Equivalence class NR_all_70966.1 Obsolete
| # | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | #NTs | Date |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 1QWA|1|A (rep) | 18S ribosomal RNA, 5'ETS | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Solution NMR | 21 | 2003-11-25 | |||||
| 2 | 1RKJ|1|B | 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*GP*AP*GP*UP*GP*CP*AP*UP*CP*C)-3' | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target | Solution NMR | 21 | 2004-04-27 |
Release history
| Release | 2.0 | 2.1 | 2.2 | 2.3 | 2.4 | 2.5 | 2.6 | 2.7 | 2.8 | 2.9 | 2.10 | 2.11 | 2.12 | 2.13 | 2.14 | 2.15 | 2.16 | 2.17 | 2.18 | 2.19 | 2.20 | 2.21 | 2.22 | 2.23 | 2.24 | 2.25 | 2.26 | 2.27 | 2.28 | 2.29 | 2.30 | 2.31 | 2.32 | 2.33 | 2.34 | 2.35 | 2.36 | 2.37 | 2.38 | 2.39 | 2.40 | 2.41 | 2.42 | 2.43 | 2.44 | 2.45 | 2.46 | 2.47 | 2.48 | 2.49 | 2.50 | 2.51 | 2.52 | 2.53 | 2.54 | 2.55 | 2.56 | 2.57 | 2.58 | 2.59 | 2.60 | 2.61 | 2.62 | 2.63 | 2.64 | 2.65 | 2.66 | 2.67 | 2.68 | 2.69 | 2.70 | 2.71 | 2.72 | 2.73 | 2.74 | 2.75 | 2.76 | 2.77 | 2.78 | 2.79 | 2.80 | 2.81 | 2.82 | 2.83 | 2.84 | 2.85 | 2.86 | 2.87 | 2.88 | 2.89 | 2.90 | 2.91 | 2.92 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Date | 2014-12-05 | 2014-12-12 | 2014-12-19 | 2014-12-26 | 2015-01-02 | 2015-01-09 | 2015-01-16 | 2015-01-23 | 2015-01-30 | 2015-02-06 | 2015-02-13 | 2015-02-20 | 2015-02-27 | 2015-03-06 | 2015-03-13 | 2015-03-20 | 2015-03-27 | 2015-04-03 | 2015-04-10 | 2015-04-17 | 2015-04-24 | 2015-05-01 | 2015-05-08 | 2015-05-15 | 2015-05-22 | 2015-05-29 | 2015-06-05 | 2015-06-12 | 2015-06-19 | 2015-06-26 | 2015-07-03 | 2015-07-10 | 2015-07-17 | 2015-07-24 | 2015-07-31 | 2015-08-07 | 2015-08-14 | 2015-08-21 | 2015-08-28 | 2015-09-04 | 2015-09-11 | 2015-09-18 | 2015-09-25 | 2015-10-02 | 2015-10-09 | 2015-10-16 | 2015-10-23 | 2015-10-30 | 2015-11-06 | 2015-11-13 | 2015-11-20 | 2015-11-27 | 2015-12-04 | 2015-12-11 | 2015-12-18 | 2015-12-25 | 2016-01-01 | 2016-01-08 | 2016-01-15 | 2016-01-22 | 2016-01-29 | 2016-02-05 | 2016-02-12 | 2016-02-19 | 2016-02-26 | 2016-03-04 | 2016-03-11 | 2016-03-18 | 2016-03-25 | 2016-04-01 | 2016-04-08 | 2016-04-15 | 2016-04-22 | 2016-04-29 | 2016-05-06 | 2016-05-13 | 2016-05-20 | 2016-05-27 | 2016-06-03 | 2016-06-10 | 2016-06-17 | 2016-06-24 | 2016-07-01 | 2016-07-08 | 2016-07-15 | 2016-07-22 | 2016-07-29 | 2016-08-05 | 2016-08-12 | 2016-08-19 | 2016-08-26 | 2016-09-02 | 2016-09-09 |
Parents
| This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
|---|
Children
| This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
|---|---|---|---|---|---|
| NR_all_70966.1 | NR_all_33176.1 | 2.93 | (1) 1RKJ|1|B | (1) 1QWA|1|A | (0) |
| NR_all_70966.1 | NR_all_52004.1 | 2.93 | (1) 1QWA|1|A | (1) 1RKJ|1|B | (0) |
Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.
| #S | View | PDB | Title | Method | Resolution | #NTs |
|---|---|---|---|---|---|---|
| 1 | 1QWA|1|A | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | SOLUTION NMR | 21 | ||
| 2 | 1RKJ|1|B | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target | SOLUTION NMR | 21 |
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.
Coloring options: