#SLoop idPDBDisc#Non-coreChain(s)Standardized name 1 2 3break 4 5 6 7break 8 9break 10 11 12 13break 14 15 16 17 18 19 20 21 22 23 24break 25 26 27 28 29 30 31 32 331-332-33-44-325-337-89-1011-3013-1420-2820-3121-2722-2624-25
1 J6_5TBW_0025TBW0.000051 LSU rRNAU2416U2417A2419*U2611U2612U2613G2614*C2627A2628*U2650G2651U2652C2653*G2754C2755C2756U2757A2758U2759G2761A2762U2763C2764C2765*G2793G2794U2795G2796C2797C2798G2800A2803A2804cWWcWHcWWtsScWHcWWcWWcWWcWWtHhtSStHWtHWcWW

3D structures

Complete motif including flanking bases
SequenceCounts
UUGA*UUUG*CA*UGUC*GCCUAUCGAUCCGGUGCCAGAAAA1
Non-Watson-Crick part of the motif
SequenceCounts
UG*UU**GU*CCUAUCGAUCGUGCCAGAAA1

Release history

Release3.23.33.43.53.63.73.83.93.103.113.123.133.143.153.163.173.183.193.203.213.223.233.243.253.263.273.283.293.303.313.323.333.343.353.363.373.383.393.403.413.423.433.443.453.463.473.483.493.503.513.523.533.543.553.563.573.583.593.603.613.623.633.643.653.663.673.683.693.703.713.723.733.743.753.763.773.783.793.803.813.823.833.843.853.863.873.883.893.90
Date2018-02-092018-03-082018-04-062018-05-042018-06-012018-06-292018-07-272018-08-242018-09-212018-10-192018-11-162018-12-142019-01-112019-02-082019-03-082019-04-052019-05-032019-05-312019-06-282019-07-262019-08-232019-09-192019-10-162019-11-132019-12-112020-01-082020-02-052020-03-042020-04-012020-04-292020-05-272020-06-242020-07-222020-08-192020-09-162020-10-142020-11-112020-12-092021-01-062021-02-032021-03-032021-03-312021-04-282021-05-262021-06-232021-07-212021-08-182021-09-152021-10-132021-11-102021-12-082022-01-052022-02-022022-03-022022-03-302022-04-272022-05-252022-06-222022-07-202022-08-172022-09-142022-10-122022-11-092022-12-072023-01-042023-02-012023-03-012023-03-292023-04-262023-05-242023-06-212023-07-192023-08-162023-09-132023-10-112023-11-082023-12-062024-01-032024-01-312024-02-282024-03-272024-04-242024-05-222024-06-192024-07-172024-08-142024-09-112024-10-092024-11-06
StatusNew id, no parentsExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.
Annotations
  • (1)
  • Basepair signature
    cWW-F-F-F-cWW-F-cWW-F-F-cWW-tHH-tSS-tHW-F-tHW-cHW-F-cWW-tSS-cWW-cWH-cWW-F
    Heat map statistics
    Min 0.00 | Avg 0.00 | Max 0.00
    Help

    Coloring options:

    Copyright 2025 BGSU RNA group. Page generated in 0.0901 s