3D structure

PDB id
1FKA (explore in PDB, NAKB, or RNA 3D Hub)
Description
STRUCTURE OF FUNCTIONALLY ACTIVATED SMALL RIBOSOMAL SUBUNIT AT 3.3 A RESOLUTION
Experimental method
X-RAY DIFFRACTION
Resolution
3.3 Å

Loop

Sequence
CCGGCCAACUCCGUGCCAGCAGCCGCGGUAAUACGGAGGG
Length
40 nucleotides
Bulged bases
1FKA|1|A|C|492, 1FKA|1|A|A|493, 1FKA|1|A|A|494, 1FKA|1|A|G|501, 1FKA|1|A|A|507, 1FKA|1|A|G|514, 1FKA|1|A|U|515, 1FKA|1|A|A|516, 1FKA|1|A|A|517, 1FKA|1|A|U|518, 1FKA|1|A|A|519
QA status
Valid loop

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

1FKA|1|A|C|487
1FKA|1|A|C|488
1FKA|1|A|G|489
1FKA|1|A|G|490
1FKA|1|A|C|491
1FKA|1|A|C|492
1FKA|1|A|A|493
1FKA|1|A|A|494
1FKA|1|A|C|495
1FKA|1|A|U|496
1FKA|1|A|C|497
1FKA|1|A|C|498
1FKA|1|A|G|499
1FKA|1|A|U|500
1FKA|1|A|G|501
1FKA|1|A|C|502
1FKA|1|A|C|503
1FKA|1|A|A|504
1FKA|1|A|G|505
1FKA|1|A|C|506
1FKA|1|A|A|507
1FKA|1|A|G|508
1FKA|1|A|C|509
1FKA|1|A|C|510
1FKA|1|A|G|511
1FKA|1|A|C|512
1FKA|1|A|G|513
1FKA|1|A|G|514
1FKA|1|A|U|515
1FKA|1|A|A|516
1FKA|1|A|A|517
1FKA|1|A|U|518
1FKA|1|A|A|519
1FKA|1|A|C|520
1FKA|1|A|G|521
1FKA|1|A|G|522
1FKA|1|A|A|523
1FKA|1|A|G|524
1FKA|1|A|G|525
1FKA|1|A|G|526

Current chains

Chain A
16S RIBOSOMAL RNA

Nearby chains

Chain D
30S RIBOSOMAL PROTEIN S4
Chain E
30S RIBOSOMAL PROTEIN S5
Chain L
30S RIBOSOMAL PROTEIN S12

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.1028 s