#IFEStandardized nameMoleculeOrganismSourceRfamTitleMethodRes. ÅDate
11QWA|1|A (rep)18S ribosomal RNA, 5'ETSNMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.Solution NMR2003-11-25
21RKJ|1|B5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*GP*AP*GP*UP*GP*CP*AP*UP*CP*C)-3'Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA targetSolution NMR2004-04-27

Release history

Release2.02.12.22.32.42.52.62.72.82.92.102.112.122.132.142.152.162.172.182.192.202.212.222.232.242.252.262.272.282.292.302.312.322.332.342.352.362.372.382.392.402.412.422.432.442.452.462.472.482.492.502.512.522.532.542.552.562.572.582.592.602.612.622.632.642.652.662.672.682.692.702.712.722.732.742.752.762.772.782.792.802.812.822.832.842.852.862.872.882.892.902.912.92
Date2014-12-052014-12-122014-12-192014-12-262015-01-022015-01-092015-01-162015-01-232015-01-302015-02-062015-02-132015-02-202015-02-272015-03-062015-03-132015-03-202015-03-272015-04-032015-04-102015-04-172015-04-242015-05-012015-05-082015-05-152015-05-222015-05-292015-06-052015-06-122015-06-192015-06-262015-07-032015-07-102015-07-172015-07-242015-07-312015-08-072015-08-142015-08-212015-08-282015-09-042015-09-112015-09-182015-09-252015-10-022015-10-092015-10-162015-10-232015-10-302015-11-062015-11-132015-11-202015-11-272015-12-042015-12-112015-12-182015-12-252016-01-012016-01-082016-01-152016-01-222016-01-292016-02-052016-02-122016-02-192016-02-262016-03-042016-03-112016-03-182016-03-252016-04-012016-04-082016-04-152016-04-222016-04-292016-05-062016-05-132016-05-202016-05-272016-06-032016-06-102016-06-172016-06-242016-07-012016-07-082016-07-152016-07-222016-07-292016-08-052016-08-122016-08-192016-08-262016-09-022016-09-09

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child
NR_all_70966.1NR_all_33176.12.93(1) 1RKJ|1|B(1) 1QWA|1|A(0)
NR_all_70966.1NR_all_52004.12.93(1) 1QWA|1|A(1) 1RKJ|1|B(0)

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5

#S - ordering by similarity (same as in the heat map).
#SPDBTitleMethodResolutionLength
11QWA|1|ANMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.SOLUTION NMR21
21RKJ|1|BSolution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA targetSOLUTION NMR21
Copyright 2024 BGSU RNA group. Page generated in 0.0038 s