3D structure

PDB id
5WE6 (explore in PDB, NAKB, or RNA 3D Hub)
Description
70S ribosome-EF-Tu H84A complex with GTP and cognate tRNA
Experimental method
ELECTRON MICROSCOPY
Resolution
3.4 Å

Loop

Sequence
UUGAUGUGUAGGAUAGGUGG*CCACCCUUUAA
Length
31 nucleotides
Bulged bases
5WE6|1|A|U|2111, 5WE6|1|A|U|2118
QA status
Unknown status

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

5WE6|1|A|U|2105
5WE6|1|A|U|2106
5WE6|1|A|G|2107
5WE6|1|A|A|2108
5WE6|1|A|U|2109
5WE6|1|A|G|2110
5WE6|1|A|U|2111
5WE6|1|A|G|2112
5WE6|1|A|U|2113
5WE6|1|A|A|2114
5WE6|1|A|G|2115
5WE6|1|A|G|2116
5WE6|1|A|A|2117
5WE6|1|A|U|2118
5WE6|1|A|A|2119
5WE6|1|A|G|2120
5WE6|1|A|G|2121
5WE6|1|A|U|2122
5WE6|1|A|G|2123
5WE6|1|A|G|2124
*
5WE6|1|A|C|2174
5WE6|1|A|C|2175
5WE6|1|A|A|2176
5WE6|1|A|C|2177
5WE6|1|A|C|2178
5WE6|1|A|C|2179
5WE6|1|A|U|2180
5WE6|1|A|U|2181
5WE6|1|A|U|2182
5WE6|1|A|A|2183
5WE6|1|A|A|2184

Current chains

Chain A
23S rRNA

Nearby chains

Chain k
30S ribosomal protein S11
Chain w
Transfer RNA; tRNA

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.2053 s