3D structure

PDB id
1FKA (explore in PDB, NAKB, or RNA 3D Hub)
Description
STRUCTURE OF FUNCTIONALLY ACTIVATED SMALL RIBOSOMAL SUBUNIT AT 3.3 A RESOLUTION
Experimental method
X-RAY DIFFRACTION
Resolution
3.3 Å

Loop

Sequence
GUGCCUAAGACAUGC*GCAGUUAGGAAUCUUCCGCAAUGGGCGCAAGCCUGACGGAGCGAC
Length
60 nucleotides
Bulged bases
1FKA|1|A|C|48, 1FKA|1|A|C|49, 1FKA|1|A|U|50, 1FKA|1|A|A|51, 1FKA|1|A|A|52, 1FKA|1|A|U|363, 1FKA|1|A|G|376, 1FKA|1|A|C|377, 1FKA|1|A|A|378, 1FKA|1|A|A|379, 1FKA|1|A|A|385, 1FKA|1|A|A|393
QA status
Valid loop

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

1FKA|1|A|G|45
1FKA|1|A|U|46
1FKA|1|A|G|47
1FKA|1|A|C|48
1FKA|1|A|C|49
1FKA|1|A|U|50
1FKA|1|A|A|51
1FKA|1|A|A|52
1FKA|1|A|G|53
1FKA|1|A|A|54
1FKA|1|A|C|55
1FKA|1|A|A|56
1FKA|1|A|U|57
1FKA|1|A|G|58
1FKA|1|A|C|59
*
1FKA|1|A|G|350
1FKA|1|A|C|351
1FKA|1|A|A|352
1FKA|1|A|G|353
1FKA|1|A|U|354
1FKA|1|A|U|355
1FKA|1|A|A|356
1FKA|1|A|G|357
1FKA|1|A|G|358
1FKA|1|A|A|359
1FKA|1|A|A|360
1FKA|1|A|U|361
1FKA|1|A|C|362
1FKA|1|A|U|363
1FKA|1|A|U|364
1FKA|1|A|C|365
1FKA|1|A|C|366
1FKA|1|A|G|367
1FKA|1|A|C|368
1FKA|1|A|A|369
1FKA|1|A|A|370
1FKA|1|A|U|371
1FKA|1|A|G|372
1FKA|1|A|G|373
1FKA|1|A|G|374
1FKA|1|A|C|375
1FKA|1|A|G|376
1FKA|1|A|C|377
1FKA|1|A|A|378
1FKA|1|A|A|379
1FKA|1|A|G|380
1FKA|1|A|C|381
1FKA|1|A|C|382
1FKA|1|A|U|383
1FKA|1|A|G|384
1FKA|1|A|A|385
1FKA|1|A|C|386
1FKA|1|A|G|387
1FKA|1|A|G|388
1FKA|1|A|A|389
1FKA|1|A|G|390
1FKA|1|A|C|391
1FKA|1|A|G|392
1FKA|1|A|A|393
1FKA|1|A|C|394

Current chains

Chain A
16S RIBOSOMAL RNA

Nearby chains

Chain L
30S RIBOSOMAL PROTEIN S12
Chain P
30S RIBOSOMAL PROTEIN S16
Chain T
30S RIBOSOMAL PROTEIN S20

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.0898 s