-07-272022-08-032022-08-102022-08-172022-08-242022-08-312022-09-072022-09-142022-09-212022-09-282022-10-052022-10-122022-10-192022-10-262022-11-022022-11-092022-11-162022-11-232022-11-302022-12-072022-12-142022-12-212022-12-282023-01-042023-01-112023-01-182023-01-252023-02-012023-02-082023-02-152023-02-222023-03-012023-03-082023-03-152023-03-222023-03-292023-04-052023-04-122023-04-192023-04-262023-05-032023-05-102023-05-172023-05-242023-05-312023-06-072023-06-142023-06-212023-06-282023-07-052023-07-122023-07-192023-07-262023-08-022023-08-092023-08-162023-08-232023-08-302023-09-062023-09-132023-09-202023-09-272023-10-042023-10-112023-10-182023-10-252023-11-012023-11-082023-11-152023-11-242023-11-292023-12-062023-12-132023-12-202023-12-272024-01-032024-01-102024-01-172024-01-242024-01-312024-02-072024-02-142024-02-212024-02-282024-03-062024-03-132024-03-202024-03-272024-04-032024-04-102024-04-172024-04-242024-05-012024-05-082024-05-152024-05-222024-05-292024-06-052024-06-122024-06-192024-06-262024-07-032024-07-102024-07-172024-07-252024-07-312024-08-072024-08-142024-08-212024-08-282024-09-042024-09-112024-09-182024-09-252024-10-02

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child

Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.

#SViewPDBTitleMethodResolutionLength
11QWB|4|ANMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12SOLUTION NMR26

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.


Coloring options:

Copyright 2024 BGSU RNA group. Page generated in 0.0276 s