3D structure

PDB id
8RPZ (explore in PDB, NAKB, or RNA 3D Hub)
Description
Escherichia coli 50S subunit in complex with the antimicrobial peptide Api88 - conformation I
Experimental method
ELECTRON MICROSCOPY
Resolution
2.44 Å

Loop

Sequence
UGUUGGCUUAGAAGCAGCCAUCA
Length
23 nucleotides
Bulged bases
8RPZ|1|A|U|1061, 8RPZ|1|A|A|1067, 8RPZ|1|A|A|1070, 8RPZ|1|A|G|1071, 8RPZ|1|A|C|1072
QA status
Unknown status

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

8RPZ|1|A|U|1058
8RPZ|1|A|G|1059
8RPZ|1|A|U|1060
8RPZ|1|A|U|1061
8RPZ|1|A|G|1062
8RPZ|1|A|G|1063
8RPZ|1|A|C|1064
8RPZ|1|A|U|1065
8RPZ|1|A|U|1066
8RPZ|1|A|A|1067
8RPZ|1|A|G|1068
8RPZ|1|A|A|1069
8RPZ|1|A|A|1070
8RPZ|1|A|G|1071
8RPZ|1|A|C|1072
8RPZ|1|A|A|1073
8RPZ|1|A|G|1074
8RPZ|1|A|C|1075
8RPZ|1|A|C|1076
8RPZ|1|A|A|1077
8RPZ|1|A|U|1078
8RPZ|1|A|C|1079
8RPZ|1|A|A|1080

Current chains

Chain A
23S ribosomal RNA

Nearby chains

Chain M
Large ribosomal subunit protein uL16

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.0444 s