#PDBTitleRNA source organismCompoundsMethodResolutionDate
14NFO|A (rep)Crystal Structure Analysis of the 16mer GCAGACUUAAGUCUGCGCAGACUUAAGUCUGC, GCAGACUUAAGUCUGC, GCAGACUUAAGUCUGCX-RAY DIFFRACTION1.962014-07-02
21Z7F|ACrystal structure of 16 base pair RNA duplex containing a C-A mismatch5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*UP*CP*UP*GP*C)-3', 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*UP*CP*UP*GP*C)-3', 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*UP*CP*UP*GP*C)-3'X-RAY DIFFRACTION2.12005-10-18
34NFP|ACrystal Structure Analysis of the 16mer GCAGNCUUAAGUCUGC containing 8-aza-7-deaza-7-ethynyl AdenosineGCAG(A7E)CUUAAGUCUGC, GCAG(A7E)CUUAAGUCUGC, GCAG(A7E)CUUAAGUCUGCX-RAY DIFFRACTION1.852014-07-02
44NFQ|ACrystal Structure Analysis of the 16mer GCAGNCUUAAGUCUGC containing 7-triazolyl-8-aza-7-deazaadenosineGCAG(7AT)CUUAAGUCUGC, GCAG(7AT)CUUAAGUCUGC, GCAG(7AT)CUUAAGUCUGCX-RAY DIFFRACTION1.72014-07-02

Release history

Release1.681.691.701.711.721.731.741.751.761.771.781.791.801.811.821.831.841.851.861.871.881.89
Date2014-07-042014-07-182014-07-252014-08-012014-08-082014-08-152014-08-222014-08-292014-09-052014-09-122014-09-192014-09-262014-10-032014-10-102014-10-172014-10-242014-10-312014-11-072014-11-142014-11-212014-11-282014-12-05

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Children

This classDescendant classesRelease idIntersectionOnly in this classAdded to child

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5

#S - ordering by similarity (same as in the heat map).
#SPDBTitleMethodResolutionLength