3D structure

PDB id
5J3C (explore in PDB, NAKB, or RNA 3D Hub)
Description
Thermus thermophilus 70S termination complex containing E. coli RF1
Experimental method
X-RAY DIFFRACTION
Resolution
3.04 Å

Loop

Sequence
GGUGGCUUAGAAGCAGCCAUCC
Length
22 nucleotides
Bulged bases
5J3C|1|RA|A|1067, 5J3C|1|RA|G|1068, 5J3C|1|RA|C|1072, 5J3C|1|RA|C|1076
QA status
Missing nucleotides

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

5J3C|1|RA|G|1058
5J3C|1|RA|G|1059
5J3C|1|RA|U|1060
5J3C|1|RA|G|1062
5J3C|1|RA|G|1063
5J3C|1|RA|C|1064
5J3C|1|RA|U|1065
5J3C|1|RA|U|1066
5J3C|1|RA|A|1067
5J3C|1|RA|G|1068
5J3C|1|RA|A|1069
5J3C|1|RA|A|1070
5J3C|1|RA|G|1071
5J3C|1|RA|C|1072
5J3C|1|RA|A|1073
5J3C|1|RA|G|1074
5J3C|1|RA|C|1075
5J3C|1|RA|C|1076
5J3C|1|RA|A|1077
5J3C|1|RA|U|1078
5J3C|1|RA|C|1079
5J3C|1|RA|C|1080

Current chains

Chain RA
23S rRNA

Nearby chains

No other chains within 10Å

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.13 s