#IFECompound(s)RNA source organismTitleMethodResolutionDate
11QWA|1|A (rep)18S ribosomal RNA, 5'ETSNMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.SOLUTION NMR2003-11-25
21RKJ|1|B5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*GP*AP*GP*UP*GP*CP*AP*UP*CP*C)-3'Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA targetSOLUTION NMR2004-04-27

Release history



This classParent classesRelease idIntersectionAdded to this classOnly in parent


This class Descendant classesRelease idIntersectionOnly in this classAdded to child
NR_all_70966.1NR_all_33176.12.93(1) 1RKJ|1|B(1) 1QWA|1|A(0)
NR_all_70966.1NR_all_52004.12.93(1) 1QWA|1|A(1) 1RKJ|1|B(0)

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5

#S - ordering by similarity (same as in the heat map).