#IFECompound(s)RNA source organismTitleMethodResolutionDate
11R7W|12|A (rep)34-MERNMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGESOLUTION NMR2004-05-25

Release history

Release2.932.942.952.962.972.982.992.1002.1012.1022.1032.1042.1052.1062.1072.1082.1092.1102.1112.1122.1132.1142.1152.1162.1172.1182.1192.1202.1212.1222.1232.1242.1252.1262.1272.1282.1292.1302.1312.1322.1332.1342.1352.1362.1372.1382.1392.1402.1412.1422.1432.1442.1452.1462.1472.1482.1492.1502.1512.1522.1532.1542.1552.1562.1572.1583.03.13.23.33.43.53.63.73.83.93.103.113.123.133.143.153.163.173.183.193.203.213.223.233.243.253.263.273.283.293.303.313.323.333.343.353.363.373.383.393.403.413.423.433.443.453.463.473.483.493.503.513.523.533.543.553.563.573.583.593.603.613.623.633.643.653.663.673.683.693.703.713.723.733.743.753.763.773.783.793.803.813.823.833.843.853.863.873.883.893.903.913.923.933.943.953.963.973.983.993.1003.101
Date2016-09-162016-09-232016-09-302016-10-072016-10-142016-10-212016-10-282016-11-042016-11-112016-11-182016-11-252016-12-022016-12-092016-12-162016-12-232016-12-302017-01-062017-01-132017-01-202017-01-272017-02-032017-02-102017-02-172017-02-242017-03-032017-03-102017-03-172017-03-242017-03-312017-04-112017-04-152017-04-262017-04-292017-05-092017-05-152017-05-202017-05-272017-06-072017-06-112017-06-212017-06-242017-06-282017-07-042017-07-102017-07-152017-07-262017-07-312017-08-052017-08-122017-08-192017-08-262017-09-032017-09-092017-09-162017-09-232017-09-302017-10-072017-10-142017-10-212017-10-282017-11-032017-11-102017-11-172017-11-242017-12-012017-12-082017-12-152017-12-222017-12-292018-01-052018-01-122018-01-192018-01-262018-02-022018-02-092018-02-162018-02-232018-03-012018-03-082018-03-152018-03-222018-03-292018-04-062018-04-132018-04-202018-04-272018-05-042018-05-112018-05-182018-05-252018-06-012018-06-082018-06-152018-06-222018-06-292018-07-062018-07-132018-07-202018-07-272018-08-032018-08-102018-08-172018-08-242018-08-312018-09-072018-09-142018-09-212018-09-282018-10-052018-10-122018-10-192018-10-262018-11-022018-11-092018-11-162018-11-232018-11-302018-12-072018-12-142018-12-212018-12-282019-01-042019-01-112019-01-182019-01-252019-02-012019-02-082019-02-152019-02-222019-03-012019-03-082019-03-152019-03-222019-03-292019-04-052019-04-122019-04-192019-04-262019-05-032019-05-102019-05-172019-05-242019-05-312019-06-072019-06-142019-06-212019-06-282019-07-052019-07-122019-07-192019-07-262019-08-022019-08-092019-08-162019-08-232019-08-282019-09-042019-09-112019-09-192019-09-252019-10-032019-10-092019-10-162019-10-232019-10-302019-11-062019-11-132019-11-20

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent
NR_all_85024.1NR_all_14382.12.93(1) 1R7W|12|A(0) (1) 1R7Z|5|A

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5

#S - ordering by similarity (same as in the heat map).
#SPDBTitleMethodResolutionLength
11R7W|12|ANMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGESOLUTION NMR34