IL_5WE6_184
3D structure
- PDB id
- 5WE6 (explore in PDB, NAKB, or RNA 3D Hub)
- Description
- 70S ribosome-EF-Tu H84A complex with GTP and cognate tRNA
- Experimental method
- ELECTRON MICROSCOPY
- Resolution
- 3.4 Å
Loop
- Sequence
- UUGAUGUGUAGGAUAGGUGG*CCACCCUUUAA
- Length
- 31 nucleotides
- Bulged bases
- 5WE6|1|A|U|2111, 5WE6|1|A|U|2118
- QA status
- Unknown status
Sequence variability
-
If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
- R3DSVS
Structural variability across Equivalence Class
-
The link below will give the loop's structural variability across the equivalence class for this chain.
- R3DMCS EC
Structural variability across Rfam
-
If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
- R3DMCS Rfam
- Detailed Annotation
- No text annotation
- Broad Annotation
- No text annotation
- Motif group
- Not in a motif group
- Basepair signature
- Not available
- Number of instances in this motif group
- 0
Unit IDs
5WE6|1|A|U|2105
5WE6|1|A|U|2106
5WE6|1|A|G|2107
5WE6|1|A|A|2108
5WE6|1|A|U|2109
5WE6|1|A|G|2110
5WE6|1|A|U|2111
5WE6|1|A|G|2112
5WE6|1|A|U|2113
5WE6|1|A|A|2114
5WE6|1|A|G|2115
5WE6|1|A|G|2116
5WE6|1|A|A|2117
5WE6|1|A|U|2118
5WE6|1|A|A|2119
5WE6|1|A|G|2120
5WE6|1|A|G|2121
5WE6|1|A|U|2122
5WE6|1|A|G|2123
5WE6|1|A|G|2124
*
5WE6|1|A|C|2174
5WE6|1|A|C|2175
5WE6|1|A|A|2176
5WE6|1|A|C|2177
5WE6|1|A|C|2178
5WE6|1|A|C|2179
5WE6|1|A|U|2180
5WE6|1|A|U|2181
5WE6|1|A|U|2182
5WE6|1|A|A|2183
5WE6|1|A|A|2184
Current chains
- Chain A
- 23S rRNA
Nearby chains
- Chain k
- 30S ribosomal protein S11
- Chain w
- Transfer RNA; tRNA
Coloring options: