3D structure

PDB id
1FKA (explore in PDB, NAKB, or RNA 3D Hub)
Description
STRUCTURE OF FUNCTIONALLY ACTIVATED SMALL RIBOSOMAL SUBUNIT AT 3.3 A RESOLUTION
Experimental method
X-RAY DIFFRACTION
Resolution
3.3 Å

Loop

Sequence
CUG*CCGAAGCCAGAACGCGUUAA*G
Length
24 nucleotides
Bulged bases
1FKA|1|A|A|842, 1FKA|1|A|A|843, 1FKA|1|A|C|844, 1FKA|1|A|G|845, 1FKA|1|A|C|846, 1FKA|1|A|G|847, 1FKA|1|A|U|848, 1FKA|1|A|U|849, 1FKA|1|A|A|850
QA status
Missing nucleotides

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

1FKA|1|A|C|810
1FKA|1|A|U|811
1FKA|1|A|G|814
*
1FKA|1|A|C|834
1FKA|1|A|C|835
1FKA|1|A|G|836
1FKA|1|A|A|837
1FKA|1|A|A|838
1FKA|1|A|G|839
1FKA|1|A|C|840
1FKA|1|A|C|846
1FKA|1|A|A|851
1FKA|1|A|G|852
1FKA|1|A|A|842
1FKA|1|A|A|843
1FKA|1|A|C|844
1FKA|1|A|G|845
1FKA|1|A|C|846
1FKA|1|A|G|847
1FKA|1|A|U|848
1FKA|1|A|U|849
1FKA|1|A|A|850
1FKA|1|A|A|851
*
1FKA|1|A|G|852

Current chains

Chain A
16S RIBOSOMAL RNA

Nearby chains

Chain E
30S RIBOSOMAL PROTEIN S5
Chain H
30S RIBOSOMAL PROTEIN S8

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.0449 s