Motif J6_18258.1 Version J6_18258.1 of this group appears in releases 3.95 to 3.98

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name		1		2		3	break		4		5		6		7	break		8		9	break		10		11		12		13	break		14		15		16		17		18		19		20		21		22		23		24	break		25		26		27		28		29		30		31		32		33	1-33	2-3	3-4	4-32	5-33	7-8	9-10	11-19	11-30	13-14	20-28	20-31	21-27	22-26	24-25
1	J6_4V9F_002	4V9F	0.0000	5	0	LSU rRNA	U	2115	U	2116	A	2118	*	U	2276	U	2277	U	2278	G	2279	*	C	2292	G	2293	*	C	2315	G	2316	C	2317	C	2318	*	G	2421	U	2422	C	2423	U	2424	G	2426	C	2427	G	2428	A	2429	A	2430	C	2431	C	2432	*	G	2459	A	2460	U	2461	G	2462	A	2463	C	2464	G	2466	A	2469	A	2470	cWW	cWH	cWW	tsS	cWH	cWW	cWW	ntSW	cWW	cWW	tHh	tSS	tHW	cBW	cWW

3D structures

Complete motif including flanking bases

Sequence	Counts
UUUAUUUGCGCGCCGUCUAGCGAACCGAUGACAGAAAA	1

Non-Watson-Crick part of the motif

Sequence	Counts
UUUUGCUCUAGCGAACAUGACAGAAA	1

Release history

Release	3.95	3.96	3.97	3.98
Date	2025-03-26	2025-04-23	2025-05-21	2025-06-18
Status	New id, 1 parent	Exact match	Exact match	Exact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (1)
Basepair signature: cWW-cWH-cWH-tSS-cWW-tSS-cWW-F-F-tHH-cWW-tHW-F-cWW-cWW-F-F-F-cWW-F-F-F-F-F
Heat map statistics: Min 0.00 | Avg 0.00 | Max 0.00

Help

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/package.js

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/corejmol.z.js

JSmol exec jmolApplet0 start applet null

Jmol JavaScript applet jmolApplet0__210361178889289__ initializing

Jmol getValue debug null

Jmol getValue logLevel null

Jmol getValue allowjavascript null

AppletRegistry.checkIn(jmolApplet0__210361178889289__)

vwrOptions:

{ "name":"jmolApplet0","applet":true,"documentBase":"https://rna.bgsu.edu/rna3dhub/motif/view/J6_18258.1","platform":"J.awtjs2d.Platform","fullName":"jmolApplet0__210361178889289__","codePath":"https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//","display":"jmolApplet0_canvas2d","signedApplet":"true","appletReadyCallback":"Jmol._readyCallback","statusListener":"[J.appletjs.Jmol object]","syncId":"210361178889289","bgcolor":"white" }

setting document base to "https://rna.bgsu.edu/rna3dhub/motif/view/J6_18258.1"

Jmol Version: 14.4.4_2016.04.25 2016-04-26 17:41

java.vendor: Java2Script (HTML5)

java.version: 2016-04-21 14:47:41 (JSmol/j2s)

os.name: Mozilla/5.0 AppleWebKit/537.36 (KHTML, like Gecko; compatible; ClaudeBot/1.0; +claudebot@anthropic.com)

Access: ALL

memory: 0.0/0.0

processors available: 1

useCommandThread: false

appletId:jmolApplet0 (signed)

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/corescript.z.js

Jmol getValue emulate null

defaults = "Jmol"

Jmol getValue boxbgcolor null

Jmol getValue bgcolor white

backgroundColor = "white"

Jmol getValue ANIMFRAMECallback null

Jmol getValue APPLETREADYCallback Jmol._readyCallback

APPLETREADYCallback = "Jmol._readyCallback"

callback set for APPLETREADYCallback Jmol._readyCallback APPLETREADY

Jmol getValue ATOMMOVEDCallback null

Jmol getValue CLICKCallback null

Jmol getValue DRAGDROPCallback null

Jmol getValue ECHOCallback null

Jmol getValue ERRORCallback null

Jmol getValue EVALCallback null

Jmol getValue HOVERCallback null

Jmol getValue IMAGECallback null

Jmol getValue LOADSTRUCTCallback null

Jmol getValue MEASURECallback null

Jmol getValue MESSAGECallback null

Jmol getValue MINIMIZATIONCallback null

Jmol getValue SERVICECallback null

Jmol getValue PICKCallback null

Jmol getValue RESIZECallback null

Jmol getValue SCRIPTCallback null

Jmol getValue SYNCCallback null

Jmol getValue STRUCTUREMODIFIEDCallback null

Jmol getValue doTranslate null

language=en_US

Jmol getValue popupMenu null

Jmol getValue script null

Jmol getValue loadInline null

Jmol getValue load null

Jmol applet jmolApplet0__210361178889289__ ready

script 1 started

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/coretext.z.js

Script completed

Jmol script terminated

script 2 started