#IFEStandardized nameMoleculeOrganismSourceRfamTitleMethodRes. Å#NTsDate
11QWA|1|A (rep)18S ribosomal RNA, 5'ETSNMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.Solution NMR212003-11-25
21RKJ|1|B5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*GP*AP*GP*UP*GP*CP*AP*UP*CP*C)-3'Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA targetSolution NMR212004-04-27

Release history

Release2.02.12.22.32.42.52.62.72.82.92.102.112.122.132.142.152.162.172.182.192.202.212.222.232.242.252.262.272.282.292.302.312.322.332.342.352.362.372.382.392.402.412.422.432.442.452.462.472.482.492.502.512.522.532.542.552.562.572.582.592.602.612.622.632.642.652.662.672.682.692.702.712.722.732.742.752.762.772.782.792.802.812.822.832.842.852.862.872.882.892.902.912.92
Date2014-12-052014-12-122014-12-192014-12-262015-01-022015-01-092015-01-162015-01-232015-01-302015-02-062015-02-132015-02-202015-02-272015-03-062015-03-132015-03-202015-03-272015-04-032015-04-102015-04-172015-04-242015-05-012015-05-082015-05-152015-05-222015-05-292015-06-052015-06-122015-06-192015-06-262015-07-032015-07-102015-07-172015-07-242015-07-312015-08-072015-08-142015-08-212015-08-282015-09-042015-09-112015-09-182015-09-252015-10-022015-10-092015-10-162015-10-232015-10-302015-11-062015-11-132015-11-202015-11-272015-12-042015-12-112015-12-182015-12-252016-01-012016-01-082016-01-152016-01-222016-01-292016-02-052016-02-122016-02-192016-02-262016-03-042016-03-112016-03-182016-03-252016-04-012016-04-082016-04-152016-04-222016-04-292016-05-062016-05-132016-05-202016-05-272016-06-032016-06-102016-06-172016-06-242016-07-012016-07-082016-07-152016-07-222016-07-292016-08-052016-08-122016-08-192016-08-262016-09-022016-09-09

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child
NR_all_70966.1NR_all_33176.12.93(1) 1RKJ|1|B(1) 1QWA|1|A(0)
NR_all_70966.1NR_all_52004.12.93(1) 1QWA|1|A(1) 1RKJ|1|B(0)

Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.

#SViewPDBTitleMethodResolution#NTs
11QWA|1|ANMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.SOLUTION NMR21
21RKJ|1|BSolution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA targetSOLUTION NMR21

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.


Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.0233 s