3D structure

PDB id
5IMQ (explore in PDB, NAKB, or RNA 3D Hub)
Description
Structure of ribosome bound to cofactor at 3.8 angstrom resolution
Experimental method
ELECTRON MICROSCOPY
Resolution
3.8 Å

Loop

Sequence
UAAGUGGUAAAGG*CCGAAAAUGAUGCGGGGCUUAA
Length
35 nucleotides
Bulged bases
5IMQ|1|D|U|1026, 5IMQ|1|D|A|1127, 5IMQ|1|D|U|1130, 5IMQ|1|D|U|1141, 5IMQ|1|D|U|1142
QA status
Valid loop

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

5IMQ|1|D|U|1019
5IMQ|1|D|A|1020
5IMQ|1|D|A|1021
5IMQ|1|D|G|1022
5IMQ|1|D|U|1023
5IMQ|1|D|G|1024
5IMQ|1|D|G|1025
5IMQ|1|D|U|1026
5IMQ|1|D|A|1027
5IMQ|1|D|A|1028
5IMQ|1|D|A|1029
5IMQ|1|D|G|1030
5IMQ|1|D|G|1031
*
5IMQ|1|D|C|1123
5IMQ|1|D|C|1124
5IMQ|1|D|G|1125
5IMQ|1|D|A|1126
5IMQ|1|D|A|1127
5IMQ|1|D|A|1128
5IMQ|1|D|A|1129
5IMQ|1|D|U|1130
5IMQ|1|D|G|1131
5IMQ|1|D|A|1132
5IMQ|1|D|U|1133
5IMQ|1|D|G|1134
5IMQ|1|D|C|1135
5IMQ|1|D|G|1136
5IMQ|1|D|G|1137
5IMQ|1|D|G|1138
5IMQ|1|D|G|1139
5IMQ|1|D|C|1140
5IMQ|1|D|U|1141
5IMQ|1|D|U|1142
5IMQ|1|D|A|1142|||A
5IMQ|1|D|A|1143

Current chains

Chain D
23S ribosomal RNA

Nearby chains

Chain 1
50S ribosomal protein L36
Chain E
5S ribosomal RNA; 5S rRNA
Chain b
50S ribosomal protein L3
Chain e
50S ribosomal protein L6
Chain f
50S ribosomal protein L13
Chain i
50S ribosomal protein L16

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.1173 s