3D structure

PDB id
1I97 (explore in PDB, NAKB, or RNA 3D Hub)
Description
CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM THERMUS THERMOPHILUS IN COMPLEX WITH TETRACYCLINE
Experimental method
X-RAY DIFFRACTION
Resolution
4.5 Å

Loop

Sequence
CGGAGUAGCGGUGAAAUGCGCAGAUACCG
Length
29 nucleotides
Bulged bases
1I97|1|A|A|685
QA status
Valid loop

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

1I97|1|A|C|664
1I97|1|A|G|665
1I97|1|A|G|666
1I97|1|A|A|667
1I97|1|A|G|668
1I97|1|A|U|669
1I97|1|A|A|670
1I97|1|A|G|671
1I97|1|A|C|672
1I97|1|A|G|673
1I97|1|A|G|674
1I97|1|A|U|675
1I97|1|A|G|676
1I97|1|A|A|677
1I97|1|A|A|678
1I97|1|A|A|679
1I97|1|A|U|680
1I97|1|A|G|681
1I97|1|A|C|682
1I97|1|A|G|683
1I97|1|A|C|684
1I97|1|A|A|685
1I97|1|A|G|686
1I97|1|A|A|687
1I97|1|A|U|688
1I97|1|A|A|689
1I97|1|A|C|690
1I97|1|A|C|691
1I97|1|A|G|692

Current chains

Chain A
16S RRNA

Nearby chains

Chain F
30S RIBOSOMAL PROTEIN S6
Chain G
30S RIBOSOMAL PROTEIN S7
Chain K
30S RIBOSOMAL PROTEIN S11

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.3767 s