3D structure

PDB id
6PCQ (explore in PDB, NAKB, or RNA 3D Hub)
Description
E. coli 50S ribosome bound to VM2
Experimental method
ELECTRON MICROSCOPY
Resolution
2.6 Å

Loop

Sequence
GUGGGAGGCUUUGAAGUGUGGACGCCAGUCUGCAUGGAGCCGACCUUGAAAUACCAC
Length
57 nucleotides
Bulged bases
6PCQ|1|I|U|2122, 6PCQ|1|I|U|2131, 6PCQ|1|I|U|2132, 6PCQ|1|I|A|2135, 6PCQ|1|I|C|2145, 6PCQ|1|I|U|2151, 6PCQ|1|I|C|2160, 6PCQ|1|I|U|2172, 6PCQ|1|I|A|2173
QA status
Unknown status

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

6PCQ|1|I|G|2121
6PCQ|1|I|U|2122
6PCQ|1|I|G|2123
6PCQ|1|I|G|2124
6PCQ|1|I|G|2125
6PCQ|1|I|A|2126
6PCQ|1|I|G|2127
6PCQ|1|I|G|2128
6PCQ|1|I|C|2129
6PCQ|1|I|U|2130
6PCQ|1|I|U|2131
6PCQ|1|I|U|2132
6PCQ|1|I|G|2133
6PCQ|1|I|A|2134
6PCQ|1|I|A|2135
6PCQ|1|I|G|2136
6PCQ|1|I|U|2137
6PCQ|1|I|G|2138
6PCQ|1|I|U|2139
6PCQ|1|I|G|2140
6PCQ|1|I|G|2141
6PCQ|1|I|A|2142
6PCQ|1|I|C|2143
6PCQ|1|I|G|2144
6PCQ|1|I|C|2145
6PCQ|1|I|C|2146
6PCQ|1|I|A|2147
6PCQ|1|I|G|2148
6PCQ|1|I|U|2149
6PCQ|1|I|C|2150
6PCQ|1|I|U|2151
6PCQ|1|I|G|2152
6PCQ|1|I|C|2153
6PCQ|1|I|A|2154
6PCQ|1|I|U|2155
6PCQ|1|I|G|2156
6PCQ|1|I|G|2157
6PCQ|1|I|A|2158
6PCQ|1|I|G|2159
6PCQ|1|I|C|2160
6PCQ|1|I|C|2161
6PCQ|1|I|G|2162
6PCQ|1|I|A|2163
6PCQ|1|I|C|2164
6PCQ|1|I|C|2165
6PCQ|1|I|U|2166
6PCQ|1|I|U|2167
6PCQ|1|I|G|2168
6PCQ|1|I|A|2169
6PCQ|1|I|A|2170
6PCQ|1|I|A|2171
6PCQ|1|I|U|2172
6PCQ|1|I|A|2173
6PCQ|1|I|C|2174
6PCQ|1|I|C|2175
6PCQ|1|I|A|2176
6PCQ|1|I|C|2177

Current chains

Chain I
23S ribosomal RNA

Nearby chains

No other chains within 10Å

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.0725 s