#PDBTitleRNA source organismCompoundsMethodResolutionDate
14NFO (rep)Crystal Structure Analysis of the 16mer GCAGACUUAAGUCUGCGCAGACUUAAGUCUGC, GCAGACUUAAGUCUGC, GCAGACUUAAGUCUGCX-RAY DIFFRACTION1.962014-07-02
21Z7FCrystal structure of 16 base pair RNA duplex containing a C-A mismatch5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*UP*CP*UP*GP*C)-3', 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*UP*CP*UP*GP*C)-3', 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*UP*CP*UP*GP*C)-3'X-RAY DIFFRACTION2.12005-10-18
34NFPCrystal Structure Analysis of the 16mer GCAGNCUUAAGUCUGC containing 8-aza-7-deaza-7-ethynyl AdenosineGCAG(A7E)CUUAAGUCUGC, GCAG(A7E)CUUAAGUCUGC, GCAG(A7E)CUUAAGUCUGCX-RAY DIFFRACTION1.852014-07-02
44NFQCrystal Structure Analysis of the 16mer GCAGNCUUAAGUCUGC containing 7-triazolyl-8-aza-7-deazaadenosineGCAG(7AT)CUUAAGUCUGC, GCAG(7AT)CUUAAGUCUGC, GCAG(7AT)CUUAAGUCUGCX-RAY DIFFRACTION1.72014-07-02

Release history

Release1.681.691.701.711.721.731.741.751.761.771.781.791.801.811.821.831.841.851.86
Date2014-07-042014-07-182014-07-252014-08-012014-08-082014-08-152014-08-222014-08-292014-09-052014-09-122014-09-192014-09-262014-10-032014-10-102014-10-172014-10-242014-10-312014-11-072014-11-14

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent
NR_all_51063.1NR_all_44062.11.681Z7F4NFO, 4NFP, 4NFQ

Children

This classDescendant classesRelease idIntersectionOnly in this classAdded to child