Motif J3_08158.1 Version J3_08158.1 of this group appears in releases 3.88 to 3.97

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name		1		2		3		4		5		6		7		8		9		10		11		12		13		14		15		16		17		18		19		20	break		21		22		23		24		25		26		27		28		29		30	break		31		32		33		34		35		36	1-36	3-9	3-14	3-25	4-16	4-24	5-18	6-17	8-15	19-22	20-21	27-34	28-32	30-31
1	J3_7OSM_056	7OSM	0.0000	3	ASIT	tRNA	G	6	A	7	U	8	A	9	G	10	C	11	U	12	C	13	A	14	G	15	U	16	G	19	U	20	A	21	G	22	A	23	G	24	C	25	A	26	G	27	*	C	43	G	44	U	45	G	46	C	48	C	49	U	50	U	51	G	52	G	53	*	C	62	G	63	A	64	G	65	U	66	C	67	ncWW	ntWH	ntsS	ncsS	ncWB	ncHS	ncWW	ncWW	ncWW	ntHH	cWW	ncWW	ncWWa	cWW

3D structures

Complete motif including flanking bases

Sequence	Counts
GAUAGCUCAGUCGGUAGAGCAGCGUGUCCUUGGCGAGUC	1

Non-Watson-Crick part of the motif

Sequence	Counts
AUAGCUCAGUCGGUAGAGCAGUGUCCUUGGAGU	1

Release history

Release	3.88	3.89	3.90	3.91	3.92	3.93	3.94	3.95	3.96	3.97
Date	2024-09-11	2024-10-09	2024-11-06	2024-12-04	2025-01-01	2025-01-29	2025-02-26	2025-03-26	2025-04-23	2025-05-21
Status	New id, no parents	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (1)
Basepair signature: cWW-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-F-cWW-F-F-F
Heat map statistics: Min 0.00 | Avg 0.00 | Max 0.00

Help

Coloring options: Nucleotide numbers

Copyright 2025 BGSU RNA group. Page generated in 0.1012 s