IL_6YS3_044
3D structure
- PDB id
- 6YS3 (explore in PDB, NAKB, or RNA 3D Hub)
- Description
- Cryo-EM structure of the 50S ribosomal subunit at 2.58 Angstroms with modeled GBC SecM peptide
- Experimental method
- ELECTRON MICROSCOPY
- Resolution
- 2.58 Å
Loop
- Sequence
- GCCAGGAUGUUGGCUUAGAAGCAGCCAUCAUUUAAAGAAA*UCACUGGU
- Length
- 48 nucleotides
- Bulged bases
- 6YS3|1|b|A|1069, 6YS3|1|b|A|1071, 6YS3|1|b|U|1080, 6YS3|1|b|A|1086, 6YS3|1|b|A|1087, 6YS3|1|b|G|1089, 6YS3|1|b|A|1105
- QA status
- Valid loop
Sequence variability
-
If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
- R3DSVS
Structural variability across Equivalence Class
-
The link below will give the loop's structural variability across the equivalence class for this chain.
- R3DMCS EC
Structural variability across Rfam
-
If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
- R3DMCS Rfam
- Detailed Annotation
- No text annotation
- Broad Annotation
- No text annotation
- Motif group
- Not in a motif group
- Basepair signature
- Not available
- Number of instances in this motif group
- 0
Unit IDs
6YS3|1|b|G|1053
6YS3|1|b|C|1054
6YS3|1|b|C|1055
6YS3|1|b|A|1056
6YS3|1|b|G|1057
6YS3|1|b|G|1058
6YS3|1|b|A|1059
6YS3|1|b|U|1060
6YS3|1|b|G|1061
6YS3|1|b|U|1062
6YS3|1|b|U|1063
6YS3|1|b|G|1064
6YS3|1|b|G|1065
6YS3|1|b|C|1066
6YS3|1|b|U|1067
6YS3|1|b|U|1068
6YS3|1|b|A|1069
6YS3|1|b|G|1070
6YS3|1|b|A|1071
6YS3|1|b|A|1072
6YS3|1|b|G|1073
6YS3|1|b|C|1074
6YS3|1|b|A|1075
6YS3|1|b|G|1076
6YS3|1|b|C|1077
6YS3|1|b|C|1078
6YS3|1|b|A|1079
6YS3|1|b|U|1080
6YS3|1|b|C|1081
6YS3|1|b|A|1082
6YS3|1|b|U|1083
6YS3|1|b|U|1084
6YS3|1|b|U|1085
6YS3|1|b|A|1086
6YS3|1|b|A|1087
6YS3|1|b|A|1088
6YS3|1|b|G|1089
6YS3|1|b|A|1090
6YS3|1|b|A|1091
6YS3|1|b|A|1092
*
6YS3|1|b|U|1103
6YS3|1|b|C|1104
6YS3|1|b|A|1105
6YS3|1|b|C|1106
6YS3|1|b|U|1107
6YS3|1|b|G|1108
6YS3|1|b|G|1109
6YS3|1|b|U|1110
Current chains
- Chain b
- 23S rRNA
Nearby chains
- Chain 8
- 50S ribosomal protein L36
Coloring options: