3D structure

PDB id
6I7V (explore in PDB, NAKB, or RNA 3D Hub)
Description
Ribosomal protein paralogs bL31 and bL36
Experimental method
X-RAY DIFFRACTION
Resolution
2.9 Å

Loop

Sequence
AUGUGUAGGAUAGGUGGGAGG*CCGACCUUGAAAUACCACCCUU
Length
43 nucleotides
Bulged bases
6I7V|1|CA|U|2111, 6I7V|1|CA|A|2114, 6I7V|1|CA|G|2115, 6I7V|1|CA|U|2118, 6I7V|1|CA|A|2163, 6I7V|1|CA|C|2164, 6I7V|1|CA|U|2172
QA status
Valid loop

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

6I7V|1|CA|A|2108
6I7V|1|CA|U|2109
6I7V|1|CA|G|2110
6I7V|1|CA|U|2111
6I7V|1|CA|G|2112
6I7V|1|CA|U|2113
6I7V|1|CA|A|2114
6I7V|1|CA|G|2115
6I7V|1|CA|G|2116
6I7V|1|CA|A|2117
6I7V|1|CA|U|2118
6I7V|1|CA|A|2119
6I7V|1|CA|G|2120
6I7V|1|CA|G|2121
6I7V|1|CA|U|2122
6I7V|1|CA|G|2123
6I7V|1|CA|G|2124
6I7V|1|CA|G|2125
6I7V|1|CA|A|2126
6I7V|1|CA|G|2127
6I7V|1|CA|G|2128
*
6I7V|1|CA|C|2160
6I7V|1|CA|C|2161
6I7V|1|CA|G|2162
6I7V|1|CA|A|2163
6I7V|1|CA|C|2164
6I7V|1|CA|C|2165
6I7V|1|CA|U|2166
6I7V|1|CA|U|2167
6I7V|1|CA|G|2168
6I7V|1|CA|A|2169
6I7V|1|CA|A|2170
6I7V|1|CA|A|2171
6I7V|1|CA|U|2172
6I7V|1|CA|A|2173
6I7V|1|CA|C|2174
6I7V|1|CA|C|2175
6I7V|1|CA|A|2176
6I7V|1|CA|C|2177
6I7V|1|CA|C|2178
6I7V|1|CA|C|2179
6I7V|1|CA|U|2180
6I7V|1|CA|U|2181

Current chains

Chain CA
23S ribsomal RNA

Nearby chains

No other chains within 10Å

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.1017 s